Abstract
Background and Objectives:
Pseudomonas aeruginosa is a frequent opportunistic pathogen in health care associated infections that is highly resistant to the majority of β-lactams. The aims of this study were to access the antimicrobial susceptibility pattern of P. aeruginosa isolated from educational hospitals of Qazvin and Alborz provinces, to determine the prevalence of metallo-β-lactamase (MBL) among carbapenem non-susceptible isolates by combined disk (CD) method, and to detect the blaIMP, blaVIM, blaSIM, blaGIM, blaSPM and blaNDM-1-MBL genes.
Materials and Methods:
In this cross-sectional study, 300 P. aeruginosa isolates were collected from different clinical specimens in two provinces of Qazvin and Alborz hospitals, Iran. After identification of isolates by standard laboratory methods, antimicrobial susceptibility was done against 17 antibiotics according to clinical and laboratory standards institute (CLSI) guideline. CD method was carried out for detection of MBLs and the presence of blaIMP, blaVIM, blaSIM, blaGIM, blaNDM-1 and blaSPM-genes was further assessed by PCR and sequencing methods.
Results:
In this study, 107 (35.66%) isolates were non-susceptible to imipenem and/or meropenem among those 56 (52.3%) isolates were metallo-β-lactamase producer. Twenty-four of 56 (42.85%) MBL-positive isolates were confirmed to be positive for MBL-encoding genes in which 14 (25%) and 10 (17.85%) isolates carried blaIMP-1 and blaVIM-1 genes either alone or in combination. Three (5.35%) isolates carried blaIMP and blaVIM genes, simultaneously.
Conclusion:
Considering the moderate prevalence and clinical importance of MBL-producing isolates, rapid identification and use of appropriate infection control (IC) measures are necessary to prevent further spread of infections by these resistant organisms.
Keywords: Pseudomonas aeruginosa, Antibiotic resistance, Metallo-β-lactamase
INTRODUCTION
Pseudomonas aeruginosa is one of the most prevalent opportunistic human pathogen causing several clinical infections including wound infection, pneumonia, urinary tract infections, endocarditis, meningitis, brain abscess, and bacteremia (1–3). The increasing inappropriate use of broad-spectrum antibiotics has increased the appearance of multidrug resistant P. aeruginosa (MDRPA) isolates which complicates the process of therapy and limits treatment options (4).
Multidrug resistant is defined as being resistant to at least 3 anti-pseudomonal antibiotic-groups including β-lactams, aminoglycosides, and fluoroquinolones (5). Carbapenems are antibiotics used for treatment of hospitalized patients infected with MDRPA (6). These antibiotics are a class of β-Lactam antibiotics with a broad spectrum of antibacterial activity and have the broadest antibacterial spectrum compared to other β-lactams such as penicillins and cephalosporins (7). However, the incidence of carbapenem resistance among clinical isolates of P. aeruginosa has been raised, predominantly due to production of carbapenemases, including the imipenem metallo-β-lactamase (IMP), VIM (Verona imipenemase), SPM (São Paolo metallo-β- lactamase), and GIM (German imipenemase) (3, 8).
MBLs were first formally categorized from serine β-lactamases in 1980 in molecular classification scheme proposed by Ambler (9). In 1989, Bush further classified MBLs into a separate group (group 3) according to their functional properties (10). The MBLs-mediated resistance is important emerging resistance mechanisms in P. aeruginosa and is therefore associated with significant morbidity and mortality (3, 11). MBL activity is inhibited by metal chelators, such as EDTA and THIOL compounds. These enzymes can hydrolyze most beta-lactam antibiotics including, penicillins, cephalosporins and carbapenems except monobactams (12, 13).
The blaIMP, blaVIM, blaSPM and blaNDM-1-encoding genes responsible for MBL production are horizontally transferable via plasmids and can rapidly spread to other bacteria (6). The first reported of mobile MBLs was with the discovery of P. aeruginosa strain GN17203 from Japan in 1988 (14). The IMP enzymes were originally detected in Asia, but later spread to Europe, to the United States and to Australia, while the VIM gene was first found in Europe, and shortly after emerged to other countries (3). The aims of this study were (i) to access the antimicrobial susceptibility of P. aeruginosa isolated from educational hospitals of Qazvin and Alborz provinces, (ii) to determine the prevalence of MBLs among carbapenem non-susceptible isolates by CD test, (iii) and to detect the blaIMP, blaVIM, blaSIM, blaGIM, blaSPM and blaNDM-1 genes in MBL-producing isolates.
MATERIALS AND METHODS
Study design and identification.
A total of 300 non-repetitive P. aeruginosa isolates were obtained from the different clinical specimens of patients admitted in Qazvin and Alborz educational hospitals. The bacterial isolates were collected from January of 2011 until November 2013. These isolates were identified by standard laboratory methods including bacteriologic and biochemical methods such as; Gram staining, oxidase test, growth at 42°C, growth on cetrimide agar medium (Liofilchem, Italy), O/F (Oxidation-Fermentation) test and pigment production (15). The isolates were collected from various clinical specimens including tracheal aspirate, urine, sputum, blood, wound, and bronco alveolar lavage. These isolates were stored at −70°C in trypticase soy broth containing 20% glycerol and sub cultured twice prior to testing.
Antimicrobial susceptibility testing.
This test was performed using Kirby-Bauer disc diffusion method according to the CLSI guideline (16). The following antibiotic discs were used: cefepime (30 μg), amikacin (30 μg), aztreonam (30 μg), polymyxin B (10 μg), imipenem (10 μg), meropenem (10 μg), gentamicin (10 μg), piperacillin/tazobactam (100/10μg), piperacillin (100 μg), ceftazidim (30 μg), cefotaxime (10 μg), ciprofloxacin (5 μg), levofloxacin (5 μg), ofloxacin (10 μg), ticarcillin (10 μg), carbenicillin (10 μg) and tobramycin (10 μg). Antibiotic discs were purchased from Mast (Mast Diagnostics Group Ltd, Merseyside, UK). P. aeruginosa ATCC 27853 was used as the quality control strain in antimicrobial susceptibility testing.
MBL screening and confirmation by phenotypic methods.
Kirby-Bauer disk diffusion test was performed in order to screen MBL production using imipenem (10μg) and meropenem (10 μg) disks. Isolates that were non-susceptible to carbapenem antibiotics in combined disc method, were used as a potential MBL producer. In brief a 0.5 M EDTA solution was prepared and then was added to 10 μg imipenem disks to obtain a concentration of 750 μg. The bacterial suspension equivalent to 0.5 Mc-Farland turbidity was prepared and was inoculated onto plates of Mueller–Hinton agar as recommended by the CLSI. The imipenem and imipenem-EDTA disks were placed on the plate. The inhibition zones of these disks with and without EDTA solution were compared after 16–18 hours of incubation in air at 35°C. An increase of ≥7 in the zone diameter for imipenem in the presence of EDTA was considered as positive result (13).
Detection of MBL-encoding genes by PCR and sequencing.
All MBL-producing isolates were subjected to PCR for detection of blaIMP-1, blaIMP-2, blaVIM-1, blaVIM-2, blaSPM, blaSIM, blaGIM and blaNDM-1 genes, using specific primers (Table 1) (17–19).
Table 1.
Oligonucleotide primers used in this study
| Genes | Sequence (5′→3′) | Reference |
|---|---|---|
| blaIMP-1F | ACCGCAGCAGAGTCTTTGCC | 17 |
| blaIMP-1 R | ACAACCAGTTTTGCCTTACC | |
| blaIMP-2 F | GTTTTATGTGTATGCTTCC | 17 |
| blaIMP-2 R | AGCCTGTTCCCATGTAC | |
| blaVIM-1 F | AGTGGTGAGTATCCGACAG | 17 |
| blaVIM-1 R | ATGAAAGTGCGTGGAGAC | |
| blaVIM-2 F | ATGTTCAAACTTTTGAGTAAG | 17 |
| blaVIM-2 R | CTACTCAACGACTGAGCG | |
| blaSPM-1 F | GCGTTTTGTTTGTTGCTC | 17 |
| blaSPM-1 R | TTGGGGATG TGAGACTAC | |
| blaGIM F | TCGACACACCTTGGTCTG | 18 |
| blaGIM R | AACTTCCAACTTTGCCAT | |
| blaSIM F | TACAAGGGATTCGGCATCC | 18 |
| blaSIM R | TAATGGCCTGTTCCCATG | |
| blaNDM-1 F | GGCGGAATGGCTCATCACGA | 19 |
| blaNDM-1 R | CGCAACACAGCCTGACTTTC |
Total DNAs were extracted by the DNA extraction kit (Bioneer Company-Korea). PCR amplifications were performed in a thermocycler (Applied Biosystems, USA) as follows: 95°C for 5min and 35 cycles of 1min at 95°C, 1min at specific annealing temperature for each primer and 1min at 72°C. A final extension step of 10 min at 72°C was performed. Amplification reactions were prepared in a total volume of 25μl (24μl of PCR master mix plus 1μl of template DNA) including 5ng of genomic DNA, 2.0U of Taq DNA polymerase, 10mM dNTP mix at a final concentration of 0.2mM, 50mM MgCl2 at a final concentration of 1.5mM, 1μM of each primer, and 1X PCR buffer (final concentration). PCR products were electrophoresed on 1% agarose gel and then were stained with ethidium bromide solution and finally visualized using gel documentation system (UVtec, UK). The purified PCR products were sequenced by the Macrogen Company (Seoul, South Korea) and the sequence alignment and analysis were performed online using the BLAST program of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov).
Statistical analysis.
Statistical data analysis was performed for descriptive statistics, including frequencies, cross tabulation of microbiological, clinical features and demographic characteristics using the computer software program SPSS version 16.
RESULTS
In this study, 96 (32 %) isolates were collected from the patients admitted to intensive care unit (ICU), 100 (33.3 %) infection diseases, 61 (20.3 %) internal medicine, 30 (10 %) surgery, 8 (2.7 %) neurosurgery and 5 (1.7 %) neurology wards. Our bacterial isolates were recovered from blood (108–36%), urine (91–30.33%), wound (34–11.33%), bronco alveolar lavage (23–7.66 %), trachea secretions (23–7.66%) and sputum (21–7%) samples. One hundred fifty-six patients (52%) were female and 144 (48%) were male. The mean age of the patients was 51.07±18.8 (range 18–90) years.
Antimicrobial susceptibility.
The high rates of antibiotic resistance were against cefotaxime (92.7 %) and aztreonam (57.7%). Polymyxin B, amikacin and piperacillin/tazobactam revealed high susceptibility rates of 98.3%, 71.3% and 64.7 %, respectively. One hundred one (33.7%) isolates were characterized as MDRPA i.e., were intermediate or resistance to at least three different classes of antimicrobial agents including β-lactams, aminoglycosides and fluoroquinolones. In total, 107 (35.66%) isolates were non-susceptible to imipenem and/or meropenem (Table 2).
Table 2.
Antimicrobial susceptibility of P. aeruginosa isolated from hospitals of Qazvin and Alborz provinces
|
Number (%) | |||
|---|---|---|---|
| Antibiotics | Resistant | Intermediate | Susceptible |
| Cefotaxime | (7%.52)158 | (40%)120 | (3%.7)22 |
| Aztreonam | (36%) 115 | (21.7%) 65 | (40%) 120 |
| Carbenicillin | (7%.51)155 | (7%.4)14 | (7%.43)131 |
| Levofloxacin | (7%.48)146 | (2%)6 | (3%.49)148 |
| Ofloxacin | (47%)141 | (7%.3)11 | (3%.49)148 |
| Ticarcillin | (3%.47)142 | (3%.2) 7 | (3%.50)151 |
| Ciprofloxacin | (3%.43)130 | (7%.3)11 | (53%)159 |
| Gentamicin | (7%.44)134 | (3%.1)4 | (54%)162 |
| Tobramycin | (7%.42)128 | (7%.1)5 | (7%.55)167 |
| Ceftazidime | (37%)111 | (3%.5)16 | (7%.57)173 |
| Piperacillin | (3%.32)97 | (7%.9)29 | (58%)174 |
| Meropenem | (35%)105 | (3%.5)16 | (7%.59)179 |
| Imipenem | (31%)93 | (7%)21 | (62%)186 |
| Cefepime | (33%) 99 | (4%)12 | (63%) 189 |
| Piperacillin/tazobactam | (7%.25)77 | (9.7%)29 | (64.7%)194 |
| Amikacin | (38.3%) 62 | (8%)24 | (71.3%) 214 |
| Polymyxin B | (1.7%)5 | 0 | (3%.98)295 |
Detection of MBL by CD and PCR methods.
Among 107 carbapenem non-susceptible P. aeruginosa isolates, 56 (52.3%) isolates were MBL producer. PCR and sequencing showed that 24 (42.85%) isolates were positive for MBL genotypes among those 14 (25%) isolates and 10 (17.85%) isolates carried blaIMP-1 and blaVIM-1 genes either alone or in combination. Three (5.35%) isolates carried both the blaIMP-1 and blaVIM-1 genes, simultaneously. Isolates were negative for blaIMP-2, blaVIM-2, blaGIM, blaSIM, blaNDM-1 and blaSPM genes (Table 3).
Table 3.
Case histories and characteristics of the 24 blaIMP and blaVIM-producing P. aeruginosa isolates collected from Qazvin and Alborz hospitals
| Isolates | Age (yr)/gender | Ward | Source | Antibiotic susceptibility profile | MBL genes |
|---|---|---|---|---|---|
| P.A 16 | 71/F | ICU | Blood | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= S, ATM=R, LEV=R, PRL=R,CPD= R | blaVIM-1 |
| P.A 26 | 32/M | Internal | Blood | IMP= R,MEM= R, CPM= R, AMK= S, CTX= I, CAZ= S, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= S, ATM=I, LEV=R, PRL=R,CPD= R | blaVIM-1 |
| P.A 76 | 62/F | Infection | Urine | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= I, OFX= R, TN= R, ATM=I, LEV=R, PRL=I,CPD= R | blaVIM-1 |
| P.A 77 | 47/M | Infection | Wound | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= R, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaVIM-1 |
| P.A 79 | 49/F | Infection | Urine | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaVIM-1 |
| P.A 92 | 29/F | ICU | BAL | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 |
| P.A 113 | 30/M | Infection | Urine | IMP= R,MEM= I, CPM= S, AMK= S, CTX= R, CAZ= S, TC= R, CIP= S, GM=R, PB= S, PTZ= S, OFX= R, TN= R, ATM=S, LEV=R, PRL=S,CPD= R | blaVIM-1 |
| P.A 117 | 24/F | Infection | Blood | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= S, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 + blaVIM-1 |
| P.A 123 | 50/F | Surgery | Wound | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 |
| P.A 124 | 47/M | Infection | Urine | IMP= R,MEM= R, CPM= R, AMK= S, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= I, OFX= R, TN= R, ATM=I, LEV=R, PRL=R,CPD= R | blaIMP-1 |
| P.A 159 | 33/F | Infection | Blood | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 |
| P.A 179 | 57/F | Internal | Urine | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 + blaVIM-1 |
| P.A 183 | 46/F | ICU | BAL | IMP= R,MEM= R, CPM= R, AMK= I, CTX= R, CAZ= R, TC= S, CIP= R, GM=R, PB= S, PTZ= S, OFX= S, TN= R, ATM=R, LEV=S, PRL=S,CPD= R | blaIMP-1 |
| P.A 196 | 24/F | Infection | Blood | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 |
| P.A 198 | 36/F | Internal | Blood | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 |
| P.A 207 | 42/F | ICU | Urine | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 |
| P.A 212 | 33/F | Internal | Blood | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= I, OFX= R, TN= S, ATM=I, LEV=R, PRL=R,CPD= R | blaIMP-1 |
| P.A 224 | 61/M | Infection | Urine | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=S,CPD= R | bla IMP-1 + blaVIM-1 |
| P.A 241 | 39/M | Surgery | Blood | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= I, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= S, ATM=R, LEV=R, PRL=R,CPD= R | blaVIM-1 |
| P.A 242 | 59/F | ICU | Blood | IMP= R,MEM= R, CPM= R, AMK= I, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=I,CPD= R | blaIMP-1 |
| P.A 278 | 61/M | Infection | Urine | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= S, OFX= S, TN= S, ATM=S, LEV=S, PRL=S,CPD= R | blaIMP-1 |
| P.A 283 | 74/F | ICU | Blood | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= R, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 |
| P.A 292 | 37/F | Internal | Urine | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= I, OFX= R, TN= R, ATM=R, LEV=R, PRL=I,CPD= R | blaIMP-1 |
| P.A 295 | 77/M | Surgery | Wound | IMP= R,MEM= R, CPM= R, AMK= R, CTX= R, CAZ= R, TC= R, CIP= R, GM=R, PB= S, PTZ= I, OFX= R, TN= R, ATM=R, LEV=R, PRL=R,CPD= R | blaIMP-1 |
R: Resistance; I: Intermediate; S: Susceptible; ATM: Aztreonam; CTX: Cefotaxime; CAZ: Ceftazidime; PIP: Piperacillin; TZP: Piperacillin-tazobactam; CPM: Cefepime; GEN: Gentamicin; CIP: Ciprofloxacin; LEV: Levofloxacin; AMK: Amikacin; MEM: Meropenem; IPM: Imipenem; PB: Polymyxin B; TN: Tobramycin; OFX: Ofloxacin; TC: Ticarcillin; PY: Carbenicillin
DISCUSSION
Despite the rapid development of antibiotics and improvement in supportive care, P. aeruginosa remains one of the most serious health care associated infections with high rate of mortality and morbidity. This organism exhibits high rates of resistance to the several classes of antimicrobial agents (20). Carbapenems (imipenem and meropenem) are the most active agents for treating of nosocomial infections caused by P. aeruginosa isolates (3). However, the emergence of carbapenem resistant P. aeruginosa isolates has become a serious clinical concern because of its intrinsic and acquired resistance mechanisms, limiting the treatment options (21). MBLs are increasingly widespread around worldwide as important mechanisms of carbapenem resistance among P. aeruginosa (3, 6, 22).
In the present study, antimicrobial susceptibility results showed that 33.7% isolates were MDRPA with significant rate of resistance against common used antibiotics. These findings are in agreement with results of previous studies in Iran, which reported that P. aeruginosa isolates are resistant to many classes of antibiotics (23, 24).
Overall, resistance to imipenem and/or meropenem was 35.66% which is higher than results of other studies have been reported by Shahcheraghi et al. (12.4%) and Japoni et al. (30%) in Iran (24, 25), but lower than that found in two previous studies carried out by Sepehriseresht et al. (56%) and Khosravi (41%) et al. in burn patients in Iran (26, 27). The varied range in susceptibility rate of carbapenems among P. aeruginosa isolates in different studies could be because of varied antibiotic usage profiles in different geographic regions. These results indicate that the available choices for the appropriate treatment of infection caused by MDRPA are currently limited.
In this study, 52.3% of carbapenem non-susceptible isolates were MBL producers which are higher than those reported by Khosravi et al. from Iran (19.5%) (27), Nagaveni et al. from India (20.8%) (28), Ellington et al. from UK (38.3%) (29) and Pitout et al. from Germany (46%) (30), indicating the MBL-producing P. aeruginosa is increasing. It should be noted that 48.7% of carbapenem resistant P. aeruginosa were MBL negative which suggest other mechanisms might alternatively be contributed in the carbapenem resistance, most importantly production of oxacilinase or deficiency in porin or reduced expression of outer membrane proteins (3). We previously reported that 31 (49%) of A. baumannii isolates were found to be MBL producers (31).
In the present study, of 56 MBL-producing isolates, 24 (42.85%) isolates were positive for MBL geno-types which 14 (25%) isolates and 10 (17.85%) isolates carried blaIMP-1 and blaVIM-1 genes either alone or in combination. In recent years, blaIMP and blaVIM-producing P. aeruginosa isolates have been reported in Asian countries. In a study from Iran, Sarhangi et al. reported that 8 (9.75%) and 10 (12.19%) of MBL-producing P. aeruginosa isolates were positive for blaIMP-1 and blaVIM-1 genes, respectively (32). In another study from Iran, Khosravi et al. reported that 19.51% of clinical isolates of P. aeruginosa contained blaVIM gene (27).In South Korea, Oh et al. reported that 82.85% and 5.71% of P. aeruginosa isolates harbored blaVIM-2 and blaIMP-1 genes, respectively (33). In another study from South Korea, Ryoo et al. reported that 15.6% of P. aeruginosa isolates harbored blaIMP-1 and 8.6% of isolates harbored blaVIM-2 (34). In Turkey, Ozqumus et al. reported that 9% and 1% of P. aeruginosa isolates were positive for blaIMP-1 and blaVIM genes, respectively (35). In France, Pitout et al. showed that 43% and 2% of P. aeruginosa isolates carried blaVIM and blaIMP genes, respectively (30).
This study showed that most blaIMP-1 and blaVIM-1-positive P. aeruginosa isolates were frequently collected from the patients admitted to intensive care and infection disease units. It seems that chronic underlying conditions, prolonged period of ICU stay and the use of invasive techniques and devices predispose patients to infection with these resistant isolates.
In conclusion, results of this study revealed the considerable prevalence of MBL-producing P. aeruginosa isolates in our hospital settings. Moreover, the MBL-encoding genes often carried by mobile genetic elements which can rapidly spread horizontally between different strains. However, early recognition of MBL-producing isolates and establishing tactful policies associated with infection control measures and appropriate antimicrobial therapy based on laboratory data are necessary to reduce further spread of these resistant bacteria in our hospitals.
Acknowledgements
This study was financially supported by the Cellular and Molecular Research Center and Research Deputy of Qazvin University of Medical Sciences, Qazvin, Iran.
REFERENCES
- 1. Sako S, Kariyama R, Mitsuhata R, Yamamoto M, Wada K, Ishii A, et al. Molecular epidemiology and clinical implications of metallo-β-lactamase-producing Pseudomonas aeruginosa isolated from urine. Acta Med Okayama 2014;68: 89– 99. [DOI] [PubMed] [Google Scholar]
- 2. Bisbe J, Gatell JM, Puig J, Mallolas J, Martinez JA, Jimenez de Anta MT, et al. Pseudomonas aeruginosa bacteremia: univariate and multivariate analyses of factors influencing the prognosis in 133 episodes. Rev Infect Dis 1988;10: 629– 635. [DOI] [PubMed] [Google Scholar]
- 3. Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-β-lactamases, the quiet before the storm? Clin Microbiol Rev 2005; 18: 306– 25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Bratu S, Quale J, Cebular S, Heddurshetti R, Land-man D. Multidrug resistant Pseudomonas aeruginosa in Brooklyn, New York: molecular epidemiology and in vitro activity of polymyxin B. Eur J Clin Microbiol Infect Dis 2005;24: 196– 201. [DOI] [PubMed] [Google Scholar]
- 5. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 2012;18: 268– 281 [DOI] [PubMed] [Google Scholar]
- 6. Nordmann P, Poirel L. Emerging carbapenemases in gram-negative aerobes. Clin Microbial Infect 2002;8: 321– 31. [DOI] [PubMed] [Google Scholar]
- 7. Lagatolla C, Tonin EA, Monti-Bragadin C, Dolzani L, Gombac F, Bearzi C, et al. Endemic carbapenem-resistant Pseudomonas aeruginosa with acquired metal-lo-beta-lactamase determinants in European hospital. Emerg Infect Dis 2004;10: 535– 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev 2007;20: 440– 458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Ambler RP. The structure of β-lactamases. Philos Trans R Soc Lond B Biol Sci 1980;289: 321– 331. [DOI] [PubMed] [Google Scholar]
- 10. Bush K. Classification of beta-lactamases: groups 2c, 2d, 2e, 3, and 4. Antimicrob Agents Chemother 1989;33: 271– 6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Peleg AY, Franklin C, Bell JM, Spelmann DW. Dissemination of the metallo-β-lactamase gene bla IMP4 among gram-negative pathogens in a clinical setting in Australia. Clin Infect Dis 2005;41: 1549– 56. [DOI] [PubMed] [Google Scholar]
- 12. Arakawa Y, Shibata N, Shibayama K, Kurokawa H, Yagi T, Fujiwara H, et al. Convenient test for screening metallo-β-lactamase-producing gram-negative bacteria by using thiol compounds. J Clin Microbiol 2000;38: 40– 43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Yong D, Lee K, Yum JH, Shin HB, Rossolini GM, Chong Y. Imipenem-EDTA disk method for differentiation of metallo-β-lactamase-producing clinical isolates of Pseudomonas spp. and Acinetobacter spp. J Clin Microbiol 2002;40: 3798– 3801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Watanabe M, Iyobe S, Inoue M, Mitsuhashi S. Transferable imipenem resistance in P. aeruginosa. Antimicrob Agents Chemother 1991; 35: 147– 51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Mahon CR, Lehman DC, Manuselis G. Textbook of diagnostic microbiology. 4th ed Maryland Heights, Mo.: Saunders/Elsevier; 2011. [Google Scholar]
- 16. Clinical and Laboratory Standards Institute Performance standards for antimicrobial susceptibility testing: seventeenth informational supplement M100-S23. USA: Wayne, PA; 2013. [Google Scholar]
- 17. Shibata N, Doi Y, Yamane K, Yagi T, Kurokawa H, Shibayama K, et al. Y. PCR typing of genetic determinants for metallo-β-lactamases and integrases carried by gram-negative bacteria isolated in Japan, with focus on the class 3 integron. J Clin Microbiol 2003; 41: 5407– 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Jovcic B, Lepsanovic Z, Suljagic V, Rackov G, Begovic J, Topisirovic L, et al. Emergence of NDM-1 metal-lo-β-lactamase in Pseudomonas aeruginosa clinical isolates from Serbia. Antimicrob Agents Chemother 2011; 55: 3929– 31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Chen Y, Zhou Z, Jiang Y, Yu Y. Emergence of NDM-1-producing Acinetobacter baumannii in China. J Antimicrob Chemother 2011; 66: 1255– 9. [DOI] [PubMed] [Google Scholar]
- 20. Jones RN, Kirby JT, Beach ML, Biedenbach DJ, Pfaller MA. Geographic variations in activity of broad spectrum β-lactams against Pseudomonas aeruginosa: summary of the worldwide SENTRY antimicrobial surveillance program (1997–2000). Diagn Microbiol Infect Dis 2002;43: 239– 243. [DOI] [PubMed] [Google Scholar]
- 21. Saderi H, Lotfalipour H, Owlia P, Salimi H. Detection of metallo-β-Lactamase producing Pseudomonas aeruginosa isolated from burn patients in Tehran, Iran. Lab Medicine 2010;41: 609– 12. [Google Scholar]
- 22. Hancock RE. Resistance mechanisms in Pseudomonas aeruginosa and other non-fermentative gram negative bacteria. Clin Infect Dis 1998;27: S93– 9. [DOI] [PubMed] [Google Scholar]
- 23. Tavajjohi Z, Moniri R. Detection of ESBLs and MDR in Pseudomonas aeruginosa in a tertiary-care teaching hospital. Arch Clin Infect Dis 2011;6: 18– 23. [Google Scholar]
- 24. Japoni A, Alborzi A, Kalani M, Nasiri J, Hayati M, Farshad SH. Susceptibility patterns and cross-resistance of antibiotics against Pseudomonas aeruginosa isolated from burn patients in the south of Iran. Burns 2006;32: 343– 347. [DOI] [PubMed] [Google Scholar]
- 25. Shahcheraghi F, Nikbin VS, Feizabadi MM. Identification and genetic characterization of metallo-β-lactamase -producing strains of Pseudomonas aeruginosa in Tehran, Iran. New Microbiol 2010;33: 243– 248. [PubMed] [Google Scholar]
- 26. Sepehriseresht S, Boroumand MA, Pourgholi L, Sotoudeh Anvari M, Habibi E, Sattarzadeh Tabrizi M. Detection of vim- and ipm-type metallo-β-lactamases in Pseudomonas aeruginosa clinical isolates. Arch Iran Med 2012;15: 670– 673. [PubMed] [Google Scholar]
- 27. Khosravi AD, Mihani F. Detection of metallo betalactamase- producing Pseudomonas aeruginosa strains isolated from burn patients in Ahwaz, Iran. Diagn Microbiol Infect Dis 2008;60: 125– 8. [DOI] [PubMed] [Google Scholar]
- 28. Nagaveni S, Rajeshwari H, Oli AK, Patil SA, Chandrakanth RK. Widespread emergence of multidrug resistant Pseudomonas aeruginosa isolated from CSF samples. Indian J Microbiol 2011;51: 2– 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Ellington MJ, Kistler J, Livermore DM, Woodford N. Multiplex PCR for rapid detection of genes encoding acquired metallo-β-lactamases. J Antimicrob Chemother 2007;59: 321– 322. [DOI] [PubMed] [Google Scholar]
- 30. Pitout JD, Gregson DB, Poirel L, McClure JA, Le P, Church DL. Detection of Pseudomonas aeruginosa producing metallo-β-lactamase s in a large centralized laboratory. J Clin Microbiol 2005;43: 3129– 35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Peymani A, Nahaei MR, Farajnia S, Hasani A, Mirsalehian A, Sohrabi N, et al. High prevalence of metallo-β-lactamase -producing Acinetobacter baumannii in a teaching hospital in Tabriz, Iran. Jpn J Infect Dis 2011;64: 69– 71. [PubMed] [Google Scholar]
- 32. Sarhangi M, Motamedifar M, Sarvari J. Dissemination of Pseudomonas aeruginosa Producing blaIMP1, blaVIM2, blaSIM1, blaSPM1 in Shiraz, Iran. Jundishapur J Microbiol 2013; 6: e6920. [Google Scholar]
- 33. Oh EJ, Lee S, Park YJ, Park JJ, Park K, Kim SI, et al. Prevalence of metallo-beta-lactamase among Pseudo-monas aeruginosa and Acinetobacter baumannii in a Korean university hospital and comparison of screening methods for detecting metallo-β-lactamase. J Microbiol Methods 2003;54: 411– 418. [DOI] [PubMed] [Google Scholar]
- 34. Ryoo NH, Ha JS, Jeon DS, Kim JR. Prevalence of Metallo-β-lactamases in Imipenem-non-susceptible Pseudomonas aeruginosa and Acinetobacter baumannii. Korean J Clin Microbiol 2010;13: 169– 172. [Google Scholar]
- 35. Ozgumus OB, Caylan R, Tosun I, Sandalli C, Aydin K, Koksal I. Molecular epidemiology of clinical Pseudomonas aeruginosa isolates carrying IMP-1 metallo-β-lactamase gene in a University Hospital in Turkey. Microb Drug Resist 2007;13: 191– 198. [DOI] [PubMed] [Google Scholar]