Abstract
Objective
We explored the relationship between HLA-DRB1 allele polymorphisms and familial aggregation of hepatocellular carcinoma (fhcc).
Methods
Polymerase chain reaction sequence-specific primers were used to determine HLA-DRB1 genotypes for 130 members of families with 2 or more liver cancer patients and for 130 members of families without any diagnosed cancers. The genotype profiles were then compared to explore the relationship between HLA-DRB1 gene polymorphism and fhcc.
Result
Of 11 selected alleles, the frequencies of DRB1*11 and DRB1*12 were significantly lower in the fhcc group than in no-cancer group (p < 0.05; odds ratio: 0.286; 95% confidence interval: 0.091 to 0.901; and odds ratio: 0.493; 95% confidence interval: 0.292 to 0.893). Differences in the frequencies of the other 9 alleles were not statistically significant in the two groups (p > 0.05).
Conclusions
Our research suggests that if genetic factors play a role in fhcc, the deficiency in the DRB1*11 and DRB1*12 alleles might be the risk factor at work in Guangxi Zhuang Autonomous Region, P.R.C.
Keywords: HLA-DRB1 alleles, polymorphisms, hepatocellular carcinoma, familial aggregation, pcr-ssp
INTRODUCTION
Hepatocellular carcinoma (hcc) is the most common primary tumour of liver. Worldwide, hcc constitutes an important problem for health care systems because of its high morbidity, mortality, and increasing incidence1. It is the 5th most common cancer in men, the 7th most common in women, and the 3rd most frequent cause of cancer death. Estimates suggest that the incidence of hcc will continue to rise into the foreseeable future2. This aggressive tumour usually develops in a cirrhotic liver with limited functional reserve, and without treatment, survival after diagnosis is short.
Rates of hcc are particularly high in East and Southeast Asia and in Africa, intermediate in southern Europe, and low in most high-income countries. The incidence of hcc and the distribution of hcc risk factors vary widely by geographic region. China and Africa are areas of high hcc incidence, where the primary cause of hcc is chronic infection with the hepatitis B virus (hbv), with dietary exposure to aflatoxin being an important cofactor. In areas of low hcc incidence (including Europe and North America), diverse environmental factors including chronic infection with hbv or hepatitis C virus (hcv), heavy alcohol use, diabetes, obesity, and tobacco use have been shown to contribute to the local burden of hcc3–5. However, the facts that only a small proportion of the people with established risk factors eventually develop hcc and that hcc can cluster within families both suggest that genetic factors might play a role in the development of hcc.
To date, many genetic factors have been reported to be related to a susceptibility to hcc: polymorphisms of tumour necrosis factor α6,7, of epidermal growth factor and epidermal growth factor receptor8,9, of the transforming growth factor β1 gene10, and of major histocompatibility complex (mhc) or human leucocyte antigen (hla)11–15, among others. Of the foregoing genetic factors, mhc plays a key role in antivirus activity and tumour defense. The function of hla is to regulate the immune response to foreign antigens and to discriminate self from non-self antigens. The hlas are encoded by a series of closely linked genetic loci found on chromosome 616,17. Polymorphism in hla is implicated in conferring genetic susceptibility to a large number of immune-mediated diseases, including some cancers.
Statistical data show that half of all new hcc cases and deaths reported worldwide occur in China, where the case distribution has obvious regional differences. An epidemiologic investigation indicated that the incidence of, and mortality from, liver cancer in Guangxi are significantly higher than the national average, and liver cancer in Guangxi showed a tendency toward familial aggregation (fhcc). Most patients with hcc had family history of liver cancer. The risk of developing hcc increased greatly when 1st- and 2nd-degree relatives also had the disease. We therefore designed a project to probe the relationship between HLA-DRB1 allele polymorphisms and fhcc.
METHODS
Our project was approved by the National Natural Science Foundation of China and the Science Foundation of the Health Bureau of Guangxi Zhuang Autonomous Region. It enrolled 260 healthy individuals with no known disease, among whom many had various degrees of consanguinity. All subjects came from 11 areas of high hcc incidence in Guangxi. Of the 260 enrolled participants, 130 were members of 34 families considered to show fhcc (all included 2 or more hcc patients), and 130 were members of 37 families considered to have no familial cancers (control group). The control participants were matched with the fhcc participants in terms of age (±5 years), presence of the hbv surface antigen (HBsAg), ethnicity, residence, and sex.
When patients were diagnosed with liver cancer at our hospital, we collected their information and subsequently contacted healthy members of their families and other families in their towns of the same ethnicity and residence. Using epidemiology questionnaires, we then obtained basic personal and demographic information and information about risk factors for liver cancer from the healthy individuals. Using the personal information, we created family trees. At the same time, we collected 5-mL samples of non-anticoagulated blood so that serum could be separated for the detection of markers of hbv, anti-hcv, alanine transaminase, aspartate transaminase, albumin, and so on. In the morning, another 5 mL of fasting venous blood was collected in anticoagulant tubes, and dna for genome study was extracted.
We used polymerase chain reaction (pcr) sequence-specific primers (ssps) to determine the HLA-DRB1 genotype for the 130 fhcc participants and the 130 non-cancer participants. The genotypes were then compared to explore the relationships between HLA-DRB1 gene polymorphisms and fhcc participants. We selected certain HLA-DRB1 alleles that had been reported to be associated with hcc, and sequence-specific primers were designed based on reference sequences from the GeneBank database and from Olerup and Zetterquist18. The primers (Table i) were then synthesized by Shanghai Sangon Biological Engineering Technology and Services (Shanghai, P.R.C.).
TABLE I.
Sequence-specific primers for HLA-DRB1 alleles
| Allele | Primer sequences | PCR product size (bp) | |
|---|---|---|---|
|
| |||
| 5′-Sequence 5′→3′ | 3′-Sequence 5′→3′ | ||
| DRB1*03 | TACTTCCATAACCAGGAGGAGA | TGCAGTAGTTGTCCACCCG | 151 |
| DRB1*04 | GTTTCTTGGAGCAGGTTAAACA | CTGCACTGTGAAGCTCTCAC | 260 |
| DRB1*07 | CCTGTGGCAGGGTAAGTATA | CCCGTAGTTGTGTCTGCACAC | 232 |
| DRB1*08 | AGTACTCTACGGGTGAGTGTT | CTGCAGTAGGTGTCCACCAG | 214 |
| DRB1*09 | GTTTCTTGAAGCAGGATAAGTT | CCCGTAGTTGTGTCTGCACAC | 236 |
| DRB1*11 | GTTTCTTGGAGTACTCTACGTC | CTGGCTGTTCCAGTACTCCT | 176 |
| DRB1*12 | ACTCTACGGGTGAGTGTT | ACTGTGAAGCTCTCCACAG | 244 |
| DRB1*13 | TACTTCCATAACCAGGAGAGA | CCCGCTCGTCTTCCAGGAT | 130 |
| DRB1*14 | GTTTCTTGCAGTACTCTACGTC | TCTGCAATAGGTGTCCACCT | 224 |
| DRB1*15 | TCCTGTGGCAGCCTAAGAG | CCGCGCCTGCTCCAGGAT | 197 |
| DRB1*16 | TCCTGTGGCAGCCTAAGAG | CTCCGTCACCGCCCGGT | 137 |
| HGF | CAGTGCCTTCCCAACCATTCCCTTA | ATCCACTCACGGATTTCTGTTGTGTTTC | 432 |
PCR = polymerase chain reaction.
The conventional phenol chloroform and proteinase K method using Promega kits (Madison, WI, U.S.A.) was applied to extract genomic dna from peripheral blood lymphocytes. The dna concentration was determined by ultraviolet spectrophotometer and subsequently adjusted to 1 μg/μL.
Every pcr reaction tube contained genomic dna; a pcr mix (including Taq polymerase, deoxyribose nucleoside triphosphate, and Taq buffer); 5′-ssp and 3′-ssp of each HLA-DRB1 allele, and 5′-ssp and 3′-ssp of the reference sequence; and human growth factor, which was the housekeeping gene in our genomic dna. Tables ii and iii present complete information for every reaction tube and the pcr conditions for each HLA-DRB1 allele. The pcr product was analyzed in 2% agarose gel. The SPSS statistical software package (version 16.0: SPSS, Chicago, IL, U.S.A.) was used for data analysis.
TABLE II.
Specific polymerase chain reaction system for HLA-DRB1 alleles
| Allele | Premix Taq (μL) | Reference (μL) | Primer (μL) | ddH2O (μL) | DNA (μL) | ||
|---|---|---|---|---|---|---|---|
|
|
|
||||||
| 5′-SSP | 3 ′-SSP | 5 ′-SSP | 3 ′-SSP | ||||
| DRB1*03 | 12.5 | 0.5 | 0.5 | 0.3 | 0.3 | 8.9 | 2 |
| DRB1*04 | 12.5 | 0.5 | 0.5 | 0.3 | 0.3 | 8.9 | 2 |
| DRB1*07 | 12.5 | 0.4 | 0.4 | 0.5 | 0.5 | 8.2 | 2 |
| DRB1*08 | 12.5 | 0.6 | 0.6 | 0.2 | 0.2 | 8.9 | 2 |
| DRB1*09 | 12.5 | 0.4 | 0.4 | 0.5 | 0.5 | 8.2 | 2 |
| DRB1*11 | 12.5 | 0.3 | 0.3 | 0.4 | 0.4 | 9.1 | 2 |
| DRB1*12 | 12.5 | 0.3 | 0.3 | 0.5 | 0.5 | 8.9 | 2 |
| DRB1*13 | 12.5 | 0.2 | 0.2 | 0.7 | 0.7 | 9.7 | 1 |
| DRB1*14 | 12.5 | 0.3 | 0.3 | 0.4 | 0.4 | 9.1 | 2 |
| DRB1*15 | 12.5 | 0.5 | 0.5 | 0.5 | 0.5 | 8.5 | 2 |
| DRB1*16 | 12.5 | 0.6 | 0.6 | 0.2 | 0.2 | 8.9 | 2 |
SSP = single specific primer; ddH2O = double-distilled water.
TABLE III.
Specific polymerase chain reaction amplification conditions for HLA-DRB1 alleles
| Allele | Initial denaturation (°C, min.) | Circulation (°C, s) | Cycles (n) | Last elongation (°C, min.) | ||
|---|---|---|---|---|---|---|
|
| ||||||
| Denaturation | Renaturation | Elongation | ||||
| DRB1*03 | 94, 3 | 94, 30 | 59, 40 | 72, 60 | 35 | 72, 5 |
| DRB1*04 | 94, 3 | 94, 30 | 58, 40 | 72, 60 | 35 | 72, 5 |
| DRB1*07 | 94, 5 | 94, 35 | 57.5, 35 | 72, 60 | 35 | 72, 10 |
| DRB1*08 | 94, 3 | 94, 30 | 61, 40 | 72, 60 | 35 | 72, 5 |
| DRB1*09 | 94, 3 | 94, 30 | 58, 30 | 72, 60 | 35 | 72, 5 |
| DRB1*11 | 94, 3 | 94, 30 | 60, 30 | 72, 60 | 35 | 72, 5 |
| DRB1*12 | 94, 3 | 94, 35 | 59, 35 | 72, 60 | 35 | 72, 10 |
| DRB1*13 | 94, 3 | 94, 35 | 56, 35 | 72, 60 | 38 | 72, 5 |
| DRB1*14 | 94, 5 | 94, 50 | 58, 40 | 72, 60 | 36 | 72, 10 |
| DRB1*15 | 94, 5 | 94, 50 | 58, 40 | 72, 60 | 35 | 72, 10 |
| DRB1*16 | 94, 3 | 94, 30 | 56, 40 | 72, 60 | 35 | 72, 5 |
RESULTS
Table iv shows the frequencies of the HLA-DRB1 alleles. We detected a total of 11 alleles at the HLA-DRB1 locus in members of the fhcc families and the non-fhcc families. Chi-squares and odds ratios (ors) were calculated for each allele. The frequency of the DRB1*11 allele was 3.08% (4 of 130) in the fhcc group and 10% (13 of 130) in the no-fhcc group, a difference between the groups that is statistically significant [p < 0.05; or: 0.286; 95% confidence interval (ci): 0.091 to 0.901]. The frequency of the DRB1*12 allele in the two groups was 16.92% (22 of 130) and 29.23% (38 of 130) respectively, another statistically significant difference (p < 0.05; or: 0.493; 95% ci: 0.292 to 0.893). The significantly lower frequencies of DRB1*11 and DRB1*12 in the fhcc group might indicate that those alleles confer some resilience against hcc.
TABLE IV.
Distribution of HLA-DRB1 alleles in the case and control groups
| Allele | Polymerase chain reaction results for ... | p Value | OR | 95% CI | |||
|---|---|---|---|---|---|---|---|
|
| |||||||
| Cases (fHCC) | Controls (no fHCC) | ||||||
|
|
|
||||||
| Positive | Negative | Positive | Negative | ||||
| DRB1*03 | 21 | 109 | 24 | 106 | 0.358 | 0.739 | 0.386 to 1.412 |
| DRB1*04 | 15 | 115 | 12 | 118 | 0.542 | 1.283 | 0.576 to 2.858 |
| DRB1*07 | 1 | 129 | 3 | 127 | 0.622 | 0.328 | 0.034 to 3.197 |
| DRB1*08 | 9 | 121 | 6 | 124 | 0.425 | 1.537 | 0.531 to 4.450 |
| DRB1*09 | 24 | 106 | 22 | 108 | 0.745 | 1.111 | 0.588 to 2.103 |
| DRB1*11 | 4 | 126 | 13 | 117 | 0.024# | 0.286 | 0.091 to 0.901 |
| DRB1*12 | 22 | 108 | 38 | 92 | 0.019& | 0.493 | 0.272 to 0.893 |
| DRB1*13 | 3 | 127 | 4 | 126 | 0.702 | 0.744 | 0.163 to 3.392 |
| DRB1*14 | 42 | 88 | 29 | 101 | 0.70 | 1.662 | 0.956 to 2.889 |
| DRB1*15 | 56 | 74 | 47 | 83 | 0.254 | 1.336 | 0.812 to 2.200 |
| DRB1*16 | 24 | 106 | 23 | 107 | 0.872 | 1.053 | 0.560 to 1.981 |
fHCC = familial hepatocellular carcinoma; OR = odds ratio; CI = confidence interval.
With respect to the other 9 alleles, the difference in frequency between the two groups was statistically non-significant (p > 0.05): DRB1*03 (16.15%, 18.46%), DRB1*04 (11.53%, 9.23%), DRB1*07 (0.76%, 2.36%), DRB1*08 (6.92%, 4.62%), DRB1*09 (18.46%, 16.92%), DRB1*13 (2.31%, 3.08%), DRB1*14 (32.31%, 22.31%), DRB1*15 (43.08%, 36.15%), and DRB1*16 (18.46%, 17.69%).
We also determined the frequencies of the DRB1*11 and DRB1*12 alleles in the study participants who had been infected with hbv, dividing them into groups depending on whether they were HBsAg-positive or -negative (Table v). The frequencies of the DRB1*11 and DRB1*12 alleles in those groups were 4.17% and 7.08%, and 14.58% and 25% respectively, differences that were nonsignificant (p > 0.05).
TABLE V.
Distribution of HLA-DRB1*11 and HLA-DRB1*12 in study participants with and without hepatitis B viral infection
| Variable | HLA-DRB1 allele | |||
|---|---|---|---|---|
|
| ||||
| *11 | *12 | |||
|
|
|
|||
| Positive | Negative | Positive | Negative | |
| HBsAg | ||||
| Positive | 2 | 46 | 7 | 41 |
| Negative | 15 | 197 | 53 | 159 |
| Statistic | ||||
| Chi-square | 0.542 | 2.392 | ||
| p Value | 0.462 | 0.122 | ||
| Odds ratio | 0.571 | 0.512 | ||
| 95% CI | 0.126 to 2.585 | 0.217 to 1.210 | ||
HBsAg = hepatitis B surface antigen; CI = confidence interval.
DISCUSSION AND CONCLUSIONS
Human leucocyte antigen, the gene product of mhc, is the first genetic system to have been discovered to be related to disease. The hla complex, a closely linked gene cluster, is found in the short arm of the human 6th chromosome. The antigens encoded by the hlas determine an organism’s rejection reaction and are related to immune response and immunologic regulation. The hla gene family is classified into 3 groups—hla-i, hla-ii, and hla-iii—by their polymorphisms, the distribution of their coding regions, and their function. The classical hla-i group has 3 functional sites, hla-a, hla-b, and hla-c, which were the first members of the hla family to be discovered19,20. Genes in the hla-i group have a very high rate of polymorphism; as of October 2014, 2964 alleles of hla-a, 3693 alleles of hla-b, and 2466 alleles of hla-c had been identified according to the IMGT/HLA database of the ImMunoGeneTics project (http://www.ebi.ac.uk/imgt/hla/stats.html).
The hla-i gene products are located mainly on the surface of all nucleated cells, where they present foreign antigens to CD8+ T cells, enabling recognition and lysis of virus-infected cells21. Class ii hlas—named hla-d and subclassified into hla-dr, hla-dq, hla-dp, and so on—are expressed mainly in immunocells. They function as labelled molecules to activate the immune response and regulate the interaction of immunocells22–24.
Given the high polymorphism of the hla complex, finding the same phenotype in multiple individuals is very rare, and thus hla has become an important target in the investigation of many diseases, including autoimmune, infectious, and malignant diseases, among others25–28. High expression of hla-dr is a marker of T-cell activation. According to statistics from the International Histocompatibility Working Group, the number of alleles in the noetic DRB1 sites of hla-ii antigens is 494, with 1582 alleles having been identified for the HLA-DRB1 gene. That polymorphism is the main genetic factor29,30 involved in the variety of immune responses and the varying susceptibility to disease presented by different individuals in a group. Both of the foregoing hla groups play very important roles in antigen recognition and immune response and regulation31,32.
Classical hlas act as genetic markers of tumour susceptibility, and many tumour-related studies are currently being performed. Allele polymorphism in HLA-DRB1 has been reported to be associated with certain cancers and autoimmune diseases, including cervical squamous cell carcinoma, rheumatoid arthritis, systemic lupus erythematosus, autoimmune hepatitis, inflammatory bowel disease, multiple sclerosis, and type 1 diabetes, among others.
Many studies have already reported the relationship between HLA-DRB1 and hcc. El-Chennawi et al.12 studied the association of hla class ii DRB1 and DQB1 polymorphisms with hcc in Egyptian patients and investigated the role of those polymorphisms as risk factors for the development of hcc. Those authors found a significantly increased frequency of DRB1*04 and DQB1*02 (p = 0.016 and 0.032 respectively) and a significantly decreased frequency of DQB1*06 (p = 0.032) in their hcc patients compared with a control group. They concluded that the DRB1*04 and DQB1*02 alleles might be risk factors for the occurrence of hcc (or: 4.373 and 3.807 respectively) and that DQB1*06 might be a protective allele (or: 0.259).
Even earlier, Donaldson et al.11 had also investigated hla class ii as a risk factor for the development of hcc in Hong Kong Chinese. Their study reported that the alleles DRB1*1501 (36% of hcc patients vs. 19% of controls; or: 2.44), DQA1*0102 (42% vs. 26%; or: 2.07), and DPB1*0501 (80% vs. 63%; or: 2.35) were significantly more common in patients with hcc, and that the alleles DQA1*03 (36% vs. 56%; or: 0.53), DQB1*0302 (4.% vs. 13%; or: 0.25), and DPB1*0201 (14% vs. 29%; or: 0.4) were found at significantly lower frequencies.
Controversially, in 1987 in Taiwan, Lin et al.33 studied the distribution of hla-a, -b, -c, and -dr antigens in Chinese patients with hcc. Their results suggested that no specific patterns or frequencies of those antigens were associated with the development of hcc.
Infection with hbv or hcv (or both) is the most important risk factor for development of hcc, and many studies have reported a relationship between HLA-DRB1 and hbv or hcv. Ali et al.34 evaluated the distribution of hla alleles and haplotypes in 204 hcv-seropositive individuals from Islamabad, Pakistan, who were receiving standard interferon therapy. The authors concluded that DRB1*04 imparts a significant protective advantage against hcv infection (Bonferroni-corrected p = 0.047). In patients on interferon therapy, DRB1*11 and DQB1*0301 were found to be associated with viral clearance (Bonferroni-corrected p = 0.044). In contrast, DRB1*07 individually (Bonferroni-corrected p = 0.008), or in combination with DQB1*02, was found to be associated with viral persistence. A meta-analysis35 demonstrated a statistically significant correlation between the DRB1*03 allele and the occurrence of chronic hepatitis B in the Han Chinese population; the DRB1*03 allele might therefore be a susceptibility allele for the disease. Another meta-analysis showed that the HLADR*04 and HLA-DR*13 alleles (or: 0.72; 95% ci: 0.60 to 0.85; and or: 0.27; 95% ci: 0.19 to 0.37 respectively) were significantly associated with hbv clearance. In contrast, patients carrying the HLA-DR*03 or HLA-DR*07 alleles (or: 1.47; 95% ci: 1.16 to 1.87; and or: 1.59; 95% ci: 1.24 to 2.03 respectively) had a significantly increased risk of chronic hbv persistence. A significant association of the HLA-DR*01 polymorphism with hbv clearance was found in the Han Chinese group (or: 0.48; 95% ci: 0.26 to 0.86), but not in other ethnic groups (p = 0.191).
The Guangxi Zhuang Autonomous Region is known as a region of high hbv prevalence in China; it is also a region with a high hcc prevalence. As is well known, hbv infection is the most important risk factor in hcc, but not every hbv infection develops into liver cirrhosis or liver cancer. However, Jin et al.36 analyzed the relationship between specific HLA-DRB1 alleles and the development of hcc in patients with chronic hbv who had taken antiviral drugs for more than 12 months, finding that the HLA-DRB1*140101 allele could potentially be associated with an increased risk of hcc development in such patients regardless of hbv replicative activity and responsiveness to antivirals.
In view of all the foregoing evidence, we designed a study to explore the relationship of HLA-DRB1 allele polymorphisms with fhcc in Guangxi Zhuang Autonomous Region. We also attempted to provide insights into the underlying genetic background of the members of families with fhcc and to discover whether the fhcc aggregation in Guangxi is related mostly to genetic factors or to a combination of genes and hbv infection. After enrolling healthy individuals both from fhcc families (“cases”) and from families with no history of cancer (“controls”) who lived in 11 areas of high hcc incidence in Guangxi (matched for age, HBsAg, nationality, residence, and sex), we selected certain HLA-DRB1 alleles that had been reported to be related to liver cancer or hbv infection and used pcr ssps to determine allele frequencies. We found that the frequencies of DRB1*11 and DRB1*12 were significantly lower in the fhcc group than in the control group and that the frequencies of DRB1*03, *04, *07, *08, *09, *13, *14, *15, and *16 were statistically similar. We speculate that the low frequency of the DRB1*11 and *12 alleles are the risk factor for the fhcc aggregation in Guangxi Zhuang Autonomous Region.
We subsequently explored the relationships of the DRB1*11 and DRB1*12 alleles with hbv infection, finding little relation between them. We therefore indirectly infer that those alleles are connected to fhcc mainly because of their own action and not because they affect hbv susceptibility. With respect to pathogenesis, we hypothesize that deficiency in the DRB1*11 and DRB1*12 alleles might result in immune evasion by the tumour because of a connection to the regulation of cytokines; more research to prove this hypothesis will be needed.
Our data suggest that genetic factors play a role in fhcc, with a deficiency of the DRB1*11 and DRB1*12 alleles potentially being the risk factor for the aggregation seen in Guangxi Zhuang Autonomous Region. However, our study has limitations, and large case–control studies focused on the potential genetic components of the local fhcc aggregation and on determining immune cytokines in the patients are required to verify our hypotheses. The potential early diagnostic value of HLA-DRB1 alleles remains a field to be explored in future.
ACKNOWLEDGMENTS
This project was supported by the National Natural Science Foundation of China (no. 30960170) and the Foundation of Guangxi Provincial Education Department (no. 201203YB048 and no. 201202ZD021).
CONFLICT OF INTEREST DISCLOSURES
We have read and understood Current Oncology’s policy on disclosing conflicts of interest, and we declare that we have none.
REFERENCES
- 1.Llovet JM. Updated treatment approach to hepatocellular carcinoma. J Gastroenterol. 2005;40:225–35. doi: 10.1007/s00535-005-1566-3. [DOI] [PubMed] [Google Scholar]
- 2.Bosch FX, Ribes J, Diaz M, Cleries R. Primary liver cancer: worldwide incidence and trends. Gastroenterology. 2004;127(suppl 1):S5–16. doi: 10.1053/j.gastro.2004.09.011. [DOI] [PubMed] [Google Scholar]
- 3.Yu MC, Yuan JM. Environmental factors and risk for hepatocellular carcinoma. Gastroenterology. 2004;127(suppl 1):S72–8. doi: 10.1016/j.gastro.2004.09.018. [DOI] [PubMed] [Google Scholar]
- 4.Donato F, Boffetta P, Puoti M. A meta-analysis of epidemiological studies on the combined effect of hepatitis B and C virus infections in causing hepatocellular carcinoma. Int J Cancer. 1998;75:347–54. doi: 10.1002/(SICI)1097-0215(19980130)75:3<347::AID-IJC4>3.0.CO;2-2. [DOI] [PubMed] [Google Scholar]
- 5.Regimbeau JM, Colombat M, Mognol P, et al. Obesity and diabetes as a risk factor for hepatocellular carcinoma. Liver Transpl. 2004;10(suppl 1):S69–73. doi: 10.1002/lt.20033. [DOI] [PubMed] [Google Scholar]
- 6.Hu Q, Lou GG, Liu YC, Qian L, Lv BD. The tumor necrosis factor-alpha-308 and −238 polymorphisms and risk of hepatocellular carcinoma for Asian populations: a meta-analysis. Curr Ther Res Clin Exp. 2014;76:70–5. doi: 10.1016/j.curtheres.2014.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chen X, Zhang L, Chang Y, et al. Association of tnf-α genetic polymorphisms with hepatocellular carcinoma susceptibility: a case–control study in a Han Chinese population. Int J Biol Markers. 2011;26:181–7. doi: 10.5301/JBM.2011.8580. [DOI] [PubMed] [Google Scholar]
- 8.Wu J, Zhang W, Xu A, et al. Association of epidermal growth factor and epidermal growth factor receptor polymorphisms with the risk of hepatitis B virus–related hepatocellular carcinoma in the population of North China. Genet Test Mol Biomarkers. 2013;17:595–600. doi: 10.1089/gtmb.2013.0031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Yuan JM, Fan Y, Ognjanovic S, et al. Genetic polymorphisms of epidermal growth factor in relation to risk of hepatocellular carcinoma: two case–control studies. BMC Gastroenterol. 2013;13:32. doi: 10.1186/1471-230X-13-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Guo Y, Zang C, Li Y, et al. Association between tgf-β1 polymorphisms and hepatocellular carcinoma risk: a meta-analysis. Genet Test Mol Biomarkers. 2013;17:814–20. doi: 10.1089/gtmb.2013.0268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Donaldson PT, Ho S, Williams R, Johnson PJ. hla class ii alleles in Chinese patients with hepatocellular carcinoma. Liver. 2001;21:143–8. doi: 10.1034/j.1600-0676.2001.021002143.x. [DOI] [PubMed] [Google Scholar]
- 12.El-Chennawi FA, Auf FA, Metwally SS, Mosaad YM, El-Wahab MA, Tawhid ZE. hla-class ii alleles in Egyptian patients with hepatocellular carcinoma. Immunol Invest. 2008;37:661–74. doi: 10.1080/08820130802111605. [DOI] [PubMed] [Google Scholar]
- 13.Hamed NA, Hano AF, Raouf HA, Gamal M, Eissa M. Relationship between HLA-DRB1*0101, DRB1*0301 alleles and interleukin-12 in haemophilic patients and hepatitis C virus positive hepatocellular carcinoma patients. Egypt J Immunol. 2003;10:17–26. [PubMed] [Google Scholar]
- 14.Kummee P, Tangkijvanich P, Poovorawan Y, Hirankarn N. Association of HLA-DRB1*13 and tnf-α gene polymorphisms with clearance of chronic hepatitis B infection and risk of hepatocellular carcinoma in Thai population. J Viral Hepat. 2007;14:841–8. doi: 10.1111/j.1365-2893.2007.00880.x. [DOI] [PubMed] [Google Scholar]
- 15.Xin YN, Lin ZH, Jiang XJ, et al. Specific HLA-DQB1 alleles associated with risk for development of hepatocellular carcinoma: a meta-analysis. World J Gastroenterol. 2011;17:2248–54. doi: 10.3748/wjg.v17.i17.2248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Klein J, Sato A. The hla system. First of two parts. N Engl J Med. 2000;343:702–9. doi: 10.1056/NEJM200009073431006. [DOI] [PubMed] [Google Scholar]
- 17.Klein J, Sato A. The hla system. Second of two parts. N Engl J Med. 2000;343:782–6. doi: 10.1056/NEJM200009143431106. [DOI] [PubMed] [Google Scholar]
- 18.Olerup O, Zetterquist H. HLA-DR typing by pcr amplification with sequence-specific primers (pcr-ssp) in 2 hours: an alternative to serological dr typing in clinical practice including donor–recipient matching in cadaveric transplantation. Tissue Antigens. 1992;39:225–35. doi: 10.1111/j.1399-0039.1992.tb01940.x. [DOI] [PubMed] [Google Scholar]
- 19.Petersdorf EW, Mickelson EM, Anasetti C, Martin PJ, Woolfrey AE, Hansen JA. Effect of hla mismatches on the outcome of hematopoietic transplants. Curr Opin Immunol. 1999;11:521–6. doi: 10.1016/S0952-7915(99)00016-3. [DOI] [PubMed] [Google Scholar]
- 20.Jin P, Wang E. Polymorphism in clinical immunology—from hla typing to immunogenetic profiling. J Transl Med. 2003;1:8. doi: 10.1186/1479-5876-1-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Maciag PC, Schlecht NF, Souza PS, Franco EL, Villa LL, Petzl-Erler ML. Major histocompatibility complex class ii polymorphisms and risk of cervical cancer and human papillomavirus infection in Brazilian women. Cancer Epidemiol Biomarkers Prev. 2000;9:1183–91. [PubMed] [Google Scholar]
- 22.Santos PS, Kellermann T, Uchanska-Ziegler B, Ziegler A. Genomic architecture of mhc-linked odorant receptor gene repertoires among 16 vertebrate species. Immunogenetics. 2010;62:569–84. doi: 10.1007/s00251-010-0468-6. [DOI] [PubMed] [Google Scholar]
- 23.Agudelo WA, Patarroyo ME. Quantum chemical analysis of mhc-peptide interactions for vaccine design. Mini Rev Med Chem. 2010;10:746–58. doi: 10.2174/138955710791572488. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Taneja V, David CS. Role of hla class ii genes in susceptibility/resistance to inflammatory arthritis: studies with humanized mice. Immunol Rev. 2010;233:62–78. doi: 10.1111/j.0105-2896.2009.00858.x. [DOI] [PubMed] [Google Scholar]
- 25.Invernizzi P. Human leukocyte antigen in primary biliary cirrhosis: an old story now reviving. Hepatology. 2011;54:714–23. doi: 10.1002/hep.24414. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Elliott RL, Jiang XP, Phillips JT, Barnett BG, Head JF. Human leukocyte antigen G expression in breast cancer: role in immunosuppression. Cancer Biother Radiopharm. 2011;26:153–7. doi: 10.1089/cbr.2010.0924. [DOI] [PubMed] [Google Scholar]
- 27.Yan WH. hla-g expression in cancers: potential role in diagnosis, prognosis and therapy. Endocr Metab Immune Disord Drug Targets. 2011;11:76–89. doi: 10.2174/187153011794982059. [DOI] [PubMed] [Google Scholar]
- 28.Vigano A, Cerini C, Pattarino G, Fasan S, Zuccotti GV. Metabolic complications associated with antiretroviral therapy in hiv-infected and hiv-exposed uninfected paediatric patients. Expert Opin Drug Saf. 2010;9:431–45. doi: 10.1517/14740330903579991. [DOI] [PubMed] [Google Scholar]
- 29.Rosenman KD, Rossman M, Hertzberg V, et al. hla class ii DPB1 and DRB1 polymorphisms associated with genetic susceptibility to beryllium toxicity. Occup Environ Med. 2011;68:487–93. doi: 10.1136/oem.2010.055046. [DOI] [PubMed] [Google Scholar]
- 30.Eppler E, Caelers A, Berishvili G, Reinecke M. The advantage of absolute quantification in comparative hormone research as indicated by a newly established real-time rt-pcr: gh, igf-i, and igf-ii gene expression in the tilapia, Oreochromis niloticus. Ann N Y Acad Sci. 2005;1040:301–4. doi: 10.1196/annals.1327.047. [DOI] [PubMed] [Google Scholar]
- 31.Stenger S. Cytolytic T cells in the immune response to Mycobacterium tuberculosis. Scand J Infect Dis. 2001;33:483–7. doi: 10.1080/00365540110026584. [DOI] [PubMed] [Google Scholar]
- 32.Parham P. mhc class i molecules and kirs in human history, health and survival. Nat Rev Immunol. 2005;5:201–14. doi: 10.1038/nri1570. [DOI] [PubMed] [Google Scholar]
- 33.Lin DY, Liaw YE, Huang CC. The distribution of hla-a, b, c, dr antigens in Chinese patients with hepatocellular carcinoma in Taiwan. Tissue Antigens. 1987;29:110–14. doi: 10.1111/j.1399-0039.1987.tb01559.x. [DOI] [PubMed] [Google Scholar]
- 34.Ali L, Mansoor A, Ahmad N, et al. Patient HLA-DRB1* and -DQB1* allele and haplotype association with hepatitis C virus persistence and clearance. J Gen Virol. 2010;91:1931–8. doi: 10.1099/vir.0.018119-0. [DOI] [PubMed] [Google Scholar]
- 35.Gao F, Zhang Y, Wang LK, et al. A meta-analysis of the correlation between the HLA-DRB1*03 allele and chronic hepatitis B in the Han Chinese population. Genet Test Mol Biomarkers. 2014;19:218–21. doi: 10.1089/gtmb.2014.0096. [DOI] [PubMed] [Google Scholar]
- 36.Jin YJ, Shim JH, Chung YH, et al. Relationship of HLADRB1 alleles with hepatocellular carcinoma development in chronic hepatitis B patients. J Clin Gastroenterol. 2012;46:420–6. doi: 10.1097/MCG.0b013e318239f9cc. [DOI] [PubMed] [Google Scholar]