Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Feb 16.
Published in final edited form as: Environ Microbiol. 2011 May 12;13(10):2623–2632. doi: 10.1111/j.1462-2920.2011.02501.x

Stable-isotope probing of the polycyclic aromatic hydrocarbon-degrading bacterial guild in a contaminated soil

Maiysha D Jones 1,*, Douglas W Crandell 1, David R Singleton 1, Michael D Aitken 1
PMCID: PMC4755288  NIHMSID: NIHMS755946  PMID: 21564459

Abstract

The bacteria responsible for the degradation of naphthalene, phenanthrene, pyrene, fluoranthene, or benz[a]anthracene in a polycyclic aromatic hydrocarbon (PAH)-contaminated soil were investigated by DNA-based stable-isotope probing (SIP). Clone libraries of 16S rRNA genes were generated from the 13C-enriched (“heavy”) DNA recovered from each SIP experiment, and quantitative PCR primers targeting the 16S rRNA gene were developed to measure the abundances of many of the SIP-identified sequences. Clone libraries from the SIP experiments with naphthalene, phenanthrene, and fluoranthene primarily contained sequences related to bacteria previously associated with the degradation of those compounds. However, Pigmentiphaga-related sequences were newly associated with naphthalene and phenanthrene degradation, and sequences from a group of uncultivated γ-Proteobacteria known as Pyrene Group 2 were newly associated with fluoranthene and benz[a]anthracene degradation. Pyrene Group 2-related sequences were the only sequences recovered from the clone library generated from SIP with pyrene, and they were 82% of the sequences recovered from the clone library generated from SIP with benz[a]anthracene. In time-course experiments with each substrate in unlabeled form, the abundance of each of the measured groups increased in response to the corresponding substrate. These results provide a comprehensive description of the microbial ecology of a PAH-contaminated soil as it relates to the biodegradation of PAHs from two to four rings, and they underscore that bacteria in Pyrene Group 2 are well-suited for the degradation of four-ring PAHs.

Keywords: bacteria, functional diversity, metagenomics/community genomics, microbial communities, microbial ecology, pollution microbiology, uncultured microbes

Introduction

Polycyclic aromatic hydrocarbons (PAHs) are a class of hazardous organic compounds regulated by the U.S. Environmental Protection Agency and are listed among the top ten contaminants found at Superfund sites in the United States (Agency for Toxic Substances and Disease Registry, 2007). PAHs are natural components of coal, petroleum, and other fossil fuels, and PAH contamination can result from the incomplete combustion of these and other organic materials. PAHs can also enter environmental systems when industrial products or wastes containing high concentrations of these compounds are accidentally released to the environment or otherwise disposed of improperly.

Bioremediation is a viable option for reducing PAH contamination in soil (US EPA Office of Solid Waste and Emergency Response, 2007), but in order to develop the most appropriate and cost-effective approaches to the bioremediation of a contaminated site, the microbial ecology of that site, as it relates to the contaminants of interest, should be understood to the fullest extent possible. Cultivation-based (Kiyohara et al., 1982; Willison, 2004; Gaskin and Bentham, 2005; Zhou et al., 2008) and cultivation-independent (Jeon et al., 2003; Padmanabhan et al., 2003; Singleton et al., 2005; Singleton et al., 2006; Singleton et al., 2007; Jones et al., 2008; Huang et al., 2009) techniques have been used to evaluate the microbial ecology of PAH degradation. However, the traditional approach of isolating and culturing bacteria greatly underestimates the diversity of the prokaryotic world (Oren, 2004) and fails to account for the complex interactions of the members of microbial communities with each other and with their native environment. Cultivation-independent techniques can help us better estimate the prokaryotic diversity of complex systems (Amann et al., 1995; Breznak, 2002; Rappe and Giovannoni, 2003) where it can be difficult to establish which organisms are responsible for the degradation of particular contaminants.

Stable-isotope probing (SIP) is a cultivation-independent technique that allows us to study the microbial ecology of specific-substrate degradation (Radajewski et al., 2000). To date, SIP has been used to identify soil bacteria capable of degrading the PAHs naphthalene (Jeon et al., 2003; Padmanabhan et al., 2003; Singleton et al., 2005), phenanthrene (Singleton et al., 2005; Singleton et al., 2007), pyrene (Singleton et al., 2006; Singleton et al., 2007; Jones et al., 2008) and anthracene (M. D. Jones et al., submitted). As part of a larger project investigating strategies for the bioremediation of PAH-contaminated soil from a former manufactured-gas plant site, we performed DNA-based SIP with [U-13C]naphthalene, phenanthrene, pyrene, fluoranthene, or benz[a]anthracene. The identification of fluoranthene- or benz[a]anthracene-degrading bacteria by SIP has not been previously reported. This study represents the most comprehensive SIP-based investigation of the bacterial guild responsible for the degradation of a range of related compounds in a contaminated soil.

Results

Mineralization and growth substrate disappearance

Samples of the original soil were incubated as a slurry and spiked with a 2-, 3-, or 4-ring PAH. After 8 h (naphthalene), 16 h (phenanthrene), 12 d (pyrene), or 21 d (benz[a]anthracene) of incubation, the rate of mineralization had declined, and ≤ 6% of the added parent compound remained for each substrate except pyrene, for which 25% remained. The mineralization data for each PAH are shown in Fig. S1 of the supporting information. In general, mineralization occurred over the same time scale as the disappearance of the parent compound. For fluoranthene, mineralization reached a plateau after 17 d even though 95% of the added fluoranthene had been consumed by day 4. We observed a similar difference in the time frames over which mineralization and parent compound disappearance occurred for anthracene in a separate SIP study on the same soil (M. D. Jones et al., submitted).

16S rRNA gene clones libraries

A 16S rRNA gene clone library was generated from the heavy DNA recovered from each SIP experiment, and 96 clones were sequenced for each experiment. After excluding vector sequences, poor reads, and chimeras, the clone libraries generated from DNA associated with the degradation of naphthalene, phenanthrene, pyrene, fluoranthene, and benz[a]anthracene contained 65, 85, 96, 91, and 91 sequences, respectively. Because we do not have confidence that singleton sequences were associated with heavy DNA (Singleton et al., 2005), singleton sequences are not included in subsequent analyses but are listed in the supporting information (Table S1). The remaining sequences, along with sequences from our previous anthracene SIP experiment (M. D. Jones et al., submitted), were grouped into operational taxonomic units (OTUs) based on 97% sequence similarity (Table 1). Figure 1 shows how the representative for each OTU is related to selected reference sequences from GenBank.

Table 1.

Percent representation of SIP-identified groups in each clone library.1

OTU No. Classification2 NAP ANT3 PHE PYR FLA BaA
1 Sphingobium -4 - - - 56 -
2 Pyrene Group 2 - - - 100 13 82
3 Rhodobacter - 1 - - - 3
4 Variovorax 31 24 - - - 5
5 Rhizobium - 3 - - - 4
6 Sphingomonas - - - - 25 -
7 Pigmentiphaga 8 4 13 - - -
8 Acidovorax 9 - 74 - - -
9 Sphingobium 25 - 9 - - -
10 Achromobacter 3 - - - - -
11 Pseudoxanthomonas 3 2 - - - -
12, 13 Pseudomonas 22 2 - - - -
14 Anthracene Group 1 - 43 - - - -
15 Unclassified Rhizobiales - 1 - - - -
16 Skermanella - 1 - - - -
Open in a new tab
1

NAP, naphthalene (65 sequences total); ANT, anthracene (185); PHE, phenanthrene (85); PYR, pyrene (96); FLA, fluoranthene (91); BaA, benz[a]anthracene (91).

2

Assigned using RDP Classifier (Wang et al., 2007) with an 80% confidence threshold.

3

From M.D. Jones et al. (submitted). Percentages do not add to 100 because two sequences found in the clone libraries from heavy DNA were subsequently concluded not to have grown on the 13C-labeled anthracene in the SIP experiment.

4

-, Not found or was a singleton sequence in that clone library, except as noted otherwise,.5 Found in the clone libraries from heavy DNA but subsequently concluded not to have grown on the 13C-labeled anthracene in the SIP experiment.

Fig. 1.

Fig. 1

Open in a new tab

Phylogenetic tree of representative partial 16S rRNA gene sequences of bacteria from OTUs that contain sequences associated with the degradation of each of the five compounds investigated by SIP in this study and with anthracene degradation in the same soil (M. D. Jones et al., submitted) and selected reference sequences. The tree was rooted with Mycobacterium vanbaalenii PYR100 (AY636002, not shown). Clones are named by the original soil sample (SB, Salisbury), the growth substrate (NAP, naphthalene; ANT, anthracene; PHE, phenanthrene; PYR, pyrene; FLA, fluoranthene; and BAA, benz[a]anthracene), and assigned an identifying number. The representative clone sequence and the GenBank accession numbers are in parentheses. OTUs are as in Table 1. Open and closed circles at nodes indicate ≥ 95% and ≥ 50% bootstrap support, respectively. PG2, Pyrene Group 2; AG1, Anthracene Group 1

The most abundant sequences in the clone library generated from SIP with naphthalene were related to members of the Variovorax (20 of 65 clones), Sphingobium (16 clones), and Pseudomonas (14 clones) genera. Other sequences were related to Acidovorax (6 clones), Pigmentiphaga (5 clones), Achromobacter (2 clones), and Pseudoxanthomonas (2 clones). Sphingobium- and Pigmentiphaga-related sequences were also present in the clone library generated from SIP with phenanthrene (11 and 8 of 85 clones, respectively), but most of the sequences recovered were related to Acidovorax (63 clones). All of the sequences in the clone library generated from SIP with pyrene were related to members of an uncultivated group of γ-Proteobacteria previously designated “Pyrene Group 2” (PG2) (Singleton et al., 2006). Sequences related to PG2 were also present in the clone library generated from SIP with fluoranthene (12 of 91 clones), but the majority of the sequences were related to Sphingobium (51 clones) and Sphingomonas (23 clones). PG2-related sequences also dominated the clone library generated from SIP with benz[a]anthracene (75 of 91 clones). Other sequences were related to Variovorax (5 clones), Rhizobium (4 clones), and Rhodobacter (3 clones).

Quantification of SIP-identified groups

Primers for quantitative PCR (qPCR) targeting the 16S rRNA genes of several SIP-identified groups were developed (Table 2) and used to determine the abundance of each group in response to the corresponding growth substrate. Except for the Sphingobium- and Sphingomonas-related bacteria associated with fluoranthene degradation, all of the targeted groups were below the respective detection limit of each assay in the original soil sample (data not shown; see Table 2 for the detection limits). Several of these groups increased to above the detection limit during the two days of pre-incubation in the absence of the spiked PAH, but from the time the SIP incubation flasks were spiked with the 13C-labeled PAH to the end of each SIP experiment, 16S rRNA gene copy numbers for each of these groups increased at least an order of magnitude in parallel flasks containing unlabeled substrate (Fig. 2). The Sphingobium- and Sphingomonas-related bacteria associated with fluoranthene degradation were quantifiable in the original soil sample, and their 16S rRNA gene copy abundance increased by about 1.5 log by day 4 when the added fluoranthene had been consumed (Fig. 3). PG2-related bacteria associated with fluoranthene degradation were below the detection limit in the original soil sample, but their abundance also increased by about 1.5 log by day 4. None of the fluoranthene-associated groups increased in abundance between day 4 and day 17 when the SIP incubation was terminated.

Table 2.

Quantitative PCR primers used in this study.

Target Group Primer Name1 Primer Sequence (5’→3’) TM (°C)2 qPCR Standard3 Amplicon Length Amp. Eff.4 (Bac; Group) Detect. Limit5 RDP Hits6
Bacteria 341F CCTACGGGAGGCAGCAG 60 -- -- -- -- --
517R ATTACCGCGGCTGCTGG
Pigmentiphaga 7 PigmF CAGGCGGTTCGGAAAG 56 SBNAP45 63 1.91; 2.03 8.86 × 106 17
PigmR TGACATACTCTAGTTCGGGA
Sphingobium 8 SGBF ACGTAGGCGGCGATTT 59 SBNAP83 70 2.03; 2.03 1.44 × 107 329
SGBR CCTCTCCAAGATTCTAGCAA
Sphingobium 9 SGB.5F ACAGTACCGGGAGAATAAGCTC 56 SBANT43 158 1.98; 1.92 2.32 × 107 128
SGB.5R CAAGCAATCCAGTCTCAAAGGCTA
Variovorax VarioF AGCTGTGCTAATACCGCATAA 61 SBNAP02 279 2.05; 1.99 8.10 × 107 65
VarioR GAGACTTTTCGTTCCGTAC
Acidovorax AcidF TAACGGAGCGAAAGCTT 55 SBPHE2-37 60 1.98; 2.01 2.08 × 107 331
AcidR GTCCGCGCAAGGCCTT
Pyrene Group 2 PG2.4F CCAAGCCGACGACGGGTAG 59 SBPYR03 94 2.02; 1.99 8.17 × 107 900
PG2.4R TTCCCCACTGCTGCCTC
Sphingomonas SPH.1F CGGTACGGAATAACTCA 50 SBFLA15 202 1.98; 1.95 8.12 × 105 37
Univ338R GCTGCCTCCCGTAGGAGT
Open in a new tab
1

Bacterial primers are from Muyzer et al. (1993), SGB.5 and Pigm primers are from Jones et al. (M. D. Jones et al., submitted), Acidovorax primers are from Singleton et al. (2007), and Univ338R are from Suzuki and Giovannoni (1996). All other primers were developed in this study.

2

PCR annealing temperature.

3

Clones from which plasmid DNA was used to generate standard curves. Each plasmid was linearized with NcoI. Clone names are as in Fig. 1.

4

Amp. Eff., Amplification efficiency (Pflaff, 2001) with eubacterial (Bac) and group-specific (Group) primers.

5

Detection limit of each qPCR assay (number of 16S rRNA gene copies/ g dry soil).

6

Number of sequences returned by the Ribosomal Database Project II release 10.18 (Cole et al., 2009) (excluding sequences from this study) with no mismatches to primer pairs.

7

Pigmentiphaga-related sequences were identical to those recovered from the SIP experiment anthracene (M. D. Jones et al., submitted).

8

Targets naphthalene- and phenanthrene-associated Sphingobium sequences.

9

Targets fluoranthene-associated Sphingobium sequences. The clone used for qPCR was from a highly similar sequence recovered in clone libraries from an earlier SIP experiment with anthracene (M. D. Jones et al., submitted).

Fig. 2.

Fig. 2

Open in a new tab

Abundances of eubacterial (BAC) and group-specific 16S rRNA genes at the beginning (open bars) and end (closed bars) of each SIP experiment in response to enrichment with the unlabeled substrate indicated; t = 0 is when each substrate was first added to the incubation flask after two days of pre-incubating the soil slurry without any added substrate. Group-specific values are the mean and range of duplicate reactions. Eubacterial values are the combined mean and standard deviation of the duplicate reactions calculated for each of the group-specific templates. Asterisks indicate that the value was below the detection limit of the assay. PIGM, Pigmentiphaga; SGB, Sphingobium; VARIO, Variovorax; ACI, Acidovorax; BaA, benz[a]anthracene. Error bars represent one standard deviation and are shown in only one direction for clarity.

Fig. 3.

Fig. 3

Open in a new tab

Abundances of eubacterial and group-specific 16S rRNA genes over time in response to enrichment with unlabeled fluoranthene; t = 0 is when fluoranthene was first added to the incubation flask after two days of pre-incubating the soil slurry without fluoranthene. Group-specific values are the mean and standard deviation of triplicate reactions. Eubacterial values are the combined mean and standard deviation of the triplicate reactions calculated for each of the group-specific templates. SPH, Sphingomonas. Other notes are as in Fig. 2.

Discussion

Individual stable-isotope probing experiments were performed with five different uniformly 13C-labeled PAHs to investigate the bacterial guild responsible for PAH degradation in a PAH-contaminated soil from the site of a former manufactured-gas plant. Coupled with SIP of anthracene-degrading bacteria in the same soil (M. D. Jones et al., submitted), this work represents a comprehensive investigation of bacteria capable of degrading 2-ring (naphthalene), 3-ring (anthracene and phenanthrene), and 4-ring (benz[a]anthracene, fluoranthene, and pyrene) PAHs.

Collectively, a diverse range of bacteria spanning the α-, β-, and γ-Proteobacteria were found to grow on one or more of the six PAHs we evaluated (Figure 1). Of the 16 OTUs reported in Table 1, nine represented at least 10% of the clone library for at least one of the PAHs. However, only a few OTUs were well-represented in more than one clone library (Table 1), suggesting a degree of specialization for degrading a particular PAH. Only one OTU associated with growth on naphthalene (Rhizobium) was associated with growth on a four-ring compound, and it was not a major OTU in either clone library. None of the three OTUs associated with growth on phenanthrene grew on a four-ring PAH. All of the phenanthrene-degrading OTUs grew on naphthalene, but not vice versa. Four of the OTUs associated with anthracene degradation were also associated with naphthalene degradation, but several of the remaining OTUs did not grow on any other PAH evaluated.

Sequences related to members of the orders Burkholderiales (Variovorax, Acidovorax, and Pigmentiphaga) and Sphingomonadales (Sphingobium, Anthracene Group 1) dominated the clone libraries generated from SIP with 2- and 3-ring PAHs. Most of the 16S rRNA gene sequences we recovered from SIP with naphthalene were similar to sequences from genera that have been associated with naphthalene degradation in previous DNA-based SIP studies, including Pseudomonas (Jeon et al., 2003; Padmanabhan et al., 2003; Yu and Chu, 2005), Acidovorax (Jeon et al., 2003; Yu and Chu, 2005), and Variovorax (Jeon et al., 2003; Padmanabhan et al., 2003). Members of the genus Sphingobium have previously been associated with naphthalene degradation by other methods (Lafortune et al., 2009). Pigmentiphaga-related sequences have not previously been associated with naphthalene degradation, but were present in heavy DNA from incubations with naphthalene and increased in abundance in response to naphthalene addition (Fig. 2). Variovorax- related sequences were also well-represented in the clone libraries generated from SIP with anthracene, but the most numerous sequences were related to an uncultivated and unclassified group within the order Sphingomonadales (M. D. Jones et al., submitted). The Variovorax- and Pigmentiphaga-related sequences associated with naphthalene were greater than 99% (over 815 bp of aligned sequence) and 98.9% (817 bp) similar, respectively, to sequences recovered from SIP with anthracene (M. D. Jones et al., submitted).

As with naphthalene, many of the 16S rRNA gene sequences we recovered from SIP with phenanthrene were similar to sequences from genera previously associated with phenanthrene degradation. Acidovorax-related sequences have previously been associated with phenanthrene degradation by SIP (Singleton et al., 2005; Singleton et al., 2007), and Sphingobium-related sequences have been associated with phenanthrene degradation by other methods (Lafortune et al., 2009; Isaza and Daugulis, 2010). In addition, Pigmentiphaga-related bacteria were shown for the first time to be capable of growth on phenanthrene as a result of this work. The Sphingobium- and Pigmentiphaga-related sequences associated with phenanthrene were greater than 99.1% (over 801 bp of aligned sequence) and 99.8% (816 bp) similar, respectively, to sequences recovered from SIP with naphthalene., The Pigmentiphaga-related sequence was identical (over 816 bp) to the sequences recovered from SIP with anthracene (M. D. Jones et al., submitted).

Sequences related to bacteria designated as PG2 were abundant in each clone library generated from SIP with a 4-ring PAH, but not in any clone library generated from SIP with a 2- or 3-ring PAH. PG2 was first identified in association with pyrene degradation via an SIP investigation of PAH-contaminated soil from a different manufactured-gas plant site (in Charlotte, NC) after the soil was treated in a laboratory bioreactor (Singleton et al., 2006). PG2 organisms were also the primary pyrene degraders in an SIP investigation of PAH-contaminated soil from a former wood-treatment plant site in St. Louis Park, Minnesota (Jones et al., 2008). The Salisbury, North Carolina soil used in the present study is the third soil (of three tested) to be investigated by SIP with pyrene in which PG2 was the dominant group associated with pyrene-degradation. Organisms in PG2 did not respond to the addition of naphthalene or phenanthrene in the present study (data not shown), but PG2 organisms in the Charlotte, North Carolina soil did grow on phenanthrene (Singleton et al., 2007). In addition to PG2, Sphingomonas- and Sphingobium-related sequences were well-represented in the clone library generated from SIP with fluoranthene. These sequences did not increase in abundance between day 4, when the added fluoranthene had been consumed, and the end of the SIP incubation on day 17. This suggests that the PG2-, Sphingomonas-, and Sphingobium-related organisms in the soil grew primarily on fluoranthene itself, rather than an extracellular metabolite derived from fluoranthene. Sphingomonas and Sphingobium are genera that are known to include fluoranthene-degrading species (Pinyakong et al., 2003; Story et al., 2004; Baboshin et al., 2008). The Sphingobium-related sequences were greater than 96.3% (over 790 bp of aligned sequence) and 95.9% (790 bp) similar to Sphingobium-related sequences from SIP with naphthalene and phenanthrene, respectively, and they were the only sequences recovered that increased in abundance in response to 2-ring, 3-ring, and 4-ring PAHs. This is not surprising because sphingomonads are known to have an extensive substrate range that includes both substituted and unsubstituted mono- and polyaromatic hydrocarbons up to 4 rings (Kazunga et al., 2001; Pinyakong et al., 2003; Basta et al., 2004; Stolz, 2009). What little is known about the bacterial degradation of benz[a]anthracene has resulted from studies of Mycobacterium isolates (Schneider et al., 1996; Moody et al., 2005; Kim et al., 2006; Kim et al., 2008), but PG2 sequences dominated the clone library generated from SIP with benz[a]anthracene in the present study.

Gram positive and Gram negative bacteria representing several different genera can grow on both pyrene and fluoranthene and include Alcaligenes, Pseudomonas, Stappia, Rhodococcus and Microbacterium (Hilyard et al., 2008), as well as Stenotrophomonas (Juhasz et al., 2000), Burkholderia (Juhasz et al., 1997), and Mycobacterium (Zeng et al., 2010). However, there have been relatively few reports of bacteria that can grow on multiple 4-ring PAHs. Mycobacterium vanbaalenii PYR-1 is the most thoroughly studied bacterium capable of higher-molecular-weight PAH degradation. Cultivation-based investigations of this bacterium (Heitkamp et al., 1988; Kelley and Cerniglia, 1991; Moody et al., 2005) and other Mycobacterium species (Boldrin et al., 1993; Dean-Ross and Cerniglia, 1996; Schneider et al., 1996; Rehmann et al., 1998; Churchill et al., 1999; Gauthier et al., 2003; Miller et al., 2004; Pagnout et al., 2007; Zhou et al., 2008; Hennessee et al., 2009) have revealed that members of this genus can grow on the 4-ring PAHs chrysene, pyrene, fluoranthene, and benz[a]anthracene. We have now shown that PG2 bacteria can grow not only on pyrene, but also on fluoranthene and benz[a]anthracene as well. This suggests that PG2 bacteria may be particularly well-suited for growth on 4-ring PAHs. Preliminary efforts to isolate a representative PG2 culture have been unsuccessful to date.

The present work highlights the need for the continued use of cultivation-independent methods to gain further insights into the microbial groups responsible for PAH degradation. Of the six PAHs we have evaluated as growth substrates in this soil, three (anthracene, benz[a]anthracene and pyrene) were primarily degraded by bacteria that are not closely related to any cultivated species. The results of such cultivation-independent approaches should be used to complement the discoveries made by studying bacteria isolated from environmental systems, and in fact can assist in targeting bacteria for isolation (Jeon et al., 2003; Kasai et al., 2006; Singleton et al., 2009).

Experimental Procedures

Soil sample

PAH-contaminated soil from a former manufactured-gas plant site in Salisbury, Rowan County, North Carolina. Large objects were removed by hand. The soil was then sieved through a 10-mm wire screen, blended, and sieved again prior to storage in the dark at 4°C. The processed soil (64% sand, 30% silt, 6% clay, 15% moisture, pH =7.6) was further prepared by manually removing any remaining small stones and other debris immediately before use in experiments. The total concentration of PAHs regulated by the U.S. Environmental Protection Agency was determined by high-pressure liquid chromatography (HPLC) as previously described (Singleton et al., 2008) and was approximately 890 mg/kg. The native concentrations of naphthalene, phenanthrene, pyrene, fluoranthene, and benz[a]anthracene were approximately 74, 362, 100, 34, and 65 mg/kg, respectively.

Substrates and chemical reagents

The natural abundance isotopomers (unlabeled versions) of naphthalene, phenanthrene, pyrene, and fluoranthene were obtained from Sigma-Aldrich (St. Louis, MO), and benz[a]anthracene was obtained from Acros Organics (NJ). [U-13C] versions of each compound were synthesized by methods to be described elsewhere (Z. Zhang, L.M. Ball, and A. Gold, personal communication). Until the methods are published, details of the syntheses can be obtained by contacting MDA at mike_aitken@unc.edu. [U-14C]Naphthalene (17.8 mCi/mmol), [9-14C]phenanthrene (8.3 mCi/mmol), [4,5,9,10-14C]pyrene (61 mCi/mmol), and [3-14C]fluoranthene (45 mCi/mmol) were obtained from Sigma-Aldrich (St. Louis, MO). [5,6-14C]Benz[a]anthracene (54.6 mCi/mmol) was obtained from Chemsyn Science Laboratories (Lenexa, KS). All other reagents were the highest purity available. All solvents were molecular biology or HPLC grade.

Identification and quantification of PAH-degrading bacteria

Duplicate soil slurries were prepared in 125-ml Erlenmeyer flasks and consisted of 1 g of the original soil sample (wet weight) and 30 ml of simulated groundwater amended with 0.37 mM NH4NO3 and 0.08 mM K2HPO4. The groundwater was prepared to reproduce the major ion concentrations in the groundwater of Rowan County, NC (0.7 mM CaCl2·H2O, 0.2 mM MgSO4·7H2O, 1.0 mM NaHCO3, 0.06 mM KCl, 1 N H2SO4; pH=7.5) and was filter-sterilized through a 0.1 μm pore-size flow-through, hollow-fiber membrane water filter (Sawyer Products, Safety Harbor, FL). After two days of agitation without any added substrate to allow native PAH concentrations to decline, the soil in each flask was pelleted, the supernatants were discarded, and each pellet was resuspended in 30 ml of fresh nitrogen- and phosphorus-amended simulated groundwater. Each soil slurry was then added to a flask containing 625 μg of a [U-13C]PAH (t=0). Flasks were agitated on an orbital shaker in the dark at room temperature until the predetermined endpoint.

Each incubation endpoint was determined by triplicate mineralization experiments in which soil slurry was incubated with 20,000 dpm of a 14C-labeled version of each PAH. Mineralization was measured by liquid scintillation counting of 14CO2 trapped in KOH-soaked filter paper (Singleton et al., 2008). The following endpoints were selected for the SIP incubations with [U-13C]PAH based on the mineralization data shown in Fig. S1 in the supporting information: naphthalene, 8 h; phenanthrene, 16 h; pyrene, 12 d; fluoranthene, 17 d; and benz[a]anthracene, 21 d.

At each incubation endpoint for SIP experiments with 13C-labeled naphthalene, phenanthrene, and pyrene, DNA was isolated via a single extraction of each of two 500 mg aliquots of the soil pellet with a FastDNA® Spin Kit for Soil (MP Biomedicals, Solon, OH) according to the instructions provided with the kit, except that DNA was eluted in Tris-EDTA (TE; 10 mM Tris-HCl, 1 mM EDTA; pH=8.0). DNA extracts from the same source flask were pooled prior to CsCl separation by ultracentrifugation. 13C-enriched (heavy) DNA was separated from unlabeled DNA, 16S rRNA gene sequences representing PAH-degrading bacteria were identified in the heavy DNA via clone libraries, and qPCR primers (Table 2) were developed as previously described (Singleton et al., 2006).

At each incubation endpoint for SIP experiments with 13C-labeled fluoranthene and benz[a]anthracene, DNA was isolated from each of four 250 mg aliquots of the soil pellet with the FastDNA® Spin Kit for Soil and eluted in TE. Two successive extractions of each soil aliquot were performed, and DNA extracts from the same source flask were pooled prior to CsCl separation by ultracentrifugation (M. D. Jones et al., submitted). 13C-enriched DNA was separated from unlabeled DNA, PAH-degrading bacteria were identified in the heavy DNA via 16S rRNA gene clone libraries, and qPCR primers (Table 2) were developed as previously described (Singleton et al., 2006), except that sequences were aligned within the myRDP personalized workspace (Cole et al., 2007).

The 16S rRNA gene sequences derived from 13C-enriched DNA were grouped into OTUs and a representative sequence was chosen for each OTU using the complete linkage clustering and dereplicate tools, respectively, each with a maximum cluster distance of 3%, within RDP's Pyrosequencing Pipeline (Cole et al., 2009). A neighbor-joining phylogenetic tree was constructed with representative sequences and close relatives using Clustal X 2.0 (Larkin et al., 2007) and bootstrapped 1000 times.

DNA extracted from triplicate incubations with unlabeled growth substrates performed in parallel to the SIP experiments were used to measure the abundance of each SIP-identified group by qPCR and to follow the disappearance of each growth substrate by HPLC over time as previously described (M. D. Jones et al., submitted). Detection limits for qPCR, as a product of both the detection limits of the primer sets and dilution of the sample, are identified in Table 2.

Nucleotide sequence accession numbers

Sequences of 16S rRNA genes recovered from SIP incubations were deposited in GenBank with accession numbers GU266293-GU266537 (naphthalene, phenanthrene, and pyrene) and HM640025-HM640206 (fluoranthene and benz[a]anthracene).

Supplementary Material

SupportingInfo

Acknowledgements

This work was supported by the U.S. National Institute of Environmental Health Sciences (5 P42 ES005948). MDJ was also supported by the U.S. National Science Foundation Alliance for Graduate Education and the Professoriate (HRD-0450099). We thank J. Chad Roper, Stephen Richardson, and Jing Hu for assistance with HPLC analyses.

References

  1. Agency for Toxic Substances and Disease Registry CERCLA Priority List of Hazardous Substances [WWW document] 2007 URL http://www.atsdr.cdc.gov/cercla/07list.html.
  2. Amann RI, Ludwig W, Schleifer K. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 1995;59:143–169. doi: 10.1128/mr.59.1.143-169.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Baboshin M, Akimov V, Baskunov B, Born TL, Khan SU, Golovleva L. Conversion of polycyclic aromatic hydrocarbons by Sphingomonas sp. VKM B-2434. Biodeg. 2008;19:567–576. doi: 10.1007/s10532-007-9162-2. [DOI] [PubMed] [Google Scholar]
  4. Basta T, Keck A, Klein J, Stolz A. Detection and characterization of conjugative degradative plasmids in xenobiotic-degrading Sphingomonas strains. J Bacteriol. 2004;186:3862–3872. doi: 10.1128/JB.186.12.3862-3872.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Boldrin B, Tiehm A, Fritzsche C. Degradation of phenanthrene, fluorene, fluoranthene, and pyrene by a Mycobacterium sp. Appl Environ Microbiol. 1993;59:1927–1930. doi: 10.1128/aem.59.6.1927-1930.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Breznak JA. A need to retrieve the not-yet-cultured majority. Environ Microbiol. 2002;4:4–5. doi: 10.1046/j.1462-2920.2002.t01-8-00257.x. [DOI] [PubMed] [Google Scholar]
  7. Churchill SA, Harper JP, Churchill PF. Isolation and characterization of a Mycobacterium species capable of degrading three- and four-ring aromatic and aliphatic hydrocarbons. Appl Environ Microbiol. 1999;65:549–552. doi: 10.1128/aem.65.2.549-552.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cole JR, Wang Q, Cardenas E, Fish J, Chai B, Farris RJ, et al. The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 2009;37:D141–145. doi: 10.1093/nar/gkn879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dean-Ross D, Cerniglia CE. Degradation of pyrene by Mycobacterium flavescens. Appl Microbiol Biotechnol. 1996;46:307–312. doi: 10.1007/s002530050822. [DOI] [PubMed] [Google Scholar]
  10. Gaskin S, Bentham R. Comparison of enrichment methods for the isolation of pyrene-degrading bacteria. Intl Biodeter Biodeg. 2005;56:80–85. [Google Scholar]
  11. Gauthier E, Déziel E, Villemur R, Juteau P, Lépine F, Beaudet R. Initial characterization of new bacteria degrading high-molecular weight polycyclic aromatic hydrocarbons isolated from a 2-year enrichment in a two-liquid-phase culture system. J Appl Microbiol. 2003;94:301–311. doi: 10.1046/j.1365-2672.2003.01835.x. [DOI] [PubMed] [Google Scholar]
  12. Heitkamp MA, Franklin W, Cerniglia CE. Microbial metabolism of polycyclic aromatic hydrocarbons: isolation and characterization of a pyrene-degrading bacterium. Appl Environ Microbiol. 1988;54:2549–2555. doi: 10.1128/aem.54.10.2549-2555.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hennessee CT, Seo J, Alvarez AM, Li QX. Polycyclic aromatic hydrocarbon-degrading species isolated from Hawaiian soils: Mycobacterium crocinum sp. nov., Mycobacterium pallens sp. nov., Mycobacterium rutilum sp. nov., Mycobacterium rufum sp. nov. and Mycobacterium aromaticivorans sp. nov. Int J Syst Evol Microbiol. 2009;59:378–387. doi: 10.1099/ijs.0.65827-0. [DOI] [PubMed] [Google Scholar]
  14. Hilyard EJ, Jones-Meehan JM, Spargo BJ, Hill RT. Enrichment, isolation, and phylogenetic identification of polycyclic aromatic hydrocarbon-degrading bacteria from Elizabeth River sediments. Appl Environ Microbiol. 2008;74:1176–1182. doi: 10.1128/AEM.01518-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Huang WE, Ferguson A, Singer AC, Lawson K, Thompson IP, Kalin RM, et al. Resolving genetic functions within microbial populations: in situ analyses using rRNA and mRNA stable isotope probing coupled with single-cell raman-fluorescence in situ hybridization. Appl Environ Microbiol. 2009;75:234–241. doi: 10.1128/AEM.01861-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Isaza PA, Daugulis AJ. Enhanced degradation of phenanthrene in a solid-liquid two-phase partitioning bioreactor via sonication. Biotech and Bioeng. 2010;105:997–1001. doi: 10.1002/bit.22618. [DOI] [PubMed] [Google Scholar]
  17. Jeon CO, Park W, Padmanabhan P, DeRito C, Snape JR, Madsen EL. Discovery of a bacterium, with distinctive dioxygenase, that is responsible for in situ biodegradation in contaminated sediment. Proc Natl Acad Sci. 2003;100:13591–13596. doi: 10.1073/pnas.1735529100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jones MD, Singleton DR, Carstensen DP, Powell SN, Swanson JS, Pfaender FK, Aitken MD. Effects of incubation conditions on the enrichment of pyrene- degrading bacteria identified by stable-isotope probing in an aged, PAH-contaminated soil. Microb Ecol. 2008;56:341–349. doi: 10.1007/s00248-007-9352-9. [DOI] [PubMed] [Google Scholar]
  19. Juhasz AL, Britz ML, Stanley GA. Degradation of fluoranthene, pyrene, benz[a]anthracene and dibenz[a,h]anthracene by Burkholderia cepacia. J Appl Microbiol. 1997;83:189–198. [Google Scholar]
  20. Juhasz A, Stanley G, Britz M. Microbial degradation and detoxification of high molecular weight polycyclic aromatic hydrocarbons by Stenotrophomonas maltophilia strain VUN 10,003. Lett Appl Microbiol. 2000;30:396–401. doi: 10.1046/j.1472-765x.2000.00733.x. [DOI] [PubMed] [Google Scholar]
  21. Kasai Y, Takahata Y, Manefield M, Watanabe K. RNA-based stable isotope probing and isolation of anaerobic benzene-degrading bacteria from gasoline-contaminated groundwater. Appl Environ Microbiol. 2006;72:3586–3592. doi: 10.1128/AEM.72.5.3586-3592.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kazunga C, Aitken MD, Gold A, Sangaiah R. Fluoranthene-2,3- and -1,5-diones are novel products from the bacterial transformation of fluoranthene. Environ Sci Technol. 2001;35:917–922. doi: 10.1021/es001605y. [DOI] [PubMed] [Google Scholar]
  23. Kelley I, Cerniglia CE. The metabolism of fluoranthene by a species of Mycobacterium. J Ind. Microbiol Biotechnol. 1991;7:19–26. [Google Scholar]
  24. Kim S, Kweon O, Jones RC, Edmondson RD, Cerniglia CE. Genomic analysis of polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1. Biodeg. 2008;19:859–881. doi: 10.1007/s10532-008-9189-z. [DOI] [PubMed] [Google Scholar]
  25. Kim S, Kweon O, Freeman JP, Jones RC, Adjei MD, Jhoo J, et al. Molecular cloning and expression of genes encoding a novel dioxygenase involved in low- and high- molecular-weight polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1. Appl Environ Microbiol. 2006;72:1045–1054. doi: 10.1128/AEM.72.2.1045-1054.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kiyohara H, Nagao K, Yana K. Rapid screen for bacteria degrading water-insoluble, solid hydrocarbons on agar plates. Appl Environ Microbiol. 1982;43:454–457. doi: 10.1128/aem.43.2.454-457.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lafortune I, Juteau P, Déziel E, Lépine F, Beaudet R, Villemur R. Bacterial diversity of a consortium degrading high-molecular-weight polycyclic aromatic hydrocarbons in a two-liquid phase biosystem. Microb Ecol. 2009;57:455–468. doi: 10.1007/s00248-008-9417-4. [DOI] [PubMed] [Google Scholar]
  28. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
  29. Miller CD, Hall K, Liang YN, Nieman K, Sorensen D, Issa B, et al. Isolation and characterization of polycyclic aromatic hydrocarbon–degrading Mycobacterium isolates from soil. Microbial Ecology. 2004;48:230–238. doi: 10.1007/s00248-003-1044-5. [DOI] [PubMed] [Google Scholar]
  30. Moody JD, Freeman JP, Cerniglia CE. Degradation of benz[a]anthracene by Mycobacterium vanbaalenii strain PYR-1. Biodegradation. 2005;16:513–526. doi: 10.1007/s10532-004-7217-1. [DOI] [PubMed] [Google Scholar]
  31. Muyzer G, De Waal EC, Uitierlinde AG. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol. 1993;59:695–700. doi: 10.1128/aem.59.3.695-700.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Oren A. Prokaryote diversity and taxonomy: current status and future challenges. Philos. Trans. R. Soc. B-Biol. Sci. 2004;359:623–638. doi: 10.1098/rstb.2003.1458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Padmanabhan P, Padmanabhan S, DeRito C, Gray A, Gannon D, Snape JR, et al. Respiration of 13C-labeled substrates added to soil in the field and subsequent 16S rRNA gene analysis of 13C-labeled soil DNA. Appl Environ Microbiol. 2003;69:1614–1622. doi: 10.1128/AEM.69.3.1614-1622.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pagnout C, Frache G, Poupin P, Maunit B, Muller JF, Ferard JF. Isolation and characterization of a gene cluster involved in PAH degradation in Mycobacterium sp. strain SNP1: expression in Mycobacterium smegmatis mc(2)155. Res Microbiol. 2007;158:175–186. doi: 10.1016/j.resmic.2006.11.002. [DOI] [PubMed] [Google Scholar]
  35. Pflaff MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:2002–2007. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Pinyakong O, Habe H, Omori T. The unique aromatic catabolic genes in Sphingomonads degrading polycyclic aromatic hydrocarbons (PAHs). J Gen Appl Microbiol. 2003;49:1–19. doi: 10.2323/jgam.49.1. [DOI] [PubMed] [Google Scholar]
  37. Radajewski S, Ineson P, Parekh NR, Murrell JC. Stable-isotope probing as a tool in microbial ecology. Nature. 2000;403:646–649. doi: 10.1038/35001054. [DOI] [PubMed] [Google Scholar]
  38. Rappe MS, Giovannoni SJ. The uncultured microbial majority. Annu Rev Microbiol. 2003;57:369–394. doi: 10.1146/annurev.micro.57.030502.090759. [DOI] [PubMed] [Google Scholar]
  39. Rehmann K, Noll HP, Steinberg CEW, Kettrup AA. Pyrene degradation by Mycobacterium sp. strain KR2. Chemosphere. 1998;36:2977–2992. doi: 10.1016/s0045-6535(97)10240-5. [DOI] [PubMed] [Google Scholar]
  40. Schneider J, Grosser R, Jayasimhulu K, Xue W, Warshawsky D. Degradation of pyrene, benz[a]anthracene, and benzo[a]pyrene by Mycobacterium sp. strain RJGII-135, isolated from a former coal gasification site. Appl Environ Microbiol. 1996;62:13–19. doi: 10.1128/aem.62.1.13-19.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Singleton DR, Richardson SD, Aitken MD. Effects of enrichment with phthalate on polycyclic aromatic hydrocarbon biodegradation in contaminated soil. Biodeg. 2008;19:577–587. doi: 10.1007/s10532-007-9163-1. [DOI] [PubMed] [Google Scholar]
  42. Singleton DR, Hunt M, Powell SN, Frontera-Suau R, Aitken MD. Stable-isotope probing with multiple growth substrates to determine substrate specificity of uncultivated bacteria. J Microbiol Methods. 2007;69:180–187. doi: 10.1016/j.mimet.2006.12.019. [DOI] [PubMed] [Google Scholar]
  43. Singleton DR, Sangaiah R, Gold A, Ball LM, Aitken MD. Identification and quantification of uncultivated Proteobacteria associated with pyrene degradation in a bioreactor treating PAH-contaminated soil. Environ Microbiol. 2006;8:1736–1745. doi: 10.1111/j.1462-2920.2006.01112.x. [DOI] [PubMed] [Google Scholar]
  44. Singleton DR, Powell SN, Sangaiah R, Gold A, Ball LM, Aitken MD. Stable-isotope probing of bacteria capable of degrading salicylate, naphthalene, or phenanthrene in a bioreactor treating contaminated soil. Appl Environ Microbiol. 2005;71:1202–1209. doi: 10.1128/AEM.71.3.1202-1209.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Singleton DR, Guzman Ramirez L, Aitken MD. Characterization of a polycyclic aromatic hydrocarbon degradation gene cluster in a phenanthrene-degrading Acidovorax strain. Appl Environ Microbiol. 2009;75:2613–2620. doi: 10.1128/AEM.01955-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Stolz A. Molecular characteristics of xenobiotic-degrading sphingomonads. Appl Microbiol Biotechnol. 2009;81:793–811. doi: 10.1007/s00253-008-1752-3. [DOI] [PubMed] [Google Scholar]
  47. Story SP, Kline EL, Hughes TA, Riley MB, Hayasaka SS. Degradation of aromatic hydrocarbons by Sphingomonas paucimobilis strain EPA505. Arch Environ Contam Toxicol. 2004;47:168–176. doi: 10.1007/s00244-004-3069-2. [DOI] [PubMed] [Google Scholar]
  48. Suzuki MT, Giovannoni SJ. Bias caused by template annealing in the amplification of mixtures of 16S rRNA genes by PCR. Appl Environ Microbiol. 1996;62:625–630. doi: 10.1128/aem.62.2.625-630.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. US EPA Office of Solid Waste and Emergency Response . Treatment Technologies for Site Cleanup Annual Status Report. 12th edition. U.S. Environmental Protection Agency; Washington, D.C.: 2007. EPA-542-R-07-012. [Google Scholar]
  50. Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol. 2007;73:5261–5267. doi: 10.1128/AEM.00062-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Willison JC. Isolation and characterization of a novel sphingomonad capable of growth with chrysene as sole carbon and energy source. FEMS Microbiol Lett. 2004;241:143–150. doi: 10.1016/j.femsle.2004.10.012. [DOI] [PubMed] [Google Scholar]
  52. Yu CP, Chu KH. A quantitative assay for linking microbial community function and structure of a naphthalene-degrading microbial consortium. Environ Sci Technol. 2005;39:9611–9619. doi: 10.1021/es051024e. [DOI] [PubMed] [Google Scholar]
  53. Zeng J, Lin X, Zhang J, Li X. Isolation of polycyclic aromatic hydrocarbons (PAHs)-degrading Mycobacterium spp. and the degradation in soil. J Hazard Mater. 2010;183:718–723. doi: 10.1016/j.jhazmat.2010.07.085. [DOI] [PubMed] [Google Scholar]
  54. Zhou HW, Luan TG, Zou F, Tam NFY. Different bacterial groups for biodegradation of three- and four-ring PAHs isolated from a Hong Kong mangrove sediment. J Haz Mat. 2008;152:1179–1185. doi: 10.1016/j.jhazmat.2007.07.116. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SupportingInfo
NIHMS755946-supplement-SupportingInfo.pdf (300.3KB, pdf)

RESOURCES