Skip to main content
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2016 Feb 11;4(2):apps.1500081. doi: 10.3732/apps.1500081

DNA microsatellite markers for Swartzia glazioviana (Fabaceae), a threatened species from the Brazilian Atlantic Forest1

Janaína Spoladore 2,3,6, Vidal F Mansano 2,3, Luan C Dias de Freitas 2, Alexandre M Sebbenn 4, Maristerra R Lemes 2,3,5
PMCID: PMC4760745  PMID: 26949573

Abstract

Premise of the study:

Development and characterization of a set of DNA microsatellite markers for Swartzia glazioviana (Fabaceae), a naturally rare and threatened tree species, were carried out to investigate its conservation genetics.

Methods and Results:

Through an enriched genomic library procedure, 10 DNA microsatellite loci were isolated and characterized for the species. The mean expected heterozygosity was 0.776 (0.424–0.894). Cross-species amplifications of these loci were successfully tested for six congener taxa (S. apetala var. apetala, S. flaemingii, S. langsdorffii, S. macrostachya, S. myrtifolia var. elegans, and S. simplex var. continentalis).

Conclusions:

The 10 polymorphic microsatellite markers developed are quite informative and will provide a valuable resource to study the population and conservation genetics of S. glazioviana and other Swartzia species.

Keywords: conservation, Fabaceae, population genetics, simple sequence repeat (SSR), Swartzia glazioviana, Swartzia spp


Swartzia glazioviana (Taub.) Glaz. (Fabaceae) is an endemic legume tree species that occurs on the slopes of coastal hills with sandbanks in the Região dos Lagos, Rio de Janeiro, Brazil (Mansano and Lima, 2007; Bohrer et al., 2009). Swartzia glazioviana is considered a threatened species (Ministério do Meio Ambiente, 2014) due to its rare distribution and limited occurrence in very disturbed and fragmented habitats, which may compromise the viability of their populations as evolutionary units. To our knowledge, there are no detailed studies on the ecology, reproductive biology, and population genetics for this species that could contribute effectively to its conservation. Microsatellites (or simple sequence repeats [SSRs]) are considered the marker of choice for population genetic studies due to their codominant nature, high information content (polymorphisms), and reproducibility (Litt and Luty, 1989; Selkoe and Toonen, 2006). They are ideal markers to investigate the genetic diversity and structure, mating system, and gene flow of tree populations (Ashley, 2010), including those considered endangered species, such as S. glazioviana. Here we present the development and characterization of a set of highly polymorphic microsatellite markers developed for S. glazioviana for use in population genetic and conservation studies of this endemic species from the Brazilian Atlantic Forest.

METHODS AND RESULTS

For the library construction, total genomic DNA was extracted from dried leaves previously collected from a single adult of S. glazioviana. The genomic library was enriched for the repeat motifs CT and GT using biotinylated probes with streptavidin-coated magnetic beads according to Billotte et al. (1999). The total genomic DNA extraction followed a modified cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1990; Ferreira and Grattapaglia, 1998).

The total genomic DNA was cleaved using AfaI restriction enzyme (Invitrogen, Carlsbad, California, USA), and the fragments were ligated to Afa21 (5′-CTCTTGCTTACGCGTGGACTA-3′) and Afa25 (5′-TAGTCCACGC GTAAGCAAGAGCACA-3′) adapters. The linked fragments were amplified via PCR and purified using QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany). Selected fragments were reamplified using primer Afa21, cloned using pGEM-T Easy Vector (Promega Corporation, Madison, Wisconsin, USA), and transformed into Escherichia coli (XL1-Blue) competent cells by electroporation. The transformed cells were grown in Luria–Bertani medium containing ampicillin and IPTG/X-Gal and incubated. Recombinant-positive clones were selected and grown on Circlegrow (MP Biomedicals, Santa Ana, California, USA) and plasmid DNA extracted. Sequencing reactions used T7 or Sp6 universal primers and BigDye Terminator Cycle Sequencing Kit (version 3.1; Life Technologies, Grand Island, New York, USA) and sequencing was performed on an ABI 377XL sequencer (Applied Biosystems, Waltham, Massachusetts, USA) following the manufacturer’s instructions. Primer pairs complementary to the flanking regions of the repeats were designed using Primer3 software (Rozen and Skaletsky, 1999). Of 96 positive sequenced clones, 38 (∼40%) showed repetitive elements of which ca. 70% were dinucleotide CT or GA. Of these, 20 (52.6%) sequences were appropriate for primer design. The loci were initially amplified using six DNA samples of S. glazioviana from the three populations. PCRs were performed in a final volume of 13.0 μL containing: 2.0 μL of ultrapure water, 1.4 μL of 10× reaction buffer (NH4), 1.0 μL MgCl2 (50 mM), 1.2 μL bovine serum albumin (BSA; 2.5 mg/mL), 0.8 μL dNTPs (250 mM), 4.3 μL of unlabeled primers (0.9 mM of each), 0.3 μL Taq Polymerase (5 U/μL), and 2.0 μL of DNA template (2.5 ng/μL) in a Veriti thermocycler (Life Technologies). The following PCR program was used: one cycle at 95°C for 5 min; 30 cycles at 94°C for 1 min, at primer annealing temperature for 1 min, and at 72°C for 1 min; and a final extension cycle at 72°C for 10 min. Ten out of 20 markers that showed specific and robust PCR products in agarose gels were chosen, and the forward primer of each pair was fluorescently labeled (6-FAM, VIC, and NED). The PCR mixture contained a final volume of 10.0 μL with: 1.6 μL of ultrapure water, 1.0 μL of 10× reaction buffer (NH4), 2.0 μL of MgCl2 (50 mM), 2.0 μL BSA (2.5 mg/mL), 0.8 μL dNTPs (250 mM), 0.3 μL of primers (10 mM), 0.3 μL of Taq DNA Polymerase (5 U/μL), and 2.0 μL of DNA template (2.5 ng/μL). The PCR program was as follows: one cycle at 94°C for 5 min; 30 cycles at 94°C for 1 min, at annealing temperature of each primer pair for 1 min, and at 72°C for 1 min; and a final cycle at 72°C for 60 min.

In total, 96 individuals were sampled (32 per population) from three populations of S. glazioviana located in Arraial do Cabo (22°58′07″S, 42°01′00″W) and Cabo Frio (22°52′21″S, 41°58′53″W; 22°51′20″S, 41°59′38″W), Rio de Janeiro, Brazil (voucher numbers in Appendix 1). A batch of 96 adult individuals (32 per population) of S. glazioviana was used for SSR loci screening (Table 1). The products were analyzed in a 3500XL DNA sequencer (Life Technologies) following the manufacturer’s instructions. Alleles were sized using GeneScan 600 LIZ Size Standard (Life Technologies) and GeneMapper 4.0 software (Life Technologies). We estimated total and average number of alleles per locus (A) and observed (Ho) and expected (He) heterozygosities according to the proportions of Hardy–Weinberg equilibrium, for each and overall loci. Inbreeding was quantified by estimating the coefficient of inbreeding (F), and the statistical significance of the F values was tested by Monte Carlo permutation resampling alleles among individuals. We also tested the occurrence of genotypic disequilibrium between pairwise loci using a Bonferroni correction. All estimates were performed using FSTAT (Goudet, 1995). We also inferred the discriminatory power of the SSR loci by estimating the probabilities of genetic identity (I) for each locus and combined (IC) overall loci according to Taberlet and Luikart (1999), and the probabilities of paternity exclusion (Q) for each locus and the combined probability (QC) for all loci (Weir, 1996).

Table 1.

Characteristics of 10 microsatellite markers developed for Swartzia glazioviana.

Locus Primer sequences (5′–3′) Fluorescent label Repeat motif Allele size (bp) Ta (°C) GenBank accession no.a
Sgl01 F: CGCTCTCATTTCCTCCATTC 6-FAM (CT)7T2(CT)9 193 56 KR002083
R: TGTTGAGCACACTCTTGTCG
Sgl05 F: AGATGCTCCTAACGCAGAGTG NED (TC)6C(CT)14 156 63 KR002084
R: GAGGCAGCGGTTCAAACT
Sgl11 F: TGCTCCTGCCAAACTCATC 6-FAM (GA)20 209 58 KR002086
R: TCTGGGCGTTTGTCTGAGT
Sgl12 F: ATGAGCCGTGACAGAGTTG NED (AG)19 180 60 KR002087
R: TCATGGGGAACTGTCCTG
Sgl15 F: TGCCATTCCACATATCAGC VIC (GA)15 185 57 KR002088
R: GACAACACAGCCACTAGAATCA
Sgl16 F: GTGTGCTGTGTGGATATGTGG 6-FAM (AG)19 224 58 KR002089
R: CCTGTGATAGGGAATCTGCTG
Sgl17 F: AGAAGGGGAAATGGGTAACTG 6-FAM (AG)16 226 63 KR002090
R: GAAAGTTTTGCTGGGATGCT
Sgl18 F: CAGCCACTGACTTCACATTTC 6-FAM (CT)12G(TC)6 162 56 KR002091
R: AGGGCCTTAGTGGAATTTTTAC
Sgl19 F: GAGTTGGGAGCTTGGTTGAG VIC (CT)17 188 67 KR002092
R: CTCTTTCTGGACGCGAAGA
Sgl20 F: CAGGTGGGCTGCATACAATA VIC (CT)20 185 60 KR002093
R: GGACCCTTTGAGACAGTTCG

Note: Ta = annealing temperature.

a

GenBank sequences available in April 2016.

The number of alleles per locus ranged from four to 12 (mean 8.5). Mean Ho was 0.642 (0.290–0.969) and He ranged from 0.424 to 0.894 (mean 0.776). Mean F was significantly greater than zero for two of the populations (Table 2). QC was 0.999995 (0.213–0.477), and IC was 2.245 × 10−14 (0.022–0.120), across the 10 loci, clearly showing the high individual discrimination power of the loci (Table 2). After Bonferroni corrections, significant genotypic disequilibrium was detected between only two pairwise loci (Sgl15xSgl19 and Sgl15xSgl20).

Table 2.

Genetic diversity and coefficient of inbreeding estimated for three populations of Swartzia glazioviana in the central coast of Rio de Janeiro, Brazil, based on the analysis of 10 microsatellite loci.

Trilha do Forno population (n = 32) Praia das Conchas population (n = 32) Encosta Rua Vitória population (n = 32)
Locus A Ho He F P value A Ho He F P value A Ho He F P value
Sgl01 8 0.876 0.709 −0.235 0.011 9 0.656 0.858 0.235 0.002 7 0.581 0.848 0.315* 0.001
Sgl05 10 0.531 0.838 0.366* 0.001 10 0.290 0.798 0.636* 0.001 6 0.549 0.687 0.201 0.044
Sgl11 8 0.781 0.727 −0.074 0.310 7 0.813 0.704 −0.155 0.966 4 0.406 0.424 0.042 0.452
Sgl12 12 0.969 0.830 −0.167 0.017 11 0.781 0.870 0.102 0.120 9 0.625 0.838 0.254 0.002
Sgl15 5 0.438 0.539 0.188 0.076 11 0.501 0.847 0.409* 0.001 5 0.562 0.553 −0.017 0.550
Sgl16 12 0.875 0.894 0.021 0.486 12 0.719 0.840 0.144 0.044 9 0.688 0.731 0.059 0.301
Sgl17 8 0.906 0.749 −0.210 0.012 7 0.656 0.726 0.096 0.212 5 0.531 0.613 0.133 0.169
Sgl18 6 0.625 0.816 0.234 0.010 8 0.594 0.826 0.281* 0.001 7 0.843 0.803 −0.050 0.405
Sgl19 12 0.500 0.878 0.431* 0.001 10 0.750 0.826 0.092 0.162 6 0.688 0.776 0.114 0.149
Sgl20 11 0.613 0.839 0.269 0.038 11 0.407 0.828 0.509* 0.001 9 0.500 0.775 0.355* 0.001
Mean 9.2 0.712 0.782 0.090 0.002 9.6 0.617 0.812 0.241* 0.001 6.7 0.598 0.705 0.152* 0.001
SD 2.6 0.192 0.105 0.247 1.8 0.171 0.055 0.232 1.8 0.121 0.137 0.138
Total 92 96 67

Note: A = number of alleles; F = coefficient of inbreeding; He = expected heterozygosity; Ho = observed heterozygosity.

*

Significant departure from Hardy–Weinberg equilibrium, after Bonferroni correction (P = 0.0001).

Amplification of the 10 SSR loci developed for S. glazioviana was tested for six congeners: S. apetala Raddi var. apetala, S. flaemingii Raddi, S. langsdorffii Raddi, S. macrostachya Benth., S. myrtifolia Sm. var. elegans (Schott) R. S. Cowan, and S. simplex (Sw.) Spreng. var. continentalis Urb. We found a high cross-species transportability rate (68%) of the 10 loci across the six Swartzia species. The success amplification rates of the loci for each species were as follows: S. apetala var. apetala (90%), S. flaemingii (45%), S. simplex var. continentalis (40%), S. langsdorffii and S. macrostachya (80%), and S. myrtifolia var. elegans (60%) (Table 3).

Table 3.

Cross-species amplification analysis for 10 microsatellite markers developed for Swartzia glazioviana and tested in six congeneric species.a

Locus S. apetala (n = 3) S. flaemengii (n = 2) S. langsdorffii (n = 3) S. macrostachya (n = 3) S. myrtifolia var. elegans (n = 5) S. simplex var. continentalis (n = 2)
Sgl01 +/4 +/2 +/3 +/6 +/2
Sgl05 +/3 +/? +/2 +/4 +/3 +/m
Sgl11 +/3 +/4 +/4 +/5 +/5 +/3
Sgl12 +/4 +/2 +/4 +/m +/m
Sgl15 +/3 +/2 +/4
Sgl16 +/4 +/4 +/2 +/3 +/5 +/3
Sgl17 +/2 +/3 +/m +/5
Sgl18 +/4 +/? +/2 +/? +/2 +/2
Sgl19 +/? +/3 +/4 +/m +/m
Sgl20 +/3 +/2 +/3 +/2 +/4 +/m

Note: + = positive amplification; — = no amplification; m = monomorphic; n = number of individuals.

a

Shown for each locus is amplification/number of alleles.

CONCLUSIONS

The 10 SSR loci isolated for S. glazioviana showed high levels of genetic diversity. The IC and QC estimates also indicate the highly informative and discriminatory power of these loci, which are important for their use in parentage analysis. The results also highlight the potential of the developed microsatellite markers for estimating population genetic parameters in six other Swartzia species.

The 10 polymorphic markers reported here will be useful tools for estimating pollen dispersal, mating system, genetic diversity, and population genetic structure and will provide relevant information for the effective population preservation of this threatened tree species.

Appendix 1.

Voucher numbers for Swartzia glazioviana populations and other Swartzia species sampled in the current study.

Species Voucher accession no.a Collection localityb Geographic coordinates
S. glazioviana (Taub.) Glaz. RB 623221 Trilha do Forno, Arraial do Cabo, Rio de Janeiro, RJ, Brazil 22°58′07″S, 42°01′00″W
S. glazioviana RB 623226 Praia das Conchas, Cabo Frio, Rio de Janeiro, RJ, Brazil 22°52′21″S, 41°58′53″W
S. glazioviana RB 623228 Encosta Rua Vitória, Cabo Frio, Rio de Janeiro, RJ, Brazil 22°51′20″S, 41°59′38″W
S. apetala Raddi RB 439025 Santa Cruz, Vila de Itaparica, Espírito Santo, Brazil 19°58′21″S, 40°08′52″W
S. flaemingii Raddi RB 436845 Machadinha, Rio de Janeiro, RJ, Brazil 22°01′29″S, 41°27′17″W
S. langsdorffii Raddi RB 466380 Jardim Botânico do Rio de Janeiro 22°58′05″S, 43°13′28″W
S. macrostachya Benth. RB 452769 Espírito Santo, Brazil 19°04′59″S, 39°53′06″W
S. myrtifolia Sm. var. elegans (Schott) R. S. Cowan RB 452764 Linhares, Espírito Santo, Brazil 19°48′54″S, 39°13′23″W
S. simplex (Sw.) Spreng. var. continentalis Urb. RB 452762 Espírito Santo, Brazil NA

Note: NA = not available.

a

Voucher deposited at Jardim Botânico do Rio de Janeiro herbarium (RB), Rio de Janeiro, Brazil.

b

Locality, Brazilian province, state, country.

LITERATURE CITED

  1. Ashley M. V. 2010. Plant parentage, pollination, and dispersal: How DNA microsatellites have altered the landscape. Critical Reviews in Plant Sciences 29: 148–161. [Google Scholar]
  2. Billotte N., Lagoda P. J. L., Risterucci A. M., Baurens F. C. 1999. Microsatellite-enriched libraries: Applied methodology for the development of SSR markers in tropical crops. Fruits 54: 277–288. [Google Scholar]
  3. Bohrer C. B. A., Dantas H. G. R., Cronemberger F. M., Vicens R. S., Andrade S. F. 2009. Mapeamento da vegetação e do uso do solo no centro de diversidade vegetal de Cabo Frio, Rio de Janeiro, Brasil. Rodriguesia 60: 1–23. [Google Scholar]
  4. Doyle J. J., Doyle J. L. 1990. A rapid total DNA preparation procedure for fresh plant tissue. Focus 12: 13–15. [Google Scholar]
  5. Ferreira M. E., Grattapaglia D. 1998. Introdução ao uso de marcadores moleculares em análise genética, 3rd ed. Embrapa-Cenargem, Brasília, Distrito Federal, Brazil. [Google Scholar]
  6. Goudet J. 1995. FSTAT (Version 2.9.3.2.): A computer program to calculate F-statistics. Heredity 86: 485–486. [Google Scholar]
  7. Litt M., Luty J. A. 1989. A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. American Journal of Human Genetics 44: 397–401. [PMC free article] [PubMed] [Google Scholar]
  8. Mansano V. F., Lima J. R. 2007. O gênero Swartzia Schreb. (Leguminosae, Papilionoideae) no Estado do Rio de Janeiro. Rodriguesia 58: 469–483. [Google Scholar]
  9. Ministério do Meio Ambiente 2014 Portaria no. 443, 17 dezembro 2014. Diário Oficial da União, Seção 1, no. 245, 18 dezembro 2014.
  10. Rozen S., Skaletsky H. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
  11. Selkoe K. A., Toonen R. J. 2006. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecology Letters 9: 615–629. [DOI] [PubMed] [Google Scholar]
  12. Taberlet P., Luikart G. 1999. Non-invasive genetic sampling and individual identification. Biological Journal of the Linnean Society 68: 41–55. [Google Scholar]
  13. Weir B. 1996. Genetic data analysis, 2nd ed. Sinauer, Sunderland, Massachusetts, USA. [Google Scholar]

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES