Skip to main content
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2016 Feb 11;4(2):apps.1500096. doi: 10.3732/apps.1500096

Development of microsatellite markers for the semi-natural grassland herb Veronicastrum japonicum (Plantaginaceae)1

Naoyuki Nakahama 2,3, Ayako Izuno 2, Kurumi Arima 2, Yuji Isagi 2
PMCID: PMC4760747  PMID: 26949575

Abstract

Premise of the study:

Veronicastrum japonicum (Plantaginaceae) grows in grasslands on Honshu Island, Japan, and is threatened by habitat loss because of rapid land development over recent decades. For the genetic characterization of the remaining populations, microsatellite markers were developed.

Methods and Results:

Twelve polymorphic microsatellite loci were developed using next-generation sequencing. The number of alleles per locus ranged from two to 24 (mean 7.7), and the expected heterozygosity per locus ranged from 0.35 to 0.94 (mean 0.68).

Conclusions:

These markers can be used for genetic studies in conservation, such as the evaluation of genetic diversity and genetic structure.

Keywords: conservation, grassland herb, next-generation sequencing, Plantaginaceae, Veronicastrum japonicum


Veronicastrum japonicum (Nakai) T. Yamaz. (Plantaginaceae) is a perennial plant species growing in the grasslands of mountainous regions on Honshu Island, Japan (Ohwi, 1978). In recent decades, the number of V. japonicum populations has rapidly decreased, and this species is now classified as near threatened or higher in five of the 47 Prefectural Red Lists of Japan (Association of Wildlife Research and EnVision, 2007). The decline of V. japonicum populations can be attributed to shrinking grasslands resulting from land development or the abandonment of traditional management. Furthermore, serious grazing damage by deer, which has explosively increased in the past few decades, has threatened V. japonicum populations (Takatsuki, 2009; Nagaike et al., 2014). Veronicastrum japonicum is also the main larval food plant species of Melitaea ambigua (Butler) (Nymphalidae), a rare butterfly species classified as endangered in the Japanese Red List (Ministry of the Environment of Japan, 2012). Accordingly, knowledge of the genetic diversity and structure of V. japonicum populations is important for the conservation management of V. japonicum and M. ambigua. Thus, 12 nuclear microsatellite markers for V. japonicum were developed using next-generation sequencing.

METHODS AND RESULTS

A fresh leaf sample of V. japonicum was collected from an individual plant growing in Gunma Prefecture, Japan, and genomic DNA was extracted using the DNeasy Plant Mini Kit (QIAGEN, Germantown, Maryland, USA). A DNA fragment library was constructed with an Ion Xpress Plus Fragment Library Kit (Life Technologies, Foster City, California, USA), amplified with an Ion PGM Template OT2 400 Kit, and subsequently sequenced with an Ion PGM Sequencing 400 Kit and an Ion 318 Chip v2 (both from Life Technologies), yielding 161,880 reads (size range 8–618 bp; mean 220 bp). The reads were screened using Primer3 software (Rozen and Skaletsky, 1999) embedded in MSATCOMMANDER version 0.8.2 (Faircloth, 2008) to identify dinucleotide and trinucleotide loci of at least eight and seven repeats, respectively. After screening, 284 putative microsatellite loci were identified. Using these loci, a total of 57 primer pairs with melting temperatures (Tm) of 57–61°C, GC content of 35–75%, and fragment sizes of 150–350 bp were designed.

Amplification and specificity of 34 out of the 57 primer pairs were tested using four V. japonicum individuals. For all confirmed microsatellite loci, the forward primers were synthesized using one of the three different M13 sequences, 5′-CACGACGTTGTAAAACGAC-3′, 5′-CTATAGGGCACGCGTGGT-3′, or 5′-TGTGGAATTGTGAGCGG-3′ (Boutin-Ganache et al., 2001) as shown in Table 1. Each PCR amplification was performed in a final volume of 5 μL, containing approximately 16 ng of template DNA, 2.5 μL of 2× Multiplex PCR Master Mix (QIAGEN, Valencia, California, USA), 0.01 μM of forward primer, 0.2 μM of reverse primer, and 0.1 μM of M13 (fluorescent-labeled) primer. The PCR thermal profile was as follows: initial denaturation at 95°C for 15 min; followed by 33 cycles of 94°C for 30 s, 57°C for 1.5 min, and 72°C for 1 min; and a final extension at 60°C for 30 min. The PCR products were detected on the ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Waltham, Massachusetts, USA). Fragment lengths were calculated using GeneMapper software (Applied Biosystems). Of the 34 primer pairs tested, 13 did not amplify specific regions and nine did not amplify in all four individuals. Twelve primer pairs amplified in all four individuals, and the lengths of amplified fragments were scored unambiguously. The 12 primers were used for analysis of 21 and 27 individuals sampled from two populations located in Gunma and Nagano prefectures, respectively (Gunma: 36°26′12″N, 138°25′27″E; Nagano: 35°57′25″N, 137°37′49″E). One specimen from each population was collected and deposited in the Kyoto University Museum herbarium (accession numbers: KYO_00019997 and KYO_00019998, respectively). Population statistics were calculated using GenAlEx version 6.4 (Peakall and Smouse, 2006). Tests for deviation from Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) between loci were performed using FSTAT version 2.9.3 (Goudet, 1995).

Table 1.

Characteristics of microsatellite loci for Veronicastrum japonicum. All values are based on 48 samples from two populations in Gunma and Nagano prefectures in Japan.a

Locus Primer sequences (5′–3′) Repeat motif Fluorescent labelb Allele size range (bp) GenBank accession no.
Veja004 F: AGGAGCCCAGTTTGCCTAC (CT)9 FAM 211–221 LC030210
R: CAAATGCTAATTGATCTCGACC
Veja005 F: CCCTCTTTCTGGAAGTTTGAGC (TGT)6 VIC 232–237 LC030211
R: ACGACTCCTCCTTGCTTAGG
Veja007 F: GGGACATTGGAATGGAGGC (TCT)6 FAM 166–176 LC030212
R: ATTGATGCTGAACCAGGGC
Veja009 F: CATTAAATACTCTCTCCGCAGG (CT)9 NED 233–253 LC030213
R: GCTCTTCCTCACGAGTTTCC
Veja011 F: TGATGCTTGCCATCGTTCC (GCT)9 VIC 200–221 LC030214
R: AACTCAGCTGTTCCTCCCG
Veja012 F: CTTCCTTCACCAACCAAGGG (GT)9 NED 308–332 LC069371
R: AACAGGACTCGCTCGTCAG
Veja015 F: CTGTCCCACCTTTAGATTCCC (TC)9 NED 187–193 LC030215
R: GTCCCTTCACAAGCTTCCC
Veja018 F: CACCAATCATTTCCGCAAACC (GA)12 NED 251–321 LC030216
R: ACAACCGCCCTTTATGATCTAC
Veja021 F: TGGACACATCAACCAGATTTCC (TAT)7 NED 194–209 LC030217
R: TCCTGGATTCAACGAGAACC
Veja025 F: AGGCCAATCAAACTAATTACGC (CA)9 FAM 173–192 LC030218
R: ACGCTTGTAGAGAGGTTAGGC
Veja029 F: GCGCACTGTTAAGGACAGG (TGT)6 VIC 178–196 LC030219
R: CGTGAACAACGGCATACCC
Veja032 F: CAACGCCAGCCATCCATAC (GT)10 VIC 238–265 LC030220
R: TTGGAGGAGAATGACACCCA
a

Annealing temperature was 57°C for all loci.

b

Sequence of the fluorescent labels: FAM = 5′-CACGACGTTGTAAAACGAC-3′, NED = 5′-CTATAGGGCACGCGTGGT-3′, VIC = 5′-TGTGGAATTGTGAGCGG-3′.

The number of alleles per locus ranged from two to 24 (mean 7.7) (Table 2). The observed and expected heterozygosities per locus ranged from 0.30 to 1.00 (mean 0.66) and from 0.35 to 0.94 (mean 0.68), respectively (Table 2). Only one locus (Veja009) in the Gunma population showed significant deviation from HWE (P < 0.05). Significant LD was found in the Nagano population for only one pair of loci (Veja004 and Veja021; P < 0.05).

Table 2.

Results for primer screening of all samples for 12 microsatellite loci in two populations of Veronicastrum japonicum.a,b

Gunma (N = 21) Nagano (N = 27)
Locus A Ho He FIS A Ho He FIS
Veja004 7 0.81 0.75 −0.09 5 0.48 0.59 0.19
Veja005 2 0.43 0.39 −0.11 3 0.37 0.60 0.39
Veja007 6 0.62 0.71 0.13 6 0.70 0.65 −0.08
Veja009 8 0.48 0.70 0.32 8 0.70 0.80 0.12
Veja011 6 0.62 0.53 −0.17 5 0.59 0.64 0.08
Veja012 13 0.86 0.82 −0.05 12 0.78 0.77 −0.01
Veja015 4 0.52 0.67 0.22 4 0.30 0.35 0.15
Veja018 18 0.95 0.91 −0.04 24 1.00 0.94 −0.06
Veja021 7 0.62 0.73 0.15 6 0.67 0.71 0.06
Veja025 9 0.57 0.67 0.14 10 0.93 0.85 −0.09
Veja029 5 0.52 0.52 −0.01 3 0.70 0.60 −0.17
Veja032 5 0.86 0.73 −0.17 9 0.63 0.67 0.06

Note: A = number of alleles; FIS = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = sample size.

a

Populations: Gunma Prefecture: 36°26′12″N, 138°25′27″E; Nagano Prefecture: 35°57′25″N, 137°37′49″E. Vouchers deposited in the Kyoto University Museum herbarium (accession numbers: KYO_00019997 and KYO_00019998, respectively).

b

Numbers in boldface show deviations from Hardy–Weinberg equilibrium (P < 0.05).

CONCLUSIONS

The microsatellite markers described in this study will be useful for conservation genetic studies of V. japonicum, such as those evaluating genetic diversity and structure within and between populations. Assessment of their genetic information will also contribute to elucidating how V. japonicum genetic diversity and structure has been affected by declining populations and habitat management practices. Understanding the impacts of habitat management will help the conservation of both V. japonicum and the endangered butterfly M. ambigua, because maintenance of V. japonicum population size is crucial for survival of this butterfly species.

LITERATURE CITED

  1. Association of Wildlife Research and Envision. 2007. Search system of Japanese Red Data. Website http://www.jpnrdb.com/index.html [accessed 1 February 2015] [in Japanese].
  2. Boutin-Ganache I., Raposo M., Raymond M., Deschepper C. F. 2001. M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. BioTechniques 31: 24–26. [PubMed] [Google Scholar]
  3. Faircloth B. C. 2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus-specific primer design. Molecular Ecology Resources 8: 92–94. [DOI] [PubMed] [Google Scholar]
  4. Goudet J. 1995. FSTAT: A computer program to calculate F-statistics, version 1.2. Journal of Heredity 86: 485–486. [Google Scholar]
  5. Ministry of the Environment of Japan. 2012. The red list of insects of Japan. Web site http://www.biodic.go.jp/rdb/rdb_f.html [accessed 1 February 2015] [in Japanese].
  6. Nagaike T., Ohkubo E., Hirose K. 2014. Vegetation recovery in response to the exclusion of grazing by sika deer (Cervus nippon) in seminatural grassland on Mt. Kushigata, Japan. ISRN Biodiversity 2014: 493495. [Google Scholar]
  7. Ohwi J. 1978. Flora of Japan. Shibundo, Tokyo, Japan [in  Japanese]. [Google Scholar]
  8. Peakall R., Smouse P. E. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Rozen S., Skaletsky H. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
  10. Takatsuki S. 2009. Effects of sika deer on vegetation in Japan: A review. Biological Conservation 142: 1922–1929. [Google Scholar]

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES