Summary
Polyporoid P hellinus fungi are ubiquitously present in the environment and play an important role in shaping forest ecology. Several species of P hellinus are notorious pathogens that can affect a broad variety of tree species in forest, plantation, orchard and urban habitats; however, current detection methods are overly complex and lack the sensitivity required to identify these pathogens at the species level in a timely fashion for effective infestation control. Here, we describe eight oligonucleotide microarray platforms for the simultaneous and specific detection of 17 important P hellinus species, using probes generated from the internal transcribed spacer regions unique to each species. The sensitivity, robustness and efficiency of this P hellinus microarray system was subsequently confirmed against template DNA from two key P hellinus species, as well as field samples collected from tree roots, trunks and surrounding soil. This system can provide early, specific and convenient detection of P hellinus species for forestry, arboriculture and quarantine inspection, and could potentially help to mitigate the environmental and economic impact of P hellinus‐related diseases.
Introduction
The Phellinus genus sensu lato currently comprises 154 species (Kirk, 2014) of resupinate, sessile, polyporoid fungi, several of which are known to cause diseases such as stem rot, butt rot, root rot or tree wilt in a wide range of tree species (Van der Kamp, 1991; Castello et al., 1995). These tree‐pathogenic fungi include some of the most aggressive wood‐decay species identified thus far, infestations of which can devastate forest ecosystems, impact economic viability and render urban environments more vulnerable to tree hazards (Hansen and Goheen, 2000; Ann et al., 2002; Burdon et al., 2006). To date, the identification of diseased trees has primarily relied on visual inspection for signs and symptoms, pathogen isolation and characterization on selective media and other biochemical and immunological techniques (Nobles, 1965; Anselmi and Bragaloni, 1992; Jellison and Jasalavich, 2000; Clausen, 2003). However, the diagnostic process is typically laborious, time consuming and heavily reliant on experienced etiologists; moreover, the low sensitivity of such methods makes it unlikely that infestations can be detected and controlled during the relatively manageable early stages of disease (Thorn et al., 1996; Adair et al., 2002; McCartney et al., 2003; Luisi and Campanile, 2004). In addition, current methods are limited in their ability to identify the causative agent of Phellinus‐related diseases at the species level, the knowledge of which is necessary for deploying appropriate control measures (Nam et al., 2002) and for ascertaining whether the infestation is native or exotic in nature (Hansen and Goheen, 2000). Phellinus species differentiation has traditionally relied on the morphological examination of fruiting bodies, spores and basidiocarps, but these may not appear until long after infection, by which time it is often too late to save the diseased tree (Nam et al., 2002). Therefore, the development of accurate, fast and specific diagnostic tools that can be easily used by personnel with a minimum of training is essential for the prevention and practical management of Phellinus infestations.
Recent advances in molecular biology offer the possibility of alternative approaches that can efficiently identify Phellinus pathogens, including nucleic acid‐based techniques such as dot‐blot hybridization, restriction fragment length polymorphism analysis, single‐strand conformation polymorphism analysis and polymerase chain reaction (PCR) assays (Olive and Bean, 1999; Tsui et al., 2011). Polymerase chain reaction‐based methods have been used to identify Phellinus s.l. at a generic rank (Guglielmo et al., 2007; 2008), but a single assay that can efficiently pinpoint the exact disease causative agent and provide differentiation between rapid‐decaying and slow‐progressive Phellinus species remains elusive (Lievens and Thomma, 2005). However, methods combining nucleic acid amplification and DNA arrays have demonstrated strong potential, and their good sensitivity and specificity may allow for early and accurate detection of Phellinus infestation at the species level (Martin et al., 2000; Lévesque, 2001; Lievens and Thomma, 2005; Lievens et al., 2005; Tsui et al., 2011). In these strategies, DNA sequence samples are first amplified, then labelled with universal primers that target conserved regions flanking variable domains, and subsequently hybridized with species‐specific oligonucleotide probes on DNA arrays to screen for fungal pathogens (Saiki et al., 1989; McCartney et al., 2003; Lievens and Thomma, 2005; Lievens et al., 2007; 2004; Tsui et al., 2011). But while it is true that array technology currently offers the best chance of realizing a simple, efficient, high‐throughput pathogen detection platform that can be readily deployed in the field, one key factor has limited development thus far – a lack of discriminatory genetic regions available for species identification (Everett et al., 2010; Frey et al., 2010).
Here, we report the development of a robust high‐throughput oligonucleotide microarray system capable of simultaneously screening for multiple Phellinus species. The system utilizes species‐specific probes generated from internal transcribed spacer (ITS) regions, areas of non‐coding DNA located between the small subunit and large subunit ribosomal RNA (rRNA)‐coding genes, which are removed after transcription of the rRNA cistron (Lafontaine and Tollervey, 2001). It has been proposed that ITS regions can serve as a universal barcode marker for fungi, as they provide the broadest range of inter‐ and intra‐species differentiation currently known (Schoch et al., 2012). Internal transcribed spacer sequences have previously been used to develop primers for PCR‐based identification of Phellinus species (Nam et al., 2002; Gonthier et al., 2015), but to the best of our knowledge, this is the first study to utilize ITS regions in the development of DNA microarrays for detection of the Phellinus genus s.l. We were able to specifically resolve 17 key Phellinus species on our microarray system, including Phellinus apiahynus, P. cesatii, P. gilvus, P. linteus, P. inermis, P. laevigatus, P. melleoporus, P. membranaceus, P. noxius, P. pini, P. quercinus, P. ribis, P. igniarius, P. formosanus, P. pachyphloeus, P. torulosus (now reclassified as Fuscoporia torulosa) and P. weirii. Tests with template DNA sequences and field samples confirmed the sensitivity and specificity of our microarray system, which was also shown to reliably detect infections in trees before any visually identifiable symptoms of disease were observed. There is strong demand now in forestry, arboriculture and phytosanitation for pathogen detection systems that can be easily mastered and readily deployed to yield early, accurate and specific results in a very short space of time. Our Phellinus microarray system fulfils most of these practical requirements, and could potentially play a part in reducing the environmental and economic impact of Phellinus infestation worldwide.
Results
Design of oligonucleotide probes and DNA microarrays
To develop a rapid and reliable detection system capable of inter‐species differentiation, we first amplified the ITS1–5.8S–ITS2 genetic region of 17 Phellinus species, using universal primers previously described (White et al., 1990). The resulting PCR amplicons varied between 600 bp and 750 bp, and were further utilized in the design of oligonucleotide probes. The two ITS regions, ITS1 and ITS2, contain a high degree of sequence variations, which could potentially be used to generate specific probes capable of resolving different Phellinus species. A total of 48 probes, ranging between 28 bp and 60 bp in length and targeted to the ITS1 and ITS2 regions, were subsequently synthesized. Species‐specific sequences were designed to be located at the centre of each probe, and the probes were subjected to extensive screening with hybridization assays to confirm specificity. Through this screening process, 17 oligonucleotide probes (Table 1), one for each key Phellinus species targeted, were eventually selected for the development of a reverse dot‐blot hybridization DNA microarray (Fig. 1). In order to assess the applicability of the selected probes to different array systems, and to validate the reliability and efficiency of our microarrays, PCR amplicons from 27 target reference strains and 20 non‐target strains were labelled with digoxigenin‐deoxynucleoside triphosphate (DIG‐dNTP), DIG‐tagged primers, biotin‐dNTP or biotin‐tagged primers, and then reverse‐hybridized to probes spotted on either nylon membranes or PVC chips, to derive a total of eight different array platforms (Fig. 1; Fig. S1).
Table 1.
Oligonucleotide probes used in the P hellinus microarray system
| Code | Species (Reference strain) | Sequence (5' to 3') | Length | Tm |
|---|---|---|---|---|
| Phapi | P. apiahynus (BCRC 35468) | GTCTTGTCCCCTCTTTTCATAGGAGGGGGGGGACCAGTCTTTCAAGCTGGTAT | 53 bp | 81.4°C |
| Phces | P. cesatii (BCRC 35431) | TAATAGTATTGTGGTGGCCATTTGCTGTTATTCATTGTTAGAAGCGGGTAACC | 53 bp | 76.1°C |
| Phgil | P. gilvus (BCRC 35458) | GGATTGAAAGTCGAGGCGCAAGTCTTGACTGGAGAGAAACCTTTCTACGTTTT | 53 bp | 79.3°C |
| Phlin | P. linteus (TFRI 1100) | AGAGTCGAAGCTGGAGTAGTCTCTGTAATCGAAACGGGCTTTTGAAGTATGCT | 53 bp | 77.5°C |
| Phine | P. inermis (BCRC 35430) | GTTAGTAAAAGGGGCAAGGAGTAATCCT | 28 bp | 58.0°C |
| Phlav | P. laevigatus (BCRC 35495) | TTGGGCGTTTAGGACGGAGTAATGAGTAGAAAGGAGGTGTAATGCTTCCATTT | 53 bp | 78.0°C |
| Phmel | P. melleoporus (BCRC 35429) | TCAAACTTAACTCGGTTGAAGTGGGGGGAGGAACAGTGCAAGGAGGTGGTGAA | 53 bp | 83.3°C |
| Phmem | P. membranaceus (BCRC 35411) | AGGTCGGTGAAAGATATAAGTGTCTCTGACGCTTGTATTGGAAGCCTTCCTAT | 53 bp | 76.4°C |
| Phnox | P. noxius (BCRC 35248) | CTGAAGAGAGAGAGGGAGAGGGAGAGTGGTTTATTCGTTTATTCATTTATTCG | 53 bp | 75.2°C |
| Phpin | P. pini (BCRC 35384) | GCCGTCGGGGTTGACTTTGTTAGTAGTGTTTCGACGCGAAAGCATACGGTCGG | 53 bp | 84.4°C |
| Phque | P. quercinus (BCRC 35352) | ATTGCTACAAGTATGTTAATAAGGCGAACGCACTCTTTTCGGTGTTACTAGCT | 53 bp | 74.6°C |
| Phrib | P. ribis (BCRC 35326) | ACGCAAGTGAGTCGTCAGTTCCCCTAAGTTGGGAGTGACTTGATTTGCTTCGT | 53 bp | 81.6°C |
| Phign | P. igniarius (TFRI 1543) | AGTTGGCGGTTAGTAGTCGTAAGGCGAACACTTGTCGGCGAACACTTCAATAT | 53 bp | 79.8°C |
| Phfor | P. formosanus (TFRI 1129) | GGGGCGAGACCTTTGAGTTCGAAGACAGTAGTTCTTTTTGCAAATGTGAGGGC | 53 bp | 81.5°C |
| Phpac | P. pachyphloeus (TFRI 1131) | AATCTCTGGCCATTGGTGTCTTTCATTAGACGTCGACGTGCCTTTAACTTTGA | 53 bp | 79.8°C |
| Phtor | P. torulosus (TFRI 1132) | CGTATGTTGGGTCGATGGAAGGTAAAGCTTTACGGCGGCATCTTCTTTAGGTC | 53 bp | 80.6°C |
| Phwei | P. weirii (FP 133613 (A) Sp) | GCACTTTTCGAAGTCTGTCGTCGGCTCCCATTTGGAGCAGCTGGAGGTTT | 50 bp | 84.0°C |
a. Oligonucleotide probes were arranged on arrays as indicated in Fig. 1A.
b. Seven thymine bases were added to the 3'‐end of the probe.
b. Tm: melting temperature.
Figure 1.

Arrangement and reverse dot‐blot hybridization results of the P hellinus oligonucleotide microarray.
A. Arrangement of P hellinus species‐specific probes on microarrays. Phapi: P hellinus apiahynus; Phces: P . cesatii; Phgil: P . gilvus; Phlin: P . linteus; Phine: P . inermis; Phlav: P . laevigatus; Phmel: P . melleoporus; Phmem: P . membranaceus; Phnox: P . noxius; Phpin: P . pini; Phque: P . quercinus; Phrib: P . ribis; Phign: P . igniarius; Phfor: P . formosanus; Phpac: P . pachyphloeus; Phtor: P . torulosus; Phwei: P . weirii; PM: position marker labelled with Oligo‐(dT)10; HC: hybridization control; PC: positive control.
B. Reverse dot‐blot hybridization of biotin‐primer‐labelled amplicons from target reference strains to probes on nylon membrane.
C. Reverse dot‐blot hybridization of DIG‐primer‐labelled amplicons from target reference strains to probes on PVC chip.
Reverse dot‐blot hybridization of reference strains
Reverse dot‐blot hybridization results revealed that all test isolates from target Phellinus species successfully hybridized with their respective oligonucleotide probes, with no cross‐hybridization observed (Fig. 1B and C; Fig. S1). No hybridization signals apart from those generated by the positive controls were observed when non‐target strains were screened. Together, these results indicate that our microarray systems were capable of achieving 100% specificity under controlled laboratory conditions. Furthermore, the use of PVC chips could potentially allow the screening process to be completed within 2 h (excluding the time required for target DNA amplication), which would represent a significant improvement over traditional Phellinus species identification methods that rely on morphological examination and pathogen isolation.
Sensitivity analysis of microarrays
To determine the sensitivity of our array system, we serially diluted template genomic DNA from P. weirii, a serious threat to Douglas fir viability in the Pacific Northwest of North America (Hansen and Goheen, 2000), and P. noxius, one of the most destructive Phellinus species in Taiwan (Ann et al., 2002). Samples respectively containing 1 ng, 100 pg, 10 pg, 1 pg, 100 fg and 10 fg of starting DNA were prepared, amplified and subjected to agarose gel electrophoresis and hybridization with different microarray systems. While DNA agarose gel bands were only visible with samples containing up to 10 pg of starting DNA (Fig. 2), our microarrays were able to accurately identify the respective Phellinus species with as little as 1 pg of starting DNA (Fig. 2). Biotin labelling was found to be more sensitive than DIG labelling, but no visible differences in detection sensitivity were observed between nylon membranes and PVC chips (Fig. 2).
Figure 2.

Sensitivity analysis of the P hellinus microarray. Agarose gel electrophoresis (GE) and reverse dot‐blot hybridization against microarrays were performed with PCR‐amplified (A) P . weirii or (B) P . noxius ITS primers that were serially diluted to derive samples respectively containing 1 ng, 100 pg, 10 pg, 1 pg, 100 fg or 10 fg of starting DNA. Biotin – PVC: Biotin‐labelled primer amplicons hybridized to probes on PVC chip; DIG – PVC: DIG‐labelled primer amplicons hybridized to probes on PVC chip; Biotin – NY‐M: Biotin‐labelled primer amplicons hybridized to probes on nylon membrane; DIG – NY‐M: DIG‐labelled primer amplicons hybridized to probes on nylon membrane.
Analysis of complex samples and field samples
In the natural environment, infestations often involve multiple fungal species, and a robust diagnostic system should have the ability to identify several different pathogenic species simultaneously. We therefore sought to assess whether our microarray system would be capable of detecting multiple Phellinus species within a single assay. We prepared complex samples that combined template genomic DNA from P. noxius, P. melleoporus, P. pini and P. weirii, and subjected the samples to reverse hybridization against our microarrays. The results showed that the arrays were capable of accurately detecting multiple Phellinus species in a single sample (Fig. 3).
Figure 3.

Microarray detection of complex samples within a single assay.
A. Complex sample containing two P hellinus species, P . melleoporus and P . noxius.
B. Complex sample containing three P hellinus species, P . melleoporus, P . noxius and P . pini.
C. Complex sample containing four P hellinus species, P . melleoporus, P . noxius, P . pini and P . weirii.
We further prepared field samples from trees in Taiwan with suspected or confirmed Phellinus infestations. Dimocarpus longan, Cinnamomum camphora, Grevillea robusta, Ficus microcarpa and Prunus campanulata were among the tree species sampled. Our microarrays were able to detect the disease causative agent, P. noxius (Fig. S2), before disease symptoms were visually identifiable, and the detection results were subsequently confirmed through conventional morphological analyses and pathogen isolation methods. We further used our microarray system to assess tree seedlings from a local plant nursery for the presence of Phellinus infestations. Our results showed that multiple seedlings of five species (Fraxinus formosana, Cinnamomum camphora, Koelreuteria elegans, Michelia champaca and Acacia confusa) sampled were all free of Phellinus infection (Fig. S3).
Discussion
Wood rot diseases caused by the Phellinus genus s.l. can induce decay in the roots, trunk and branches of almost all woody plants, and represent a serious threat to forest ecosystems and commercial arboriculture. Among the Phellinus species, P. weirii is considered to be one of the most destructive pests in the economically important Douglas fir forests of the Pacific Northwest in North America (Holah et al., 1993; Thies and Sturrock, Resource Bulletin PNW‐GTR‐349, 1995; Leckie et al., 2004); P. noxius has ravaged forests, plantations, orchards and urban landscapes across Japan, Taiwan and Southeast Asia (Ann et al., 1999; 2002; Mohd Farid et al., 2005; Sahashi et al., 2014); P. ignarius has been implicated as the cause of the grapevine black measles disease currently affecting vineyards in Europe and North America (Chiarappa, 1997; Gatica et al., 2004); and P. pini is viewed as one of the most dangerous invasive threats to plantation forests in Australia (Mireku and Simpson, 2002). Phellinus‐related diseases are transmitted when the healthy roots of susceptible trees come into contact with infected roots, stumps or soil; alternatively, Phellinus spores can also colonize wounds on tree trunks or branches (Leckie et al., 2004). In the initial stages of disease, infected trees exhibit few symptoms, and by the time crown symptoms or Phellinus fruiting bodies appear, a significant portion of the root system will have been destroyed, to the point that it is often too late to save the tree (Nam et al., 2002; Leckie et al., 2004). Precise identification of the exact disease‐inducing Phellinus species is crucial for the accurate assessment of disease progression and effective deployment of control measures, but conventional methods that rely on morphological examination and pathogen isolation are slow and inefficient (Thorn et al., 1996; Adair et al., 2002; McCartney et al., 2003; Luisi and Campanile, 2004). Another cause for concern involves the increasing convenience of international transport and the effects of global warming, which can facilitate the spread of Phellinus species to new regions or temperate habitats that were previously inaccessible due to reasons of geography or climate (Mireku and Simpson, 2002; Sahashi et al., 2014). Considering that Phellinus species have been known to survive in wood or soil for as long as 50 years (Leckie et al., 2004), sensitive, rapid and convenient assays that can simultaneously screen for multiple Phellinus species will be needed to conduct quarantine inspections of soil, seeds and saplings, timber and other wood products. In this study, we describe an oligonucleotide microarray system that combines all of these key attributes, allowing for fast, sensitive and convenient simultaneous identification of 17 key Phellinus species. This would potentially facilitate the early detection of disease or contamination.
Previously, microarrays have seen limited application due to the difficulty of identifying unique sequences that can be used for inter‐species differentiation (Everett et al., 2010; Frey et al., 2010), but it has been recognized in recent years that the rRNA gene regions are highly variable, and may be used to generate species‐specific markers or probes (Schoch et al., 2012). Nuclear large subunit (LSU) ribosomal DNA (rDNA) has been used in taxonomy to establish subdivisions within the Inonotus genus s.l. and Phellinus genus s.l. (Wagner and Fischer, 2001; 2002a,b). The ITS regions of the rRNA genes have also been used for fungal identification (Turenne et al., 1999; Nam et al., 2002; Gonthier et al., 2015), and it was recently proposed that ITS sequences can serve as a universal bar code marker for fungi due to their excellent inter‐ and intra‐species differentiation ability in a wide range of fungal species (Schoch et al., 2012). In this study, we initially designed 48 oligonucleotide probes targeting the ITS1 and ITS2 regions in 17 selected Phellinus species. The eventually selected probes ranged from 28–53 bp in length, excluding an additional seven thymine bases added to the 3'‐ends to improve hybridization signals (Brown and Anthony, 2000; Peplies et al., 2003; Leaw et al., 2007). It is speculated that the improved effect is due to preferential attachment of the charged support to the added thymine bases at the 3'‐end, thus leaving a greater number of oligonucleotides available for hybridization (Brown and Anthony, 2000). We further found that stronger hybridization signals were observed with longer (> 50 bp) probes, which accorded with earlier reports (Letowski et al., 2004; Rhee et al., 2004; Tiquia et al., 2004). Of the 48 oligonucleotide probes we screened, 17 probes with 100% sensitivity to the target DNA and 100% selectivity for the target species were selected for use in microarrays. All of the selected probes were 50 bp or longer in length, with the exception of the 28 bp Phine probe, which was shortened to increase specificity. To cater to the lower melting temperature (Tm) of this shorter probe, the hybridization temperature of our microarrays was adjusted to 48°C; this did not compromise the specificity of longer probes.
Multiplex PCR‐based methods have previously been used to identify Phellinus s.l. at a generic rank (Guglielmo et al., 2007; 2008), and ITS sequences have been used in the development of primers for PCR‐based Phellinus species identification techniques (Nam et al., 2002; Gonthier et al., 2015). It is known that microarray techniques can facilitate the simultaneous identification of multiple pathogenic species in a high‐throughput manner (Martin et al., 2000; Lévesque, 2001; Lievens and Thomma, 2005; Lievens et al., 2005; Tsui et al., 2011). To the best of our understanding, this is the first study to employ probes generated from ITS regions in DNA microarrays for the identification and differentiation of Phellinus species, and we elected to use reverse dot‐blot hybridization to develop our arrays, as this method has been shown to result in fewer non‐specific cross‐hybridizations (Lévesque et al., 1998). We spotted the 17 probes selected for sensitivity and specificity against target Phellinus species on to nylon membranes or PVC chips, and further added an amplification control and hybridization control (Fig. 1A). The amplification control was developed from PC1 control DNA, which can be amplified with universal ITS 1/4 primers in the same manner as Phellinus target DNA (White et al., 1990). To eliminate the possibility of competitive hybridization for amplicons between Phellinus probes and the PC1 amplification control probe, the former were designed to target only sense amplicons, while the latter targets only antisense amplicons. An additional hybridization control (HC1) DNA amplicon was also added to the hybridization buffer. Together, these two controls can provide verification of the amplification and hybridization process within our developed assay.
Amplicons derived from template DNA and field samples were labelled with DIG‐dNTP, DIG‐tagged primers, biotin‐dNTP or biotin‐tagged primers. Combined with the use of nylon membrane or PVC chip arrays, this allows for eight different array combinations. Based on the data obtained in this study, the optimal array system utilizes biotin‐tagged primers for labelling, and PVC chips for the array platform. Excluding the time required for sequence amplification in samples, our array system can complete screening and detection in less than 2 h, and is capable of detecting P. weirii or P. noxius at 1 pg of starting DNA (Fig. 2). The other seven developed systems (Fig. 1B, Fig. S1) display comparable levels of robustness, and together, these results demonstrate the broad applicability of our designed Phellinus probes to different array systems.
In this study, we showed that our microarray systems were capable of detecting target Phellinus species at about 1 pg of starting DNA (Fig. 2). Considering that the genome of Phellinus species is around 40 MB in length, at an average molecular weight of 660 Da for each nucleotide base pair, only 20–30 spores or cells would be needed for detection. However, it is important to note that if non‐target DNA amplified with the same set of primers exceeds target DNA, the detection limit may be affected (Lievens and Thomma, 2005; Lievens et al., 2005). We also found that the choice of nylon membrane or PVC chip for the array platform did not noticeably affect detection sensitivity; however, the detection limit for biotin‐labelled amplicons was slightly lower than DIG‐labelled sequences, indicating greater sensitivity with biotin labelling. Since DIG labelling is generally considered to exhibit greater sensitivity than biotin labelling (Rihn et al., 1995a,b; Gauthier and Blais, 2003), we believe our findings may be the result of differences in streptavidin‐alkaline phosphatase concentrations, and/or the number of alkaline phosphatases conjugated to each streptavidin molecule.
Our array systems could potentially be used to provide early detection of infestations involving multiple Phellinus species, and while general inferences to the disease‐causing organism can be made from the location and species of infected trees (Hansen and Goheen, 2000; Ann et al., 2002), such an array could provide much more definitive identification of disease causative agents, thus facilitating the effective implementation of control or quarantine measures. Interestingly, traditional Asian medicine has long considered P. linteus to have important medicinal properties, and recent studies have also isolated potentially useful compounds with immuno‐stimulatory or anti‐cancer properties from this species (Nam et al., 2002; Dai et al., 2010; Wu et al., 2012). However, there are major difficulties in differentiating between P. linteus and other species, such as P. igniarius, P. laevigatus and P. baumii through phenotypic methods. Considering that Phellinus species do not have the same medicinal effects, and that traditional Asian medicine relies on the use of the entire fruiting body or basidiocarp, our microarray system could plausibly be used to provide identification of important medicinal Phellinus species, in addition to more conventional applications in disease detection and phytosanitary inspection.
In conclusion, here we describe a set of eight DNA microarray systems that utilize probes generated from ITS regions to simultaneously detect 17 key Phellinus species. These arrays were shown to be capable of sensitive, specific, rapid and reliable detection, and could thus provide a significant advantage over traditional morphological or biochemical methods.
Experimental procedures
Fungal strains and growth conditions
Cultures of Phellinus strains were obtained from the Bioresource Collection and Research Center (BCRC, Hsinchu, Taiwan), the Taiwan Forestry Research Institute (TFRI, Taipei, Taiwan) and the USDA Forest Product Laboratory (USDA FPL, Madison, WI, USA) (Table 1). All strains were grown on potato dextrose agar medium (PDA; BD Difco, Sparks, MD, USA) in the dark at 24°C for 7 days prior to DNA extraction.
Genomic DNA extraction
Genomic DNA was isolated from fresh fungal cultures, field samples or herbarium specimens, using a modified version of the CTAB method that was previously described (Doyle and Doyle, 1987). In brief, 0.1 g of mycelium or 0.3 g of field or herbarium specimens were placed in 1.5 ml centrifuge tubes containing 500 μl of preheated (65°C) CTAB isolation buffer (2% hexadecyltrimethylammonium bromide, 1.4 M NaCl, 20 mM EDTA, 100 mM Tris‐HCl, pH 8.0) and crushed with a grinder tube, after which 3 μl of 2‐mercaptoethanol was added. The mixture was vortexed for 30 s and then incubated at 65°C for 10 min. The supernatant was extracted with phenol‐chloroform‐isoamyl alcohol (25:24:1, v/v) and centrifuged at 10 000 × g for 2 min, after which 0.6 volumes of isopropanol was used to precipitate nucleic acids. The precipitated DNA was washed with 500 μl of wash buffer (76% ethanol, 10 mM ammonium acetate) and re‐suspended in 20 μl of distilled deionized water containing 0.1 μl of RNase A (1 mg/ml concentration; Sigma, St. Louis, MO, USA). Concentration of DNA was determined through spectrophotometry (Nanodrop ND‐1000, NanoDrop Technologies, Rockland, DE, USA).
DNA amplification and labelling
Universal fungal primers ITS1/4 (White et al., 1990) were used to amplify the ITS1–5.8S–ITS2 region in target Phellinus species. Amplification was carried out in a 50 μl reaction volume, containing 50 μM of each primer, 10 mM dNTP (GeneTeks BioScience, Taipei, Taiwan), 1 U Prime Taq DNA polymerase (GeNet Bio, Chungnam, South Korea) and 5 μl (∼ 1 ng) of template DNA, using the GeneAmp PCR 2400 System (PerkinElmer, Waltham, MA, USA). Polymerase chain reaction conditions were as follows: 94°C for 4 min and 35 cycles at 95°C for 30 s, 50°C for 30 s and 72°C for 1 min, with a final extension at 72°C for 7 min. Products of PCR were subjected to electrophoresis in 1.0 % (wt/vol) agarose gel and visualized by UV illumination after ethidium bromide staining.
For array analysis, ITS1/4 primers were also used to amplify ITS regions, and the amplicons were simultaneously labelled with either biotin or DIG. Biotin labelling was conducted using either 5'‐biotin‐tagged ITS 1/4 primer sets or biotin‐16‐dUTP mix (Roche Applied Science, Mannheim, Germany), which were added to the amplification reaction. Digoxigenin labelling was performed with either 5'‐DIG‐tagged ITS 1/4 primers or DIG‐11‐dUTP (PCR DIG Labeling Mixplus, Roche Applied Science). Polymerase chain reaction conditions for labelling were the same as described above, and the labelled amplicons were used as targets in subsequent microarray hybridization reactions.
Oligonucleotide probe design
Species‐specific probes were designed by aligning the ITS sequences of Phellinus species, using the AlignX function in Vector NTI (Invitrogen, Carlsbad, CA, USA), to identify polymorphic regions specific to each species. Probes were designed according to the following criteria: (i) probe length of 25–55 bp; (ii) GC% of ∼ 40%; (iii) and Tm of 55–65°C. The Gibbs free energy (ΔG) of probes was calculated, and the presence of dimers and hairpin loops was assessed in order to minimize the formation of secondary structures. Seven additional thymine bases were added to the 3'‐end of each probe to increase sensitivity (Brown and Anthony, 2000). Conserved regions of the 5.8S rRNA gene and ketosynthase domain were respectively used as positive PCR/hybridization or hybridization‐only controls.
Oligonucleotide array preparation
Species‐specific probes were synthesized by MDBio (Taipei, Taiwan), and diluted to a final concentration of 20 μM and 10 μM for spotting on positively charged PVC (polyvinylchloride) chips (Dr Chip Biotechnology, Miaoli, Taiwan) or positively charged nylon membranes (Bio‐Rad Laboratories, Hercules, CA, USA) respectively. Oligonucleotide probes were spotted onto PVC chips using automatic spotter, and fixed with UV Crosslinker (Spectrolinker XL‐1000, Spectronics, Westbury, NY, USA). Alternatively, probes were spotted onto nylon membranes using EZspot arrayer (EZlife Technology, Taipei, Taiwan), air‐dried and exposed to UV for probe immobilization.
Reverse dot‐blot hybridization
Hybridization of amplicons to probes on microarrays was performed according to a previously described protocol (Hsiao et al., 2005), with modifications. Briefly, 4 μl of labelled amplicons were added to 220 μl of hybridization solution [5 × SSC (v/v), 2% blocking reagent (w/v; Roche Applied Science), 0.1% N‐lauroylsarcosine (w/v) and 0.02% SDS (w/v)], denatured with boiling water for 7 min, and immediately chilled on ice for 10 min. Hybridization was conducted at 58°C for 40 min, and arrays were then washed twice at 56°C for 5 min each with 0.25 × SSC to remove non‐hybridized PCR products, and incubated for 30 min with 200 μl of blocking solution [1% (wt/vol) blocking reagent dissolved in maleic acid buffer (0.1 M maleic acid, 0.15 M NaCl, pH 7.5)] containing either anti‐DIG‐AP (1:5,000 dilution; Roche Applied Science) or streptavidin‐AP (1:1,000 dilution; Roche Applied Science). Signals were colour developed with 500 μl nitroblue tetrazolium (NBT)/5‐bromo‐6‐chloro‐3‐indolyl phosphate, p‐toluidine salt (BCIP) solution (Roche Applied Science) at room temperature without shaking. PVC chip signals were captured and analysed with Dr AiM reader (Dr Chip Biotechnology), while nylon membrane signals were captured with a BioSpectrum Imaging System (UVP, Upland, CA, USA) and analysed with VisionWorks LS Analysis Software v6.5.2 (UVP).
Sensitivity analysis
To assess array sensitivity, P. weirii and P. noxius template genomic DNA was quantified using a NanoDrop ND‐1000 Spectrophotometer (NanoDrop Technologies), diluted to starting DNA concentrations of 1 ng, 100 pg, 10 pg, 1 pg, 100 fg and 10 fg, and subjected to PCR amplification with biotin‐labelled or DIG‐labelled ITS1/4 primers. The PCR products were then subjected to electrophoresis on a 1.0% (w/v) agarose gel, as well as hybridization with PVC chip or nylon membrane microarrays, according to the procedures described above.
Detection and identification of phellinus species in complex samples and field samples
To ascertain if our array systems were capable of simultaneously identifying multiple Phellinus species in a single assay, complex samples containing template genomic DNA from 2 (P. melleoporus and P. noxius), 3 (P. melleoporus, P. noxius and P. pini) or 4 (P. melleoporus, P. noxius, P. pini and P. weirii) Phellinus species were prepared, labelled with biotin‐tagged primers during amplification and hybridized to a PVC chip array. In addition, field samples collected from roots, stems, soil and herbariums throughout Taiwan were similarly prepared and hybridized to PVC chip arrays. The field samples were also subjected to conventional detection involving cultivation on PDA or semi‐selective media (Chang, 1995) followed by microscopic examination; and the results were compared with those derived from microarray analysis.
Conflict of interest
The authors of this article declare no conflicts of interest.
Supporting information
Fig. S1. Reverse hybridization of differentially labelled amplicons to Phellinus probes spotted on nylon membrane or PVC chip arrays. Probes were arranged on arrays as indicated in Fig. 1A.
A. Digoxigenin‐deoxynucleoside triphosphate‐labelled amplicons hybridized to probes on nylon membrane.
B. Digoxigenin primer‐labelled amplicons hybridized to probes on nylon membrane.
C. Biotin‐dNTP‐labelled amplicons hybridized to probes on nylon membrane.
D. Digoxigenin‐deoxynucleoside triphosphate‐labelled amplicons hybridized to probes on PVC chip.
E. Biotin‐dNTP‐labelled amplicons hybridized to probes on PVC chip.
F. Biotin‐primer‐labelled amplicons hybridized to probes on PVC chip. For results of biotin‐primer‐labelled amplicons hybridized to probes on nylon membrane, and DIG‐primer‐labelled amplicons hybridized to probes on PVC chip, please see Fig. 1B and C respectively.
Fig. S2. Microarray analysis results of field samples collected from trees in Taiwan with suspected or confirmed Phellinus infestations. Probes were arranged on arrays as indicated in Fig. 1A. Microarray analysis results for (A) D. longan; (B) C. camphora; (C) G. robusta; (D) F. microcarpa; and (E) P. campanulata are depicted here.
Fig. S3. Microarray analysis results of five species of tree seedlings from a local plant nursery. Probes were arranged on arrays as indicated in Fig. 1A. (A) F. formosana; (B) C. camphora; (C) K. elegans; (D) M. champaca; and (E) A. confusa seedlings were found to be free of Phellinus infestation through microarray analysis.
Acknowledgements
The authors would like to thank the Forest Products Laboratory, USDA and the Taiwan Forestry Research Institute, Taiwan, for providing fungal strains used in this study.
Funding Information
Grants 97 Agriculture Sci.‐14.3‐1‐I‐B4 and 102‐Agriculture Sci.‐10.2.5‐I‐(2), provided by the Bureau of Animal and Plant Health Investigation and Quarantine, Council of Agriculture, Executive Yuan, Taiwan were used to fund parts of this study.
References
- Adair, S. , Kim, S.H. , and Breuil, C. (2002) A molecular approach for early monitoring of decay basidiomycetes in wood chips. FEMS Microbiol Lett 211: 117–122. [DOI] [PubMed] [Google Scholar]
- Ann, P.J. , Lee, H.L. , and Huang, T.C. (1999) Brown root rot of 10 species of fruit trees caused by Phellinus noxius in Taiwan. Plant Dis 83: 746–750. [DOI] [PubMed] [Google Scholar]
- Ann, P.J. , Chang, T.T. , and Ko, W.H. (2002) Phellinus noxius brown root rot of fruit and ornamental trees in Taiwan. Plant Dis 86: 820–826. [DOI] [PubMed] [Google Scholar]
- Anselmi, A. , and Bragaloni, G. (1992) A method to identify wood decay basidiomycetes by using enzymatic comparisons. Micol Ital 2: 15–20. [Google Scholar]
- Borneman, J. , and Hartin, R.J. (2000) PCR primers that amplify fungal rRNA genes from environmental samples. Appl Environ Microbiol 66: 4356–4360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brown, T.J. , and Anthony, R.M. (2000) The addition of low numbers of 3' thymine bases can be used to improve the hybridization signal of oligonucleotides for use within arrays on nylon supports. J Microbiol Methods 42: 203–207. [DOI] [PubMed] [Google Scholar]
- Burdon, J.J. , Thrall, P.H. , and Ericson, A.L. (2006) The current and future dynamics of disease in plant communities. Annu Rev Phytopathol 44: 19–39. [DOI] [PubMed] [Google Scholar]
- Castello, J.D. , Leopold, D.J. , and Smallidge, P.J. (1995) Pathogens, patterns, and process in forest ecosystems. Bioscience 1: 16–24. [Google Scholar]
- Chang, T.T. (1995) A selective medium for Phellinus noxius . Eur J Forest Pathol 25: 185–190. [Google Scholar]
- Chiarappa, L. (1997) Phellinus ignarius: the cause of spongy wood decay of black measles (esca) disease of grapevines. Phytopathol Mediterr 36: 109–111. [Google Scholar]
- Clausen, C.A. (2003) Detecting decay fungi with antibody‐based tests and immunoassays. In Wood Deterioration and Preservation: Advances In Our Changing World. Goodell B., Nicholas D.D., and Schultz T.P. (eds). Washington, DC: American Chemical Society, pp. 325–336. [Google Scholar]
- Dai, Y.C. , Zhou, L.W. , Cui, B.K. , Chen, Y.Q. , and Decock, C. (2010) Current advances in Phellinus sensu lato: medicinal species, functions, metabolites and mechanisms. Appl Microbiol Biotechnol 87: 1587–1593. [DOI] [PubMed] [Google Scholar]
- Doyle, J.J. , and Doyle, J.L. (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19: 11–15. [Google Scholar]
- Everett, K.R. , Rees‐George, J. , Pushparajah, I.P.S. , Janssen, B.J. , and Luo, Z. (2010) Advantages and disadvantages of microarrays to study microbial population dynamics – a minireview. N Z Plant Prot 63: 1–6. [Google Scholar]
- Frey, J.E. , Pasquer, F. , Pelludat, C. , and Duffy, B. (2010) A high‐density random‐ oligonucleotide genome microarray for universal diagnostics. EPPO Bull 40: 40–45. [Google Scholar]
- Gatica, M. , Cesari, C. , and Escoriaza, G. (2004) Phellinus species inducing hoja de malvón symptoms on leaves and wood decay in mature field‐grown grapevines. Phytopathol Mediterr 43: 59–65. [Google Scholar]
- Gauthier, M. , and Blais, B.W. (2003) Comparison of different approaches for the incorporation of non‐radioactive labels into polymerase chain reaction products. Biotechnol Lett 25: 1369–1374. [DOI] [PubMed] [Google Scholar]
- Gonthier, P. , Guglielmo, F. , Sillo, F. , Giordano, L. , and Garbelotto, M. (2015) A molecular diagnostic assay for the detection and identification of wood decay fungi of conifers. Forest Pathol 45: 89–101. [Google Scholar]
- Guglielmo, F. , Bergemann, S.E. , Gonthier, P. , Nicolotti, G. , and Garbelotto, M. (2007) A multiplex PCR‐based method for the detection and early identification of wood rotting fungi in standing trees. J Appl Microbiol 103: 1490–1507. [DOI] [PubMed] [Google Scholar]
- Guglielmo, F. , Gonthier, P. , Garbelotto, M. , and Nicolotti, G. (2008) A PCR‐based method for the identification of important wood rotting fungal taxa within Ganoderma, Inonotus s.l. and Phellinus s.l. FEMS Microbiol Lett 282: 228–237. [DOI] [PubMed] [Google Scholar]
- Hansen, E.M. , and Goheen, E.M. (2000) Phellinus weirii and other native root pathogens as determinants of forest structure and process in western North America. Annu Rev Phytopathol 38: 515–539. [DOI] [PubMed] [Google Scholar]
- Holah, J.C. , Wilson, M.V. , and Hansen, E.M. (1993) Effects of a native forest pathogen, Phellinus weirii, on Douglas‐fir forest composition in western Oregon. Can J for Res 23: 2473–2480. [Google Scholar]
- Hsiao, C.R. , Huang, L. , Bouchara, J.P. , Barton, R. , Li, H.C. , and Chang, T.C. (2005) Identification of medically important molds by an oligonucleotide array. J Clin Microbiol 43: 3760–3768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jellison, J. , and Jasalavich, C. (2000) A review of selected methods for the detection of degradative fungi. Int Biodeterior Biodegradation 46: 241–244. [Google Scholar]
- Kirk, P.M. (2014) Species Fungorum In Species 2000 and ITIS Catalogue of Life. ●● ●●. (ed.). ●●: ●●; [WWW document]. URL www.catalogueoflife.org/col/browse/tree/id/20912918. [Google Scholar]
- Lafontaine, D.L. , and Tollervey, D. (2001) The function and synthesis of ribosomes. Nat Rev Mol Cell Biol 2: 514–520. [DOI] [PubMed] [Google Scholar]
- Lévesque, C.A. (2001) Molecular methods for detection of plant pathogens – What is the future? Can J Plant Pathol 24: 333–336. [Google Scholar]
- Lévesque, C.A. , Harlton, C.E. , and de Cock, A.W. (1998) Identification of some oomycetes by reverse dot blot hybridization. Phytopathology 88: 213–222. [DOI] [PubMed] [Google Scholar]
- Leaw, S.N. , Chang, H.C. , Barton, R. , Bouchara, J.P. , and Chang, T.C. (2007) Identification of medically important Candida and non‐Candida yeast species by an oligonucleotide array. J Clin Microbiol 45: 2220–2229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Leckie, D.G. , Jay, C. , Gougeon, F.A. , Sturrock, R.N. , and Paradine, D. (2004) Detection and assessment of trees with Phellinus weirii (laminated root rot) using high resolution multi‐spectral imagery. Int J Remote Sens 25: 793–818. [Google Scholar]
- Letowski, J. , Brousseau, R. , and Masson, L. (2004) Designing better probes: effect of probe size, mismatch position and number on hybridization in DNA oligonucleotide microarrays. J Microbiol Methods 57: 269–278. [DOI] [PubMed] [Google Scholar]
- Lievens, B. , and Thomma, B.P. (2005) Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practice. Phytopathology 95: 1374–1380. [DOI] [PubMed] [Google Scholar]
- Lievens, B. , Brouwer, M. , Vanachter, A.C. , Lévesque, C.A. , Cammue, B.P. , and Thomma, B.P. (2005) Quantitative assessment of phytopathogenic fungi in various substrates using a DNA macroarray. Environ Microbiol 7: 1698–1710. [DOI] [PubMed] [Google Scholar]
- Lievens, B. , Claes, L. , Krause, M.S. , Vanachter, A.C. , Cammue, B.P. , and Thomma, B.P. (2007) Assessing populations of a disease suppressive microorganism and plant pathogen using DNA arrays. Plant Sci 172: 505–514. [Google Scholar]
- Luisi, N. , and Campanile, G. (2004) The occurrence of Phellinus torulosus in Apulia and Basilicata (Southern Italy): identification of isolates by morphologic, microscopic, and molecular means. Phytopathol Mediterr 43: 289–298. [Google Scholar]
- McCartney, H.A. , Foster, S.J. , Fraaije, B.A. , and Ward, E. (2003) Molecular diagnostics for fungal plant pathogens. Pest Manag Sci 59: 129–142. [DOI] [PubMed] [Google Scholar]
- Martin, R.R. , James, D. , and Levesque, C.A. (2000) Impacts of molecular diagnostic technologies on plant disease management. Annu Rev Phytopathol 38: 207–239. [DOI] [PubMed] [Google Scholar]
- Mireku, E. , and Simpson, J.A. (2002) Fungal and nematode threats to Australian forests and amenity trees from importation of wood and wood products. Can J Plant Pathol 24: 117–124. [Google Scholar]
- Mohd Farid, A. , Lee, S.S. , Mohd Rosli, H. , Maziah, Z. , and Norwati, M. (2005) Incidence of teak basal root rot caused by Phellinus noxius in Malaysia. Australas Plant Pathol 34: 277–278. [Google Scholar]
- Nam, B.H. , Kim, G.Y. , Park, H.S. , Lee, S.J. , and Lee, J.D. (2002) Molecular detection of Phellinus linteus and P. baumii by PCR specific primer. Mycobiology 30: 197–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nobles, M.K. (1965) Identification of cultures of wood‐inhabiting Hymenomycetes . Can J Bot 43: 1097–1139. [Google Scholar]
- Olive, D.M. , and Bean, P. (1999) Principles and applications of methods for DNA‐based typing of microbial organisms. J Clin Microbiol 37: 1661–1669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peplies, J. , Glockner, F.O. , and Amann, R. (2003) Optimization strategies for DNA microarray‐based detection of bacteria with 16S rRNA‐targeting oligonucleotide probes. Appl Environ Microbiol 69: 1397–1407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rhee, S.K. , Liu, X. , Wu, L. , Chong, S.C. , Wan, X. , and Zhou, J. (2004) Detection of genes involved in biodegradation and biotransformation in microbial communities by using 50‐mer oligonucleotide microarrays. Appl Environ Microbiol 70: 4303–4317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rihn, B. , Coulais, C. , Bottin, M.C. , and Martinet, N. (1995a) Evaluation of non‐radioactive labeling and detection of deoxyribonucleic acids. Part One: chemiluminescent methods. J Biochem Biophys Methods 30: 91–102. [DOI] [PubMed] [Google Scholar]
- Rihn, B. , Bottin, M.C. , Coulais, C. , and Martinet, N. (1995b) Evaluation of non‐radioactive labeling and detection of deoxyribonucleic acids. Part Two: colorigenic methods and comparison with chemiluminescent methods. J Biochem Biophys Methods 30: 103–112. [DOI] [PubMed] [Google Scholar]
- Sahashi, N. , Akiba, M. , Takemoto, S. , Yokoi, T. , Ota, Y. , and Kanzaki, N. (2014) Phellinus noxius causes brown root rot on four important conifer species in Japan. Eur J Plant Pathol 140: 869–873. [Google Scholar]
- Saiki, R.K. , Walsh, P.S. , Levenson, C.H. , and Erlich, H.A. (1989) Genetic analysis of amplified DNA with immobilized sequence‐specific oligonucleotide probes. Proc Natl Acad Sci USA 86: 6230–6234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schoch, C.L. , Seifert, K.A. , Huhndorf, S. , Robert, V. , Spouge, J.L. , Levesque, C.A. , et al (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA 109: 6241–6246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thorn, R.G. , Reddy, C.A. , Harris, D. , and Paul, E.A. (1996) Isolation of saprophytic basidiomycetes from soil. Appl Environ Microbiol 62: 4288–4292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tiquia, S.M. , Wu, L. , Chong, S.C. , Passovets, S. , Xu, D. , Xu, Y. , and Zhou, J. (2004) Evaluation of 50‐mer oligonucleotide arrays for detecting microbial populations in environmental samples. Biotechniques 36: 664–675. [DOI] [PubMed] [Google Scholar]
- Tsui, C.K.M. , Woodhall, J. , Chen, W. , Levesque, C.A. , Lau, A. , Schoen, C.D. , et al (2011) Molecular techniques for pathogen identification and fungus detection in the environment. IMA Fungus 2: 177–189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Turenne, C.Y. , Sanche, S.E. , Hoban, D.J. , Karlowsky, J.A. , and Kabani, A.M. (1999) Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J Clin Microbiol 37: 1846–1851. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Van der Kamp, B.J. (1991) Pathogens as agents of diversity in forested landscapes. For Chron 67: 353–354. [Google Scholar]
- Wagner, T. , and Fischer, M. (2001) Natural groups and a revised system for the European poroid Hymenochaetales (Basidiomycota) supported by nLSU rDNA sequence data. Mycol Res 105: 773–782. [Google Scholar]
- Wagner, T. , and Fischer, M. (2002a) Proceedings towards a natural classification of the worldwide taxa Phellinus s.l. and Inonotus s.l., and phylogenetic relationships of allied genera. Mycologia 94: 998–1016. [PubMed] [Google Scholar]
- Wagner, T. , and Fischer, M. (2002b) Classification and phylogenetic relationships of Hymenochaete and allied genera of the Hymenochaetales, inferred from rDNA sequence data and nuclear behaviour of vegetative mycelium. Mycol Prog 1: 93–104. [Google Scholar]
- White,T.J. , Bruns, T ,. Lee, S. , Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics In PCR Protocols: A Guide to Methods and Applications. Innis M.A., Gelfand D.H., Sninsky J.J., White T.J. (eds). New York, USA: Academic Press, pp. 315–322. [Google Scholar]
- Wu, S.H. , Dai, Y.C. , Hattori, T. , Yu, T.W. , Wang, D.M. , Parmasto, E. , et al (2012) ●●. Bot Stud 53: 135–149. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1. Reverse hybridization of differentially labelled amplicons to Phellinus probes spotted on nylon membrane or PVC chip arrays. Probes were arranged on arrays as indicated in Fig. 1A.
A. Digoxigenin‐deoxynucleoside triphosphate‐labelled amplicons hybridized to probes on nylon membrane.
B. Digoxigenin primer‐labelled amplicons hybridized to probes on nylon membrane.
C. Biotin‐dNTP‐labelled amplicons hybridized to probes on nylon membrane.
D. Digoxigenin‐deoxynucleoside triphosphate‐labelled amplicons hybridized to probes on PVC chip.
E. Biotin‐dNTP‐labelled amplicons hybridized to probes on PVC chip.
F. Biotin‐primer‐labelled amplicons hybridized to probes on PVC chip. For results of biotin‐primer‐labelled amplicons hybridized to probes on nylon membrane, and DIG‐primer‐labelled amplicons hybridized to probes on PVC chip, please see Fig. 1B and C respectively.
Fig. S2. Microarray analysis results of field samples collected from trees in Taiwan with suspected or confirmed Phellinus infestations. Probes were arranged on arrays as indicated in Fig. 1A. Microarray analysis results for (A) D. longan; (B) C. camphora; (C) G. robusta; (D) F. microcarpa; and (E) P. campanulata are depicted here.
Fig. S3. Microarray analysis results of five species of tree seedlings from a local plant nursery. Probes were arranged on arrays as indicated in Fig. 1A. (A) F. formosana; (B) C. camphora; (C) K. elegans; (D) M. champaca; and (E) A. confusa seedlings were found to be free of Phellinus infestation through microarray analysis.
