Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Feb 26.
Published in final edited form as: Curr Mol Med. 2014;14(6):703–711. doi: 10.2174/1566524014666140724095112

Hepatocyte FRS2α is Essential for the Endocrine Fibroblast Growth Factor to Limit the Amplitude of Bile Acid Production Induced by Prandial Activity

Cong Wang a,b,#,#, Chaofeng Yang b,1,#, Julia YF Chang b,2, Pan You c, Yue Li d, Chengliu Jin b,3, Yongde Luo b, Xiaokun Li a, Wallace L McKeehan b, Fen Wang b,#
PMCID: PMC4768716  NIHMSID: NIHMS707506  PMID: 25056539

Abstract

In addition to being positively regulated by prandial activity, bile acid production is also negatively controlled by the endocrine fibroblast growth factor 19 (FGF19) or the mouse ortholog FGF15 from the ileum that represses hepatic cholesterol 7 α-hydroxylase (Cyp7a1) expression through activating FGF receptor four (FGFR4). However, how these two regulatory mechanisms interplay to control bile acid homeostasis in the body and the downstream pathways by which FGFR4 regulates Cyp7a1 expression are not fully understood. Here we report that hepatocyte FGFR substrate 2α (FRS2α), a scaffold protein essential for canonical FGFRs to activate the ERK and AKT pathways, was required for the regulation of bile acid production by the FGF15/19-FGFR4 signaling axis. This occurred through limiting the extent of increases in Cyp7a1 expression induced by prandial activity. Excess FGFR4 kinase activity reduced the amplitude of the increase whereas a lack of FGFR4 augmented the increase of Cyp7a1 expression in the liver. Ablation of Frs2α alleles in hepatocytes abrogated the regulation of Cyp7a1 expression by FGFR4. Together, the results demonstrate that FRS2α-mediated pathways are essential for the FGF15/FGF19-FGFR4 signaling axis to control bile acid homeostasis.

Keywords: bile acid, FRS2α, FGF15/FGF19, FGFR4, CYP7A1

Introduction

Bile acids are hydrophilic derivatives of cholesterol, which are a major ingredient in bile and function as emulsifiers to help absorption of lipids and lipid-soluble vitamins. The deficiency of bile acids leads to malnutrition. In addition, since bile acids are the exit strategy for extra cholesterol in the body, excretion of bile acids into feces helps preventing high cholesterol levels in the body, which is associated with elevation of cardiovascular diseases. Recently, bile acids have been increasingly appreciated as hormonal molecules that regulate energy metabolism together with their nuclear receptor FXR [1] and cell membrane receptor TGR5 [2].

Excessive bile acids in hepatocytes are toxic to the cells and can lead to liver damage. Therefore, the bile acid levels need to be tightly regulated by multiple mechanisms [3]. The enterohepatic circulation of bile acids after a meal occurs with secretion of bile acids into the intestine and reabsorption of up to 95% of them back into the circulation. About 5% of bile acids are excreted constantly into feces. Bile acids are synthesized from cholesterol in the liver through two pathways. The major bile acid synthesis pathway is catalyzed by CYP7A1, a key cytochrome P450 enzyme in converting cholesterol into bile acids. The alternative pathway is controlled by sterol 27-hydroxylase (CYP27A1), which is account for approximate 30% of bile acid pool size. The enzyme activity of CYP7A1 is regulated mainly at the transcription level, which is induced by cholesterol and inhibited by bile acid feedback controls [4]. Several mechanisms responsible for the negative feedback controls have been uncovered [5-7]. Among them, the fibroblast growth factor (FGF) pathway has been recognized as a key mechanism to negatively regulate the enterohepatic circulation [8]. Bile acids bind and activate intestinal FXRs, resulting in increased FGF15 (human ortholog FGF19) expression in the ileum [9]. FGF15/19 then activates the hepatocyte FGF receptor 4 (FGFR4)-betaKlotho (KLB) signaling complex to repress Cyp7a1 expression, resulting in reduced conversion of cholesterol to bile acids in the liver [10, 11]. However, the molecular mechanism downstream of the FGF15/19-FGFR4 complex signals inhibition of Cyp7a1 in hepatocytes is not fully understood.

The FGF family comprises of 18 receptor binding members and four transmembrane tyrosine kinase receptors [12]. Among the FGF ligands, FGF19, FGF21, and FGF23 belong to the endocrine FGF (eFGF) subfamily [13], which are different from the rest of other canonical FGFs in two key aspects. First, the eFGF functions as a circulating hormone that activates targets distal from its origin and is involved in metabolic regulation. This is in contrast to classic FGFs that function as autocrine or paracrine factors that target the cells producing them or the cells near the site of their origins. Second, many classic FGFs have a high affinity for heparan sulfate and require it as a cofactor to bind and activate their receptors. The eFGFs, however, have weak affinities for heparan sulfates, but require Klothos as a coreceptor [12]. Klothos are not only required for eFGFs binding to FGFRs with high affinity, but also function as a determinant of ligand and signaling specificities of FGFRs [14-20]. The ERK, AKT, PLCγ, and several other signaling cascades have been implicated to relay FGF signals intracellularly downstream of the membrane. FGF receptor substrate 2α (FRS2α) functions as a scaffold protein recruiting two downstream signaling molecules, GRB2 and SHP2, to the FGFR kinases, which are required for canonical FGFRs to activate the ERK and AKT pathways, respectively [12, 21]. The activation of PLCγ and several other pathways, however, are not FRS2α dependent. Furthermore, FRS2α has been implicated in other growth factor signaling pathways. Germ line disruption of Frs2α causes early embryonic lethality [22]. Depleting FRS2α in many organ sites does not always phenocopy the loss of FGFs or FGFRs, although sometimes results in similar defects [23-25]. This is in line with the findings that FGFR elicits signals both via FRS2α-dependent and FRS2α-independent pathways.

Here we reported that hepatocyte-specific depletion of Frs2α abrogated the activity of the FGF15-FGFR4 signaling axis on limiting the amplitude of bile acid production increases induced by prandial activities. The finding that ablation of Frs2α phenocopied Fgfr4 deficiency with respect to bile acid regulation indicated that FGF15/FGF19-FGFR4 signaling elicits such regulatory activities through FRS2α-mediated pathways. The results that the FRS2α-mediated FGFR4 signals restrict the amplitude of bile acid production induced by prandial activity unravel a mechanism by which the food intake induced bile acid production is restrained by eFGFs.

Materials and Methods

Animals and Diets

All animals were housed in the Program of Animal Resources at the Institute of Biosciences and Technology, Texas A&M Health Science Center, and were handled in accordance with the principles and procedures of the Guide for the Care and Use of Laboratory Animals. All experimental procedures were approved by the Institutional Animal Care and Use Committee. C57BL/6 mice carrying the Fgfr4 null [26], Alb-caFgfr4 transgenic [27], Frs2α floxed [28], AlbCre transgenic allele [29] were maintained and genotyped as previously described. Only 8 to 12 week-old adult male mice were used in this study. Mice were maintained in 12-hour light/12-hour dark cycles and were given free access to food and water. Standard rodent chow and the standard chow supplemented with 1% (w/w) cholic acid were purchased from Alief Purina Feed Store, Inc. (Alief, TX). FGF19 in PBS was administrated by intraperitoneal (I.P.) injection at a dosage of 1 mg/kg in the morning, four hours after fasting. PBS was used for vehicle control. The liver was harvested at the indicated times after the injection for Western blot analyses or gene expression analyses.

Histological Procedures

Liver tissues were fixed overnight in Histochoice Tissue Fixative MB (no. H120–4L, Amresco), dehydrated through a series of ethanol treatments, and embedded in paraffin according to standard procedure. Sections of 5 μm thickness were prepared and stained with hematoxylin and eosin [10].

Bile Acid Analysis

Bile acids were measured using the Bile Acids kit (no. 450-A, Sigma) as described [10]. To determine fecal bile acid excretion, the feces from individually housed mice were collected, weighed, and dried over a 72-hour period. Then 0.5 g of dried feces was minced and extracted in 10 ml of 75% ethanol at 50 °C for 2 hours. The extract was centrifuged, and 1 ml samples of supernatant were diluted to 4 ml with a 25% PBS solution for assay according to manufacturer’s suggestions. The total bile acid pool size was determined as bile acid contents in the small intestine, gallbladder, liver, and feces. Fresh organs were collected, minced, and extracted with 15 ml of 75% ethanol at 50 °C for 2 hours as aforementioned.

Analysis of mRNA

Total RNA was extracted with the Ribopure RNA isolation reagent (Ambion, TX) as described [30]. Reverse transcription was carried out with SuperScript III (Life Technologies, Grand Island, NY) and random primers. Real-time PCR was performed on Mx3000 (Strategene), using the SYBR Green JumpStart Taq ReadyMix (Sigma, St. Louis, MO) with pairs of primers specific for each transcript according to manufacturer’s protocols. The primer sequences are: Cyp7a1-F: GCATCTCAAGCAAACACCATTCC, Cyp7a1-R: AGTCAAAGGGTCTGGGTAGATTTC; Klb-F: GGGATCATGGCGCCCGTCTT, Klb-R: TGGCATGGGTTTGGCACAGGT; Fgfr4-F: GCTGCTGGCCGGGGTGTATC, Fgfr4-R: CCGAGCACCAACCTGTCCCG; Bsep-F: GCCCTCATACGGAAACCCAA, Bsep-R: TCATGGGTGCCTCTTTCCAC; Cyp8b1-F: GGTACGCTTCCTCTATCGCC, Cyp8b1-R: GAGGGATGGCGTCTTATGGG; Ibabp-F: CAGGAGACGTGATTGAAAGGG, Ibabp-R: GCCCCCAGAGTAAGACTGGG; Asbt-F: TGGGCTTCCTCTGTCAGTTTGGAA, Asbt-R: AGT GTGGAGCAAGTGGTCATGCTA; Ostα-F: AGCAATTTCCTTGCTGTGTCCACC, Ostα-R: AGGATGACAAGCACCTGGAACAGA; Ostβ-F: TCCGTTCAGAGGATGCAACTCC TT, Ostβ-R: CATTCCGTTGTCTTGTGGCTGCTT; Fgf15-F: ACAATTGCCATCAAGGACGTCAGC, Fgf15-R: TGAAGATGATGTGGAGGTGGTGCT. The ratio between expression levels in the two samples was calculated by relative quantification, using β-actin as a reference transcript for normalization.

In Situ hybridization

Paraffin-embedded tissue sections were rehydrated followed by digestion with 20 μg/ml protease K for 7 minutes at room temperature. After prehybridization at 65°C for 2 hours, the hybridization was carried out by overnight incubation at 65°C with 0.5 μg/ml digoxigenin labeled RNA probes for the indicated genes. Non-specifically bound probes were removed by washing four times with 0.1 × DIG washing buffer at 60°C for 30 minutes. Specifically bound probes were later detected using alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche, Indianapolis, IN). The in situ probe for FRS2α mRNA and its sense probe were generated as described [24].

Western Blotting Analysis

Liver tissues were homogenized in the cell lysis buffer (0.5% Triton-X-100-PBS). The lysates were harvested by centrifugation, separated SDS-PAGE, electric blotted on PVDF membrane. Mouse anti-ERK (1:3,000), anti-β-actin (1:3,000) and Rabbit anti-pJNK were purchased from Santa Cruz (Santa Cruz, CA). Rabbit anti-pERK (1:2,000), Rabbit anti-pFRS2 (1:1,000), anti-AKT (1:1,000), anti-pAKT (1:1,000), and anti-pSTAT3 were from Cell Signaling (Beverly, MA). Mouse anti-CYP7A1 (1:1,000) was from Millipore (Billerica, MA). The specific bands recognized by the aforementioned antibodies were visualized with ECL Substrate Kit (BIO-RAD) as previously described [31]. The intensity of the bands was quantitated using the NIH Image J software (http://rsb.info.inh.gov/ij).

Statistical Analyses

Values are expressed as the mean ± standard deviation (S.D.) with the number of replicates described in the legends to figures. The statistical significance of differences between mean values (p< 0.05) was evaluated using the two-tailed Student’s t test.

Results

Ablation of Frs2α in hepatocytes does not affect liver histology and body weight

Emerging evidence demonstrates that FGF signaling plays important roles in liver homeostasis and function. Although being an essential adaptor protein for FGF signaling to activate the ERK and PI3K/AKT pathways, the function of FRS2α in the liver has not been fully characterized. To determine whether Frs2α was expressed in hepatocytes, in situ hybridization was carried out to assess Frs2α expression in the liver. The results showed that Frs2α was strongly expressed in the liver, evidenced by universal but specific purple staining in the cytosol of hepatocytes (Fig. 1A). The sense probe failed to generate any detectable signal demonstrating the hybridization was sequence-specific. To investigate the role of FRS2α in the liver, Frs2α alleles were tissue-specifically ablated in hepatocytes by crossing mice bearing Frs2α floxed (Frs2αFlox) alleles and mice bearing the AlbCre transgenic allele [29], in which the albumin promoter driven Cre recombinase was highly expressed in hepatocytes. Both Frs2αFlox and AlbCre mice were back crossed to C57/BL6 for more than 5 generations. The mice harboring homozygous Frs2αFlox alleles and one AlbCre were designed as Frs2αCN. In situ hybridization showed that expression of Frs2α was diminished in the Frs2αCN liver (Fig. 1A).

Fig.1. Ablation of Frs2α in hepatocytes does not cause apparent liver defects.

Fig.1

Open in a new tab

(A) In situ hybridization showing Frs2α expression (purple staining) in the liver of Frs2αFlox but not in Frs2αCN liver. Sense probe was used as a negative control. (B) Average body weight and the liver/body weight ratios of Frs2αFlox and Frs2αCN mice at the age of 2 months. (C) Gross morphology of Frs2αFlox and Frs2αCN liver of 2-month-old mice. (D) H&E staining showing no obvious histological difference between Frs2αFlox and Frs2αCN livers. (E) Ki67 staining showing no proliferative differences between two groups. Flox, Frs2αFlox; CN, Frs2αCN; Solid bars represent 50 μm.

The body weight and liver/body weight ratios of mutant mice were compatible to those of Frs2αFlox mice at young adulthood (Fig. 1B). Although FGF signaling has been shown to be required for liver organogenesis [32], Frs2αCN mice did not exhibit apparent defects in gross organ morphology (Fig. 1C), and tissue histology of the liver (Fig. 1D), as well as did not have abnormal proliferation (Fig. 1E) or apoptotic activities (data not shown). Furthermore, the mutant mice at the age of up to 12 months also appeared to be normal (data not shown), which were consistent with the mice with ablation of Fgfr4, the major FGFR isoform in the liver. No unexpected death related to liver failure was observed in Frs2αCN mice. The results indicate that ablation of Frs2α in hepatocytes with the AlbCre driver did not result in vital function defects in the liver.

FRS2α deficiency causes elevation of bile acid productions in the liver

Our previous study shows that FGFR4 regulates bile acid production in the liver and that activation of FGFR4 induces FRS2α phosphorylation [10, 33]. To test whether the FRS2α-mediated pathways were required for regulation of bile acids, both fecal pools of single-housed Frs2αFlox and Frs2αCN mice were measured. The results showed that the daily fecal bile acid excretion of Frs2αCN mice was two folds of the control value (Fig. 2A). To determine whether the increase in bile acids excretion was due to overproduction in the liver or due to decreased re-absorption in the intestine, the bile acid pool including bile acids from the liver, gallbladder, intestine, and feces was assessed, which represented the total amount of bile acid circulation of the animal. The results showed that the bile acid pool of Frs2αCN mice was 2.4 folds higher compared to that of Frs2αFlox mice (Fig. 2B). This data suggests that Frs2αCN mice had an increase in bile acid production. CYP7A1 is the rate limiting enzyme for the classic pathway of bile acid production, which catalyzes the cholesterol oxidation in the liver. The expression of this key enzyme in the liver was measured to further determine the production of bile acids was increased. Since expression of Cyp7a1 varies between day and night due to feeding patterns, unless otherwise specified, the samples for Cyp7a1 and other gene expressions were collected only in mid mornings. The results showed that Cyp7a1 expression in the Frs2αCN liver was upregulated to 3.5 folds of that in the Frs2αFlox liver (Fig. 2C). In contrast, CYP8B1, a key enzyme for the chenodeoxycholic acid production, was not changed significantly in the Frs2αCN liver. In addition, expression of Fgfr4 which is the major FGFR isoform in hepatocytes and KLB which is the co-receptor for FGF15/FGF19 in hepatocytes was not changed. Furthermore, the bile salt export pump (BSEP/ABCB11), a transporter for bile acid secretion, in the Frs2αCN liver remained at a similar level as in the Frs2αFlox liver (Fig. 2C). Similarly, the key transporters mediating absorption of bile acids in the intestine were not changed (Fig. 2D). Immunostaining further demonstrated that CYP7A1 abundance in Frs2αCN liver was higher than that in control mice (Fig. 2E). Although most experiments were carried out with 12 to 16-week-old mice, we also assessed bile acid production and Cyp7a1 expression in 10 to 12-month-old mice and found no difference between the two groups. Together, the data here indicate that the deficiency of FRS2α in liver increases bile acid production by upregulating Cyp7a1 expression. Consistent with increasing bile acid production, expression of Fgf15 was upregulated two fold in the ileum of Frs2αCN mice (Fig. 2E). Since ileum FGF15/FGF19 downregulates bile acid production in the liver, the results suggest a failure of feedback control of enterohepatic bile acid circulation in Frs2αCN mice.

Fig.2. Ablation of Frs2α in hepatocytes increases bile acid production.

Fig.2

Open in a new tab

(A) Fecal bile acid secretion. Fecal pellets were collected daily from single housed 12-week-old Frs2αFlox and Frs2αCN mice for bile acid extraction. Data are mean±sd from 6 mice. (B) Total bile acid pool was measured from liver, gallbladder, intestine and their contents. (C&D) Real-time RT-PCR analyses showing key genes in the bile acid homeostasis in the liver (C) or ileum (D). (E) Immunostaining of CYP7A1 in 3-month-old mouse livers. Data are mean±sd from 5 mice. *, p<0.05; BA, bile acid; Flox, Frs2αFlox; CN, Frs2αCN.

Ablation of Frs2α in hepatocytes abrogates the feedback control of bile acid production mediated by the ileum-liver FGF15-FGFR4 signaling axis

FGFR4 is the cognate receptor for FGF15/FGF19 in hepatocytes, which plays a key role in negative feedback control of Cyp7a1 gene expression [10]. It has been shown that FRS2α can be phosphorylated by FGFR4 kinases, and is essential for FGFR kinases to activate the ERK and PI3K/AKT pathways [14, 18, 19]. Since Frs2αCN and Fgfr4 null mice showed a similar phenotype with respect to increased bile acids, we then tested whether FRS2α mediated FGFR4 signals to repress Cyp7a1 expression. Both Frs2αFlox and Frs2αCN mice at the age of 8-10 weeks were fed with normal chow food or the diet with 1% cholic acids (CA) for 1 week. As expected, feeding with CA diets repressed Cyp7a1 expression in Frs2αFlox mice to a level of 5% of those fed with normal chow (Fig. 3A). In contrast, the reduction in Frs2αCN mice was modest comparing with that in Frs2αFlox mice. Expression of Cyp7a1 expression in CA diet fed Frs2αCN mice remained at 38% of those fed with regular chow, which was still about 2 folds higher than that in Frs2αFlox mice fed with normal chow and 40 folds higher than that in CA diet fed Frs2αFlox mice (Fig. 3A). These results indicate a critical role of FRS2α-mediated signaling pathways in negative feedback control of bile acid production.

Fig. 3. Ablation of Frs2α in hepatocytes compromises the bile acid-FGF15 feedback control of Cyp7a1 expression.

Fig. 3

Open in a new tab

(A) Frs2αFlox and Frs2αCN mice were fed with normal chow or 1% cholic acid-containing diet for 1 week. The liver was then harvested for real-time RT-PCR analyses of Cyp7a1 expression. (B) Frs2αFlox and Frs2αCN mice were I.P. injected with FGF19 (1 mg/kg body weight). Two hours after the injection, the liver was harvested for real-time RT-PCR analyses of the indicated genes. (C&D) The indicated mice were fasted for 4 hours in the morning. FGF19 in PBS was I.P. injected at a dosage of 1 mg/kg. The liver was harvested 30 minutes later for Western blot analyses of indicated proteins. RT-PCR data derived from 5 mice were normalized to actin loading control and presented as means±sd. *, p<0.05; SE, Squalene epoxidase; Flox, Frs2αFlox; CN, Frs2αCN.

To further test whether FRS2α was required for FGF15/FGF19, the ligand for the FGFR4-KLB complex, to downregulate Cyp7a1 expression, recombinant FGF19, the human ortholog of mouse FGF15, was administered to mice bearing either Frs2αFlox or Frs2αCN alleles by I.P. injection. In Frs2αFlox mice, liver expression of Cyp7a1 in the FGF19-injected group was reduced to 30% of control animals that were injected with PBS at 2 hours after the injection. However, injection of FGF19 failed to reduce Cyp7a1 expression in Frs2αCN mice, which remained to be 2.5 to 3.0 folds higher than that in Frs2αFlox animals regardless administration of FGF19 (Fig. 3B). Western blot also showed that CYP7A1 abundance was significantly increased in Frs2αCN liver and that FGF19 failed to reduce CYP7A1 expression in Frs2αCN liver (Fig. 3C). This indicated that FRS2α was required for FGF19 to regulate CYP7A1 expression and bile acid production. Interestingly, expression of squalene epoxidase (SE), one of the rate-limiting enzymes in sterol biosynthesis, was not affected by Frs2α ablation, although it was enhanced by FGF19 treatment (Fig. 3B), suggesting that FRS2α was not essential for FGF19 to activate SE expression in the liver.

The ERK and PI3K/AKT pathways are major downstream mediators of canonical FGF signaling cascade [12]. We then tested whether FRS2α was required for FGF19 to activate ERK or PI3K/AKT in the liver. Administration of recombinant FGF19 via I.P. injection induced phosphorylation of FRS2α and ERK, but not AKT, within 30 minutes after the injection (Fig. 3C). Ablation of Frs2α led to failure of FGF19 to induce ERK phosphorylation, without affecting baseline phosphorylation of AKT. The results indicated that FRS2α was essential for FGF19 to activate the ERK pathway as has demonstrated generally for canonical FGFs. Consistently, loss of Fgfr4 abolished the activity of FGF19 to induce phosphorylation of FRS2α and ERK. The mice carrying wildtype Fgfr4 or one Fgfr4 null alleles did not exhibit detectable differences and hereafter designated as Fgfr4 controls. The data here further demonstrate that FGFR4 was the only FGF receptor in the liver mediating FGF19 signals (Fig. 3D). However, FGF19 failed to induce phosphorylation of AKT on Thr308. Ablation of Fgfr4 or Frs2α, also did not affect AKT phosphorylation at the baseline level. The results suggest that the AKT pathway is not involved in the FGF19-FGFR4 signaling axis in the liver and that other signaling pathways are the upstream regulators for the AKT pathways. Interestingly, ablation of Fgfr4, but not Frs2α, increased phosphorylation of AMPK in the liver; ablation of Frs2α, but not Fgfr4, affected STAT3 phosphorylation. This is in line with the reports that FGFR4 elicits both FRS2α dependent and independent pathways and that FRS2α does not just serve as a downstream mediator for FGFR4.

FRS2α is required for FGFR4 to control the amplitude of Cyp7a1 expression in response to prandial stimulation

In addition to being negatively regulated by the FGF19/FGFR4 signaling axis, bile acid production is also regulated by other mechanisms, including prandial activities [34, 35]. However, how FGF signaling intertwines with other bile acid regulatory mechanisms has not been characterized. To investigate whether ablation of Fgfr4 compromised prandial control of bile acid production, both Fgfr4null and wildtype littermates were fasted overnight and re-fed with regular chow. Both Cyp7a1 expression and bile acid pool were measured one hour after re-feeding (Fig. 4A&B). The results showed that although re-feeding increased Cyp7a1 expression, the effects were significantly augmented in Fgfr4null mice, indicating that FGFR4 signaling limited the amplitude of the response to feeding.

Fig. 4. Ablation of Frs2 in hepatocytes attenuates FGFR4 control of the amplitude of post-prandial activation of Cyp7a1 expression.

Fig. 4

Open in a new tab

(A) The mice bearing the indicated Fgfr4 alleles were fasted overnight followed by feeding (Refed) with normal chow or continuing to fast (Fasted) for 1 hour. Expression of Cyp7a1 was analyzed by real-time RT-PCR. (B) The bile acid pools of mice with similar treatments as in (A) were analyzed as described. (C) Mice with the indicated genotype were treated as in (A) and the expression of Cyp7a1 was analyzed by real-time RT-PCR. Data derived from 5 mice were normalized to actin loading controls and presented as means±sd. BA, bile acid; R4Tg, transgenic mice expressing constitutively active FGFR4 in hepatocytes; *, p<0.05; Flox, Frs2αFlox; CN, Frs2αCN.

We previously reported that forced overexpression of a constitutively active FGFR4 (caFGFR4) mutant in the liver represses Cyp7a1 expression and bile acid production [14]. To determine whether constitutively exposure to FGFR4 kinase further attenuated prandial influences on bile acid production and whether FRS2α was required for FGFR4 to elicit such activities, transgenic mice overexpressing caFGFR4 in the liver were crossed with both Frs2αFlox and Frs2αCN mice. As described above, the mice were fasted overnight then re-fed with regular chow or continued fasting for an hour. Consistently, expression of caFGFR4 significantly reduced Cyp7a1 expression both in fasted or re-fed conditions. Ablation of Frs2α abolished the effects of caFGFR4 on Cyp7a1 expression in both conditions since the Frs2αCN mice essentially had a similar level of Cyp7a1 expression regardless of forced expression of caFGFR4 mutants in both groups (Fig. 4C). The data indicate that FRS2α is required for FGFR4 to suppress Cyp7a1 expression. It was noteworthy that regardless of overexpression of caFGFR4, the extent of prandial pattern-induced Cyp7a1 expression change was higher in Frs2αCN mice (11-fold increase) than that in Frs2αFlox mice (2.5-fold increase). This demonstrated that FRS2α is essential for FGFR4 to control the amplitude of Cyp7a1 expression changes in response to prandial activity, and therefore, regulating bile acid homeostasis as illustrated in Fig. 5.

Fig. 5. FRS2α mediates FGFR4 signals to control the amplitude of Cyp7a1 expression induced by meal intake.

Fig. 5

Open in a new tab

Meal intakes induce bile acid production via promoting Cyp7a1 expression in the liver. Elevated bile acids in the ileum induce Fgf15/Fgf19 expression in the ileum, which then activates the FRS2α-dependent pathways of FGFR4 and suppresses expression of Cyp7a1 in the liver.

Discussion

FRS2α has been well established as a membrane proximal mediator of canonical FGF signaling. The endocrine FGF15/19-FGFR4 signaling axis is a key mechanism regulating cholesterol/bile acid homeostasis. Whether FRS2α-mediated pathways are required for FGFR4 to control hepatic bile acid production has not been reported. Herein we showed that ablation of Frs2α in the hepatocytes abrogated the FGF15/FGF19-FGFR4 feedback control of bile acid production without effect on overall liver morphology. Both ablation of Fgfr4 or tissue-specific ablation of Frs2α in hepatocytes increased augmented effects of the prandial induction on the Cyp7a1 expression. Since CYP7A1 is the rate-limiting enzyme for bile acid production, the results indicate that FRS2α is essential for FGFR4 to control the amplitude of prandially-induced bile acid production via inhibiting Cyp7a1 expression. As conversion to bile acid is one exit strategy for extra cholesterol in the body, manipulation of FRS2α-mediated signaling pathways may provide a new avenue for controlling the cholesterol/bile acid homeostasis.

Frs2α null embryos die in early development [22]; cell type-specific disruption of Frs2α causes significant defects in many organs and frequently phenocopies the deficiency of FGF or FGFR [24, 36, 37]. Although the AlbCre driver is expressed in embryonic stages, no significant developmental defects in the liver were observed. This is consistent with the data that Fgfr4 null mice have no obvious developmental defects [26], which is the only FGFR isoform in mature hepatocytes. AlbCre is only expressed in the liver after E15.5, and the expression is mosaic at the stage. It is possible that late and low penetration of the Frs2α disruption was not sufficient to disrupt liver development. It is also possible that other adaptor protein, such as FRS2β, may compensate the loss of FRS2α to support liver development. However, it is also possible that FRS2α-mediated pathways are not essential for liver development. Although beyond the scope of this study, further investigations will be taken to address this issue. No significant difference in longevity was observed between Frs2αCN and Frs2αFlox mice. This indicated that the loss of hepatocyte FRS2α did not impact the maintenance and vital functions of the liver and is in line with the finding that FGFR4-deficient mice are relatively normal [26]. However, whether FRS2α plays a role in other cell types of the liver remains to be characterized.

There is no change in liver and intestine bile acid transporters that are responsible for bile acid secretion and reabsorption, respectively. Thus, the increase in fecal bile acids and total bile acid pool size represents the upregulated bile acid production. The expression of Cyp8b1 that encodes a key enzyme for the chenodeoxycholic acid synthesis was not changed in the FRS2α deficient mice. Therefore, increase in Cyp7a1 expression is solely responsible for elevation of bile acid production in Frs2αCN liver, which is consistent with Fgfr4 ablation [10]. Since ileum FGF15/19 expression is regulated by bile acids through the FXR receptor [38], increase in bile acids in the intestine will enhance FGF15/19 expression. This explains why Frs2αCN mice had increased Fgf15 expression in the ileum.

Increased bile acid production in the FRS2α-deficient mice indicates that FRS2α-mediated pathways negatively regulate bile acid production. The significance of this finding was further demonstrated in the two studies with bile acid diet challenge and the fasting-feeding condition. In both cases, the differences between Frs2αFlox and Frs2αCN mice were intensified with respect to Cyp7a1 expression. It is worthwhile to notice that Cyp7a1 expression was increased upon re-feeding in Frs2αCN mice, suggesting prandial upregulation of Cyp7a1 expression is mediated by FRS2α-independent mechanisms. However, FRS2α-mediated pathways controlled the amplitude of the surge since ablation of Frs2α augmented the escalation of Cyp7a1 expression. The detailed molecular mechanism underlying this augmentation needs to be studied.

FRS2α-deficiency in hepatocytes blocked FGFR4 repression of Cyp7a1 expression (Fig. 4C), as well as FGF15/FGF19-regulated ERK activation and gene expression in the liver (Fig. 3), indicating that FRS2α is an essential component in the FGF15/FGF19-FGFR4 signaling axis. In addition, this suggests that eFGFs share similar downstream signaling pathways with other classical FGFs and that FRS2α is needed for FGF19 to regulate expression of these genes. The molecular mechanism of how shared signals between eFGFs and canonical FGFs requiring klotho co-receptors are limited to metabolic regulation in the case of eFGFs is of great interest.

In conclusion, the FRS2α-mediated signaling pathway is essential for the ileum-liver directionally specific FGF15/FGF19-FGFR4 signaling axis to regulate bile acid homeostasis through controlling expression of Cyp7a1 that encodes the rate-limiting enzyme in bile acid synthesis. The finding suggests a new avenue for pharmaceutical control of bile acid/cholesterol metabolism.

Conclusion

FGF15-FGFR4 signaling from the ileum to the liver limits the amplitude of bile acid production induced by prandial activities via the Frs2α-mediated pathway in hepatocytes. The results unravel a feedback control mechanism by which the food intake induced bile acid production is restrained by eFGFs.

Acknowledgements

We thank Dr. Chuxia Deng for mice bearing the original Fgfr4 null allele and Samantha Del Castillo for critical reading of the manuscript. This work was supported by the National Institutes of Health CA96824, CA140388, DE023106, and The Cancer Prevention and Research Institution of Texas CPRIT110555 to FW, the J.S. Dunn Research Foundation to WLM, the Natural Science Foundation of Zhejiang Province of China (Y2110492) to CW, and the National Natural Science Foundation of China (81101712, 81270761) to XL.

List of abbreviation

FGF

fibroblast growth factor

FGFR

fibroblast growth factor receptor

FRS2α

fibroblast growth factor receptor substrate 2 alpha

CN

conditional null

eFGF

endocrine fibroblast growth factor

SE

squalene epoxidase

Cyp7a1

cholesterol 7 α-hydroxylase

KLB

beta Klotho

Footnotes

Conflict of Interests:

None.

References

  • [1].Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell. 2000;102(6):731–44. doi: 10.1016/s0092-8674(00)00062-3. [DOI] [PubMed] [Google Scholar]
  • [2].Houten SM, Watanabe M, Auwerx J. Endocrine functions of bile acids. EMBO J. 2006;25(7):1419–25. doi: 10.1038/sj.emboj.7601049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Davis RA, Miyake JH, Hui TY, Spann NJ. Regulation of cholesterol-7alpha-hydroxylase: BAREly missing a SHP. J Lipid Res. 2002;43(4):533–43. [PubMed] [Google Scholar]
  • [4].Kalaany NY, Mangelsdorf DJ. LXRS and FXR: the yin and yang of cholesterol and fat metabolism. Annu Rev Physiol. 2006;68:159–91. doi: 10.1146/annurev.physiol.68.033104.152158. [DOI] [PubMed] [Google Scholar]
  • [5].Abrahamsson A, Gustafsson U, Ellis E, Nilsson LM, Sahlin S, Bjorkhem I, et al. Feedback regulation of bile acid synthesis in human liver: importance of HNF-4alpha for regulation of CYP7A1. Biochemical and biophysical research communications. 2005;330(2):395–9. doi: 10.1016/j.bbrc.2005.02.170. [DOI] [PubMed] [Google Scholar]
  • [6].Gupta S, Stravitz RT, Dent P, Hylemon PB. Down-regulation of cholesterol 7alpha-hydroxylase (CYP7A1) gene expression by bile acids in primary rat hepatocytes is mediated by the c-Jun N-terminal kinase pathway. The Journal of biological chemistry. 2001;276(19):15816–22. doi: 10.1074/jbc.M010878200. [DOI] [PubMed] [Google Scholar]
  • [7].Li-Hawkins J, Gafvels M, Olin M, Lund EG, Andersson U, Schuster G, et al. Cholic acid mediates negative feedback regulation of bile acid synthesis in mice. The Journal of clinical investigation. 2002;110(8):1191–200. doi: 10.1172/JCI16309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Kim I, Ahn SH, Inagaki T, Choi M, Ito S, Guo GL, et al. Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine. J Lipid Res. 2007;48(12):2664–72. doi: 10.1194/jlr.M700330-JLR200. [DOI] [PubMed] [Google Scholar]
  • [9].Inagaki T, Choi M, Moschetta A, Peng L, Cummins CL, McDonald JG, et al. Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab. 2005;2(4):217–25. doi: 10.1016/j.cmet.2005.09.001. [DOI] [PubMed] [Google Scholar]
  • [10].Yu C, Wang F, Kan M, Jin C, Jones RB, Weinstein M, et al. Elevated cholesterol metabolism and bile acid synthesis in mice lacking membrane tyrosine kinase receptor FGFR4. The Journal of biological chemistry. 2000;275(20):15482–9. doi: 10.1074/jbc.275.20.15482. [DOI] [PubMed] [Google Scholar]
  • [11].Ito S, Fujimori T, Furuya A, Satoh J, Nabeshima Y. Impaired negative feedback suppression of bile acid synthesis in mice lacking betaKlotho. J Clin Invest. 2005;115(8):2202–8. doi: 10.1172/JCI23076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].McKeehan WL, Wang F, Luo Y. The fibroblast growth factor (FGF) signaling complex. In: Bradshaw R, Dennis E, editors. Handbook of Cell Signaling. 2dn ed Academic/Elsevier Press; New York: 2009. [Google Scholar]
  • [13].Itoh N, Ornitz DM. Functional evolutionary history of the mouse Fgf gene family. Developmental dynamics : an official publication of the American Association of Anatomists. 2008;237(1):18–27. doi: 10.1002/dvdy.21388. [DOI] [PubMed] [Google Scholar]
  • [14].Luo Y, Yang C, Lu W, Xie R, Jin C, Huang P, et al. Metabolic regulator betaKlotho interacts with fibroblast growth factor receptor 4 (FGFR4) to induce apoptosis and inhibit tumor cell proliferation. The Journal of biological chemistry. 2010;285(39):30069–78. doi: 10.1074/jbc.M110.148288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Yang C, Jin C, Li X, Wang F, McKeehan WL, Luo Y. Differential specificity of endocrine FGF19 and FGF21 to FGFR1 and FGFR4 in complex with KLB. PloS one. 2012;7(3):e33870. doi: 10.1371/journal.pone.0033870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Suzuki M, Uehara Y, Motomura-Matsuzaka K, Oki J, Koyama Y, Kimura M, et al. betaKlotho is required for fibroblast growth factor (FGF) 21 signaling through FGF receptor (FGFR) 1c and FGFR3c. Molecular endocrinology. 2008;22(4):1006–14. doi: 10.1210/me.2007-0313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Urakawa I, Yamazaki Y, Shimada T, Iijima K, Hasegawa H, Okawa K, et al. Klotho converts canonical FGF receptor into a specific receptor for FGF23. Nature. 2006;444(7120):770–4. doi: 10.1038/nature05315. [DOI] [PubMed] [Google Scholar]
  • [18].Kurosu H, Choi M, Ogawa Y, Dickson AS, Goetz R, Eliseenkova AV, et al. Tissue-specific expression of betaKlotho and fibroblast growth factor (FGF) receptor isoforms determines metabolic activity of FGF19 and FGF21. The Journal of biological chemistry. 2007;282(37):26687–95. doi: 10.1074/jbc.M704165200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Kurosu H, Ogawa Y, Miyoshi M, Yamamoto M, Nandi A, Rosenblatt KP, et al. Regulation of fibroblast growth factor-23 signaling by klotho. The Journal of biological chemistry. 2006;281(10):6120–3. doi: 10.1074/jbc.C500457200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Belov AA, Mohammadi M. Molecular mechanisms of fibroblast growth factor signaling in physiology and pathology. Cold Spring Harbor perspectives in biology. 2013;5(6) doi: 10.1101/cshperspect.a015958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Zhang Y, McKeehan K, Lin Y, Zhang J, Wang F. Fibroblast growth factor receptor 1 (FGFR1) tyrosine phosphorylation regulates binding of FGFR substrate 2alpha (FRS2alpha) but not FRS2 to the receptor. Molecular endocrinology. 2008;22(1):167–75. doi: 10.1210/me.2007-0140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Hadari YR, Gotoh N, Kouhara H, Lax I, Schlessinger J. Critical role for the docking-protein FRS2 alpha in FGF receptor-mediated signal transduction pathways. Proceedings of the National Academy of Sciences of the United States of America. 2001;98(15):8578–83. doi: 10.1073/pnas.161259898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Lin Y, Cheng YS, Qin C, Lin C, D’Souza R, Wang F. FGFR2 in the dental epithelium is essential for development and maintenance of the maxillary cervical loop, a stem cell niche in mouse incisors. Developmental dynamics : an official publication of the American Association of Anatomists. 2009;238(2):324–30. doi: 10.1002/dvdy.21778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Zhang Y, Zhang J, Lin Y, Lan Y, Lin C, Xuan JW, et al. Role of epithelial cell fibroblast growth factor receptor substrate 2{alpha} in prostate development, regeneration and tumorigenesis. Development. 2008;135(4):775–84. doi: 10.1242/dev.009910. [DOI] [PubMed] [Google Scholar]
  • [25].Zhang J, Chang JY, Huang Y, Lin X, Luo Y, Schwartz RJ, et al. The FGF-BMP signaling axis regulates outflow tract valve primordium formation by promoting cushion neural crest cell differentiation. Circulation research. 2010;107(10):1209–19. doi: 10.1161/CIRCRESAHA.110.225318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Weinstein M, Xu X, Ohyama K, Deng CX. FGFR-3 and FGFR-4 function cooperatively to direct alveogenesis in the murine lung. Development. 1998;125(18):3615–23. doi: 10.1242/dev.125.18.3615. [DOI] [PubMed] [Google Scholar]
  • [27].Yu C, Wang F, Jin C, Huang X, McKeehan WL. Independent repression of bile acid synthesis and activation of c-Jun N-terminal kinase (JNK) by activated hepatocyte fibroblast growth factor receptor 4 (FGFR4) and bile acids. The Journal of biological chemistry. 2005;280(18):17707–14. doi: 10.1074/jbc.M411771200. [DOI] [PubMed] [Google Scholar]
  • [28].Lin Y, Zhang J, Zhang Y, Wang F. Generation of an Frs2alpha conditional null allele. Genesis. 2007;45(9):554–9. doi: 10.1002/dvg.20327. [DOI] [PubMed] [Google Scholar]
  • [29].Postic C, Shiota M, Niswender KD, Jetton TL, Chen Y, Moates JM, et al. Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. The Journal of biological chemistry. 1999;274(1):305–15. doi: 10.1074/jbc.274.1.305. [DOI] [PubMed] [Google Scholar]
  • [30].Wang C, Chang JY, Yang C, Huang Y, Liu J, You P, et al. Type 1 fibroblast growth factor receptor in cranial neural crest cells-derived mesenchyme is required for palatogenesis. The Journal of biological chemistry. 2013 doi: 10.1074/jbc.M113.463620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Zhang Y, Zhang J, Lin Y, Lan Y, Lin C, Xuan JW, et al. Role of epithelial cell fibroblast growth factor receptor substrate 2alpha in prostate development, regeneration and tumorigenesis. Development. 2008;135(4):775–84. doi: 10.1242/dev.009910. [DOI] [PubMed] [Google Scholar]
  • [32].Deutsch G, Jung J, Zheng M, Lora J, Zaret KS. A bipotential precursor population for pancreas and liver within the embryonic endoderm. Development. 2001;128(6):871–81. doi: 10.1242/dev.128.6.871. [DOI] [PubMed] [Google Scholar]
  • [33].Huang X, Yang C, Luo Y, Jin C, Wang F, McKeehan WL. FGFR4 prevents hyperlipidemia and insulin resistance but underlies high-fat diet induced fatty liver. Diabetes. 2007;56(10):2501–10. doi: 10.2337/db07-0648. [DOI] [PubMed] [Google Scholar]
  • [34].Everson GT. Steady-state kinetics of serum bile acids in healthy human subjects: single and dual isotope techniques using stable isotopes and mass spectrometry. Journal of lipid research. 1987;28(3):238–52. [PubMed] [Google Scholar]
  • [35].Ho KJ. Circadian distribution of bile acids in the enterohepatic circulatory system in rats. The American journal of physiology. 1976;230(5):1331–5. doi: 10.1152/ajplegacy.1976.230.5.1331. [DOI] [PubMed] [Google Scholar]
  • [36].Zhang J, Lin Y, Zhang Y, Lan Y, Lin C, Moon AM, et al. Frs2alpha-deficiency in cardiac progenitors disrupts a subset of FGF signals required for outflow tract morphogenesis. Development. 2008;135(21):3611–22. doi: 10.1242/dev.025361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Sims-Lucas S, Cusack B, Eswarakumar VP, Zhang J, Wang F, Bates CM. Independent roles of Fgfr2 and Frs2alpha in ureteric epithelium. Development. 2011;138(7):1275–80. doi: 10.1242/dev.062158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Holt JA, Luo G, Billin AN, Bisi J, McNeill YY, Kozarsky KF, et al. Definition of a novel growth factor-dependent signal cascade for the suppression of bile acid biosynthesis. Genes & development. 2003;17(13):1581–91. doi: 10.1101/gad.1083503. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES