Abstract
Background
Protozoan parasites of the genus Leishmania cause a large spectrum of clinical manifestations known as Leishmaniases. These diseases are increasingly important public health problems in many countries both within and outside endemic regions. Thus, an accurate differential diagnosis is extremely relevant for understanding epidemiological profiles and for the administration of the best therapeutic protocol.
Methods/Principal Findings
Exploring the High Resolution Melting (HRM) dissociation profiles of two amplicons using real time polymerase chain reaction (real-time PCR) targeting heat-shock protein 70 coding gene (hsp70) revealed differences that allowed the discrimination of genomic DNA samples of eight Leishmania species found in the Americas, including Leishmania (Leishmania) infantum chagasi, L. (L.) amazonensis, L. (L.) mexicana, L. (Viannia) lainsoni, L. (V.) braziliensis, L. (V.) guyanensis, L. (V.) naiffi and L. (V.) shawi, and three species found in Eurasia and Africa, including L. (L.) tropica, L. (L.) donovani and L. (L.) major. In addition, we tested DNA samples obtained from standard promastigote culture, naturally infected phlebotomines, experimentally infected mice and clinical human samples to validate the proposed protocol.
Conclusions/Significance
HRM analysis of hsp70 amplicons is a fast and robust strategy that allowed for the detection and discrimination of all Leishmania species responsible for the Leishmaniases in Brazil and Eurasia/Africa with high sensitivity and accuracy. This method could detect less than one parasite per reaction, even in the presence of host DNA.
Author Summary
The different clinical forms of the Leishmaniases range from cutaneous to visceral infections and are caused by organisms belonging to the genus Leishmania. Controversy over the validity of different molecular methods to correctly identify a species hinders the association of a given species with different clinical forms, complicating the prognosis and the development of suitable treatment protocols. A correct identification leads to a better understanding of the action and consequent development of new drugs and immunological reactions. It also provides important information about the relationship of each species with its hosts (humans, animal reservoirs and sandflies) in different geographical areas and ecological situations, helping to design control strategies. Today, PCR is the most commonly used method for Leishmania identification, but even though several targets have been described, no simple and direct protocol has emerged. In this paper, we coupled hsp70 real-time PCR with the determination of amplicon melting profiles in order to explore polymorphic regions by HRM analysis. This methodology yielded discriminatory melting temperature (Tm) values for Brazilian and Eurasian/African Leishmania species. The protocol has proven to be 100% reliable with both clinical and experimental samples. The major advantage of the presently described method is that it is simple, less expensive, highly sensitive and easily automated.
Introduction
Leishmaniases are a major worldwide public health problem and manifest themselves as a spectrum of diseases that may be exacerbated by other infections, such as human immunodeficiency virus. According to the World Health Organization, these diseases are endemic in 98 countries on 5 continents, with more than 350 million people at risk [1, 2]. Clinically, Leishmaniases can be broadly divided as either cutaneous or visceral, but neither form is exclusively linked to a particular species. Although cutaneous manifestations of the diseases are not life threatening, these manifestations can result in obstruction or destruction of the pharynx, larynx and nose in their final stages [2]. The visceral form is the most severe form, characterized by fever, loss of weight, splenomegaly, hepatomegaly, lymphadenopathies and anaemia, often with fatal outcomes if not timely treated [3].
The severity of the disease and its therapeutic responses are variable and depend on the patient’s immune response, the Leishmania species and even the parasite strain [4]. In this scenario, the development of optimized protocols for discriminating between the different Leishmania species is extremely useful and important in clinical management and treatment. The ability to evaluate the most appropriate species-specific treatments also supports the elucidation of the mechanisms of action of new drugs and the establishment of new species-specific treatment protocols. Furthermore, the identification of these parasites allows the generation of important data for clinical, epidemiological and ecological studies.
There are very few publications addressing a Leishmaniasis diagnosis using a High Resolution Melting (HRM) analysis, a methodology that detects differences in the nucleotide composition of a specific real-time PCR product. The method is based on thermodynamic differences in the dissociation curve profiles of amplicons generated from real-time PCR. The generated curves are specific signatures that identify polymorphisms due to small differences in nucleotide composition. In spite of the paucity of papers on the HRM method, some workers have already used it to discriminate Leishmania using targets against 7SL RNA [5, 6], haspb [7], the rRNA ITS sequence [8, 9], the rRNA ITS sequence coupled to hsp70 [10, 11] and a FRET-based assay using MPI and 6PGD [12].
Amongst several targets described for Leishmania identification, the heat-shock protein 70 coding gene (hsp70) has proven to be useful in identifying many species of different geographical origins [13–17].
In this work, we propose a more efficient protocol using HRM analyses targeting the hsp70 sequence for the discrimination of seven Brazilian Leishmania species, as well as three Eurasian and African species. This methodology was validated with DNA from reference strains, experimental infections in mice, human clinical samples and naturally infected phlebotomine sand flies.
Materials and Methods
Organisms
Promastigotes of L. (L.) tropica (MHOM/SU/60/OD), L. (L.) donovani (MHOM/IN/80/DD8), L. (L.) infantum chagasi (MCER/BR/1981/M6445), L. (L.) major (MHOM/IL/81/Friedlin), L. (L.) amazonensis (MHOM/BR/1973/M2269), L. (L.) mexicana (MNYC/BZ/62/M379), L. (L.) lainsoni (MHOM/BR/81/M6426), L. (V.) braziliensis (MHOM/BR/1975/M2903), L. (V.) guyanensis (MHOM/BR/1975/M4147), L. (V.) naiffi (MDAS/BR/1979/M5533) and L. (V.) shawi (MCEB/BR/84/M8408) were grown at 25°C in M199 medium with 10% fetal bovine serum (Life Technologies, Carlsbad, CA, USA). Procyclic forms of Trypanosoma cruzi (Y strain) and T. brucei (427 strain) were grown at 28°C in liver-infusion-tryptose medium and SDM-79, respectively, with 10% fetal bovine serum (Life Technologies). Human DNA, FMUSP-IOF-2016, obtained from USP Medical School, was used in specificity tests.
Trypanosomatids DNA
DNA samples from reference strains were purified by a salting-out procedure using an adaptation of the protocol described by Miller et al. 1988 [18]. Approximately 2.5 x 109 promastigotes in stationary growth culture were centrifuged at 3000 x g for 10 min at 25°C. The cells were resuspended in 6 mL of lysis buffer (10 mM Tris-HCl, pH 7.4; 400 mM NaCl; 2 mM EDTA) and lysed by the addition of 600 μL of 10% SDS. After overnight digestion with 1 mg of proteinase K at 37°C, 2 mL of saturated NaCl solution was added to lysate, and then, the lysate was vigorously mixed for 15 seconds and centrifuged for 15 minutes at 25°C for the removal of precipitated proteins. Two volumes of cold absolute ethanol were added to the supernatant, and the precipitated DNA was washed with 70% ethanol and resuspended in 1 mL of TE buffer (10 mM Tris, pH 7.4; 1 mM EDTA).
Clinical, experimental and natural DNA samples/ethical statements
DNA from samples obtained from fresh humans biopsies, collected by doctors at Clinical Hospital of Medical Faculty USP, or fixed and paraffin-embedded samples from the collection of Instituto Evandro Chagas, (Belem-Para) were used in accordance to the norms established by the National Committee of Ethics in Research (Comissão Nacional de Ética em Pesquisa, CONEP/CNS), resolution 196/96 with the approval of the Ethics in Research Committees of the Institutions of origin (CAPPesq no. 0804/07, IEC n°. 0029/2007).
Fresh experimentally infected BALB/c mice samples of L. (L.) amazonensis or L. (V.) braziliensis were obtained 6 weeks after infection when the animals were sacrificed and tissues were collected and DNA was obtained as described below; the procedures involving the use of BALB/c mice had the approval of the Ethical Committee for use of Animals of Biomedical Sciences Institute of University of São Paulo (CEUA-ICB-USP), under protocol #145 of October 20th, 2011, according to Brazilian Federal Law 11.794 of October 8th 2008.
DNA from infected phlebotomines captured in nature were purified using the commercial DNeasy Tissue & Blood kit (QIAGEN, Hilden, Germany), according to the manufacturer´s manual. Paraffin-embedded samples were prepared according to de Lima et al. 2011 [19]. The DNA concentration was measured by spectrophotometry.
PCR assays
Initially, we amplified the hsp70 234 bp fragments for all species analyzed in this study using the primers described by Graça et al. [17]. The alignment of the nucleotide sequence of those fragments was used to design primers for HRM analysis. Oligonucleotides used in the PCR assays to amplify a 144 bp fragment of hsp70 (amplicon 1) were hsp70C reverse, previously described by Graça et al. 2012 [17], and a new forward oligonucleotide designed and named hsp70F2 (5’–GGAGAACTACGCGTACTCGATGAAG–3’). For the amplification of a 104 bp fragment of hsp70 (amplicon 2) specific to the species from the L. (Viannia) subgenus, the oligonucleotides hsp70F1 (5’–AGCGCATGGTGAACGATGCGTC–3’) and hsp70R1 (5’–CTTCATCGAGTACGCGTAGTTCTCC–3’) were designed. The hsp70 amplicon sequences are shown in Fig 1 and indicate the position of the primers. Conventional PCR reactions were performed on a Mastercycler Gradient Thermocycler (Eppendorf, Hamburg, Germany) with TopTaq Master Mix (QIAGEN) in a final volume of 25 μL with 200 nM of each primer and 50 ng of genomic DNA as a template. The thermal cycling conditions were as follows: an initial denaturation step of 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 30 sec and extension at 72°C for 30 sec, with a final extension at 72°C for 10 min. Real-time PCR reactions were performed using MeltDoc Master Mix for HRM with the fluorophore SYTO9 (Life Technologies) in a final volume of 20 μL with 200 nM of each primer and 50 ng of genomic DNA. The real time amplification conditions were as follows: an initial denaturation step at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 30 sec and annealing/extension at 60°C for 30 sec, with the acquisition of fluorescent signals at the end of each extension step, followed by the dissociation curve for HRM analysis in Thermocycler PikoReal96 (Thermo Fisher Scientific, Walthman, MA, USA).
Fig 1. Nucleotide sequence of hsp70 amplicons and primer localization.
Alignment of the nucleotide sequence of amplicon 1 (A) and amplicon 2 (B) of each Leishmania species used in the HRM analysis. The underlined sequences indicate the position of the primers used in real-time PCR assays; the grey boxed nucleotides represent the variable regions found among reference strains of Leishmania.
Cloning and sequencing
The 234 bp hsp70 fragment produced by conventional PCR, as described by Graça et al. 2012 [17], from each Leishmania species used in this study was purified and cloned into a pGEM-T vector using the pGEM-T Easy Vector System (Promega, Madison, WI, USA) and E. coli SURE competent cells. The recombinant plasmids from at least three colonies were purified, and they were sequenced with T7 and SP6 primers and the BigDyeTerminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). The sequencing was performed on an ABI 3130 XL Platform (Life Technologies).
Target quantification with standard curves
Recombinant plasmids containing the hsp70 target were linearized with ScaI. The plasmid copy number was calculated considering the molar mass concentration, and a serial dilution on a tenth proportion was used to produce standard curves for each quantification test. The quality parameters for the standard curves were obtained by PikoReal Software (Thermo Fischer Scientific) analysis, including the correlation coefficient, linear dynamic range and PCR efficiency.
High resolution melting (HRM)
HRM assays were performed at the end of each real-time PCR. The amplicon dissociation analysis was performed by capturing fluorescence signals in 0.2°C intervals and holding for 10 seconds in each range of the melting curve (between 60°C to 95°C). The acquisition of fluorescence data and the construction of dissociation profiles were performed using PikoReal96 software. HRM software normalizes melting curves relatively to values from pre- and post-melting point assigned as 100% and 0%, respectively. Then the software determines the normalized difference that means the signal-to-noise ratio difference of each sample versus a user-defined sequence that can be any. The call efficiency is the benchmark measured in percentage of the similarity between two dissociation profiles using fluorescence and Tm values as parameters. The software performs a paired comparison between the profile of the sample of unknown identity and each standard and chooses the standard that has the closest value. The “call” identity refers to the designation allotted to the sample being identified based on that of the closest standard.
The graphs containing the means and standard deviations of the Tm values obtained by the HRM analyses were made in GraphPad PRISM v. 6.02 software.
Results
Polymorphic sites on the hsp70 gene
The hsp70 sequences deposited in GenBank for L. (L.) tropica (FN395025.1), L. (L.) donovani (AY702003.1), L. (L.) infantum (HF586351.1), L. (L.) major (HF586346.1), L. (L.) amazonensis (EU599090.1), L. (L.) mexicana (EU599091.1), L. (L.) infantum chagasi (FN395036.1), L. (V.) braziliensis (GU071173.1), L. (V.) guyanensis (EU599093.1), L. (V.) lainsoni (GU071174.1), L. (V.) naiffi (GU071183.1) and L. (V.) shawi (GU071177.1) were used for oligonucleotide design. DNA from all Leishmania reference strains analyzed in this study was used as templates in conventional PCR, and the amplicons were cloned and sequenced to confirm the sequences to those deposited in GenBank. The obtained hsp70 amplicon sequences were then aligned, and we chose regions containing polymorphic sites to be used in HRM methodology (Fig 1).
The two pairs of oligonucleotides depicted in the alignment produced the two expected PCR fragments for all Leishmania reference strain DNA used as a template. The 144 bp amplicon 1 is the PCR product used in the amplification of all Leishmania species. The 104 bp amplicon 2 was produced by the oligonucleotide pair designed for species of the L. (Viannia) subgenus (Figs 1, S1 and S2).
Specificity and sensitivity of HRM assays
The average and standard deviation of the melting temperature (Tm) of each amplicon was determined in duplicate from three independent experiments using 50 ng of DNA as a template from each reference species. The melting profiles and obtained Tm values of hsp70 amplicon 1 for all species studied are presented in Figs 2 and 3 and Table 1. For a reliable discrimination, we calculated the dispersion of Tm values and only considered differences in Tm values exceeding 0.3°C (Fig 2).
Fig 2. Tm values obtained with the HRM assay.
Representative dispersion graph of individual Tm values for each studied Leishmania species using 50 ng of genomic DNA as a template for hsp70 amplicon 1 and amplicon 2. The plots show the average and standard deviation of the Tm values. Each species was tested in duplicate in three independent experiments.
Fig 3. HRM plots of hsp70 amplicon 1.
Representative melting profiles of hsp70 amplicon 1 obtained with DNA from Leishmania species present in Brazil (A, B) or DNA from Leishmania species of Eurasia and Africa (C, D). (A, C): Normalized melting curves; (C, D): normalized difference curves. (Lt): L. (L.) tropica; (Ld): L. (L.) donovani; (Lc): L. (L.) infantum chagasi; (Lj): L. (L.) major; (La): L. (L.) amazonensis; (Lx): L. (L.) mexicana; (Ll): L. (V.) lainsoni; (Lb): L. (V.) braziliensis; (Lg): L. (V.) guyanensis; (Ln): L. (V.) naiffi and (Ls): L. (V.) shawi. Each sample was tested in duplicate.
Table 1. Tm values obtained in the HRM analysis targeting the hsp70 gene of different Leishmania species.
Fifty ng of genomic DNA from each species was tested in duplicate in three independent experiments.
| Leishmania species | Tm (°C) Amplicon 1 | Tm (°C) Amplicon 2 |
|---|---|---|
| L. (L.) tropica | 84.40 ± 0.02 | - |
| L. (L.) donovani | 85.01 ± 0.04 | - |
| L. (L.) infantum chagasi | 85.04 ± 0.03 | - |
| L. (L.) major | 85.23 ± 0.03 | - |
| L. (L.) amazonensis | 85.39 ± 0.03 | - |
| L. (L.) mexicana | 85.46 ± 0.06 | - |
| L. (V.) lainsoni | 85.60 ± 0.01 | 84.07 ± 0.01 |
| L. (V.) braziliensis | 85.86 ± 0.01 | 84.51 ± 0.03 |
| L. (V.) guyanensis | 86.14 ± 0.02 | 84.01 ± 0.00 |
| L. (V.) naiffi | 86.58 ± 0.11 | 84.48 ± 0.01 |
| L. (V.) shawi | 86.80 ± 0.01 | 84.07 ± 0.01 |
The standard curves for the quantification assays using the cloned target showed good linear correlations (0.99 for all curves) and efficiencies varying from 92,37 to 97.23% for all tested species, in the range of 101 to 107 copies (S3 Fig). Moreover, to evaluate the specificity/sensitivity of hsp70 amplicon 1 as a target, HRM assays were performed using genomic DNA from the seven references species of Leishmania in proportions of 1:1 or 1:100 in relation to a human reference DNA (FMUSP-IOF-2016), and the call identification agreed 100% with the reference samples, even in samples where the call efficiency was approximately 75% (Table 2).
Table 2. Call efficiency obtained in the HRM analysis targeting the hsp70 gene of different Leishmania species in the presence of two different amounts of human reference (FMUSP-IOF-2016) DNA.
The “call” column shows the identification name given by the software to the unknown samples based on names given to the reference samples; (CHA): L. (L.) infantum chagasi; (AMA): L. (L.) amazonensis; (LAI): L. (V.) lainsoni; (BRA): L. (V.) braziliensis; (GUY): L. (V.) guyanensis; (NAI): L. (V.) naiffi and (SHA): L. (V.) shawi. Each condition was tested in duplicate.
| Leishmania species | DNA proportion 1:1 | DNA proportion 1:100 | ||
|---|---|---|---|---|
| Call | Efficiency (%) | Call | Efficiency (%) | |
| L. (L.) infantum chagasi | CHA | 92.55 | CHA | 79.95 |
| L. (L.) amazonensis | AMA | 89.90 | AMA | 75.80 |
| L. (V.) lainsoni | LAI | 89.20 | LAI | 74.35 |
| L. (V.) braziliensis | BRA | 89.85 | BRA | 78.10 |
| L. (V.) guyanensis | GUY | 91.90 | GUY | 79.40 |
| L. (V.) naiffi | NAI | 95.05 | NAI | 81.95 |
| L. (V.) shawi | SHA | 93.00 | SHA | 81.55 |
To test if the initial amount of target DNA caused a variation in the Tm, serial dilutions containing 50 ng to 50 fg (DNA amount corresponding to 5.0 x 105 to 0.5 of parasite) of Leishmania DNA from reference strains were used as a template to produce both hsp70 amplicon 1 (Fig 4A) and hsp70 amplicon 2 (Fig 4B). The Tm variation obtained for both amplicons in each species showed that some species presented a fluctuation of Tm values that overlapped with other species.
Fig 4. Effect of the amount of target DNA on the Tm values of hsp70 amplicons.
Representative dispersion graph of individual Tm values for each studied Leishmania species for amplicon 1 (A) and for amplicon 2 (B). Each point corresponds to the average and standard deviation of the variation in the Tms obtained within a range of 50 ng to 50 fg of genomic DNA used as a template. Each concentration point was measured in duplicate.
In the case of overlapping Tm values for amplicon 1, a sequential discrimination can be performed by HRM analysis of amplicon 2. This amplicon is specific for the L. (Viannia) subgenus species, allowing the segregation of two patterns that group L. (V.) guyanensis, L. (V.) lainsoni and L. (V.) shawi with Tm = 83.92 ± 0.04°C or L. (V.) naiffi and L. (V.) braziliensis with Tm = 84.39 ± 0.04°C (Figs 4 and 5).
Fig 5. HRM plots of hsp70 amplicon 2.
Representative melting profiles of hsp70 amplicon 2. Panels (A) and (B) show the melting profiles of American L. (Viannia) species with data organized in normalized melting curves and normalized difference curves, respectively. (Lb): L. (V.) braziliensis; (Ln): L. (V.) naiffi; (Ll): L. (V.) lainsoni; (Lg): L. (V.) guyanensis and (Ls): L. (V.) shawi. Panel (C) shows the amplification curves in relation to the Ct, using DNA of the same species as A and B plus (Lt.): L. (L.) tropica; (Ld): L. (L.) donovani; (Li): L. (L.) infantum; (La): L. (L.) amazonensis; (Lx): L. (L.) mexicana and (Lj): L. (L.) major. Each sample was tested in duplicate.
The Ct values obtained in the amplification curves of amplicon 2, using DNA of all Leishmania studied indicated that the reactions were at least 5 orders of magnitude more specific to Leishmania (Viannia) species than for the L. (Leishmania) species (Figs 5C and S2), confirming that amplicon 2 can be used to discriminate L. (Viannia) from the L. (Leishmania) species.
Moreover, using the information on the geographical origin of the samples associated with the HRM analysis of hsp70 amplicon 2 allowed for the discrimination between L. (L.) donovani and L. (L.) infantum chagasi; among L. (L.) major, L. (L.) amazonensis, L. (L.) mexicana and L. (V.) lainsoni.
DNA from uninfected mouse, human, or Trypanosoma cruzi and T. brucei were used as templates and compared to the standardized positive range of Tm values for the tested Leishmania species. No cross-reactivity was detected. For these controls, characteristic Tm values (T. cruzi: 83.08 ± 0.07°C and T. brucei: 83.91 ± 0.06°C) or no amplification was observed (mouse and human) (S4 Fig).
Validation of the HRM Protocol with other Leishmania strains and with experimental, clinical and field samples
The HRM analysis of hsp70 amplicon 1 obtained with DNA from other Leishmania isolates also used as reference strains resulted in a 100% correlation with the Tm values of the reference species used in this study (Table 3). Some of those strains represent isolates obtained from different geographical regions in Brazil, and experimentally corroborated the identification through the HRM protocol for possible polymorphisms.
Table 3. Call efficiency obtained in the HRM analysis targeting the hsp70 gene of different Leishmania strains.
The “call” column shows the names given by the software to the unknown samples based on names given to the reference samples: L. (L.) infantum chagasi (CHA), L. (L.) amazonensis (AMA), L. (V.) lainsoni (LAI), L. (V.) braziliensis (BRA), L. (V.) guyanensis (GUY), L. (V.) naiffi (NAI) and L. (V.) shawi (SHA). Each condition was tested in duplicate in three independent experiments.
| Leishmania strain / ID | Call | Efficiency (%) |
|---|---|---|
| L. (L.) infantum chagasi / MHOM/BR/74/M2682 | CHA | 67.88 |
| L. (L.) amazonensis / MPHI/BR/99/M12275 | AMA | 83.35 |
| L. (V.) lainsoni / IUBI/BR/91/M13469 | LAI | 73.72 |
| L. (V.) braziliensis / MHOM/BR/2001/M19675 | BRA | 85.47 |
| L. (V.) braziliensis / MHOM/BR/96/M15923 | BRA | 81.12 |
| L. (V.) guyanensis / MHOM/BR/2001/M19869 | GUY | 78.73 |
| L. (V.) naiffi / MDAS/BR/82/M6934 | NAI | 87.75 |
| L. (V.) shawi / MHOM/BR/2001/M19670 | SHA | 91.10 |
| L. (V.) shawi / MHOM/BR/2001/M19664 | SHA | 87.90 |
| L. (V.) shawi / MHOM/BR/1990/M19703 | SHA | 88.10 |
The intra-specific variability was further assessed by the in silico analysis of polymorphism of 186 hsp70 entries from L. (L.) tropica, L. (L.) donovani, L. (L.) infantum, L. (L.) major, L. (L.) amazonensis, L. (L.) mexicana, L. (V.) lainsoni, L. (V.) braziliensis, L. (V.) guyanensis, L. (V.) naiffi, L. (V.) shawi, L. (V.) peruviana, L. (V.) panamensis, L. (L.) aethiopica, L. (L.) martiniquensis and L. siamensis. All the sequences were aligned to include the regions of amplicons 1 and 2. The aligned sequences were then examined for polymorphisms among species as well as among strains of the same species. We then calculated the percentage of similarity and estimated the theoretical Tm value of both amplicons (S1 Table). If we assume that the nucleotide differences that we detected are real polymorphisms and not sequencing errors then we can see from S1 Table that the differences in the theoretical Tm values of each species results in the same discriminatory pattern. Of the 186 strains analyzed, only two strains of L. infantum, MCAN/IR/96/LON-49 and LEM75/zymodeme1, presented a theoretical Tm value whose difference was higher than 0.3°C. We cannot rule out the possibilities that this difference is in fact a real one, due to sequencing errors or reflects different taxa.
In the absence of bona fide samples we also determined the theoretical Tm of amplicons 1 and 2 (S1 Table) of two Leishmania species found in America, L. (V.) peruviana and L. (V.) panamensis, that occur outside Brazil. The obtained data indicated that these two species could be differentiated from the others L. (Viannia) species by the coupled HRM analysis of the two amplicons.
The theoretical Tm value of the African L. (L.) aethiopica, potentially allowed the discrimination from L. (L.) donovani, L. (L.) infantum and L. (L.) major, but not from L. (L.) tropica (S1 Table). The enriettii complex members L. (L.) martiniquensis and L. siamensis presented identical theoretical Tm values.
To validate the HRM protocol for different types of sample preparations, sixteen DNA obtained from real biological samples, like fresh tissue from hamster inoculated with infected sample from human or dog cases; cell culture of the human isolated strain; human fresh tissue; human paraffin-embedded tissue; tissues from experimentally infected BALB/c mice and naturally infected phlebotomines, that had been previously tested in our laboratory by sequencing of SSU rDNA [20] or by discriminatory PCR targeting g6pd [21], were submitted to HRM analysis. The results obtained presented a correlation with the results obtained with the other targets (Table 4).
Table 4. Identification of Leishmania in clinical and experimentally infected and field samples by the HRM analysis targeting hsp70 gene.
The hsp70 amplicons 1 or 2 of DNA from each sample were submitted to the HRM analysis. The results were compared with a previous identification performed by SSU rDNA sequencing [17] or g6pd PCR [18]. (a) fresh tissue from hamster inoculated with infected sample; (b) cell culture of the human isolated strain; (c) human fresh tissue; (d) human paraffin-embedded tissue; (e) experimentally infected BALB/c mice; (f) naturally infected Lutzomyia (Lutzomyia) longipalpis; and (g) naturally infected Lu. (Nyssomyia) whitmani; (N/A): not applicable.
| Sample Source | HRM Identification | Previous Diagnosis | Method | |
|---|---|---|---|---|
| Amplicon 1 | Amplicon 2 | |||
| Humana | L. (V.) braziliensis | L. (V.) braziliensis | L. (Viannia) sp. | SSU + seq |
| Humana | L. (V.) braziliensis | L. (V.) braziliensis | L. (Viannia) sp. | SSU + seq |
| Humana | L. (V.) braziliensis | L. (V.) braziliensis | L. (Viannia) sp. | SSU + seq |
| Humana | L. (V.) braziliensis | L. (V.) braziliensis | L. (V.) braziliensis | g6pd PCR |
| Humanb | L. (V.) braziliensis | L. (V.) braziliensis | L. (V.) braziliensis | g6pd PCR |
| Humanb | L. (V.) braziliensis | L. (V.) braziliensis | L. (V.) braziliensis | g6pd PCR |
| Humanb | L. (V.) braziliensis | L. (V.) braziliensis | L. (V.) braziliensis | g6pd PCR |
| Humanc | L. (V.) braziliensis | L. (V.) braziliensis | L. (V.) braziliensis | g6pd PCR |
| Humand | L. (V.) braziliensis | L. (V.) braziliensis | L. (Viannia) sp. | SSU + seq |
| Caninea | L. (V.) braziliensis | L. (V.) braziliensis | L. (Viannia) sp. | SSU + seq |
| Caninea | L. (L.) infantum chagasi | N/A | L. (L.) infantum chagasi | SSU + seq |
| Mousee | L. (L.) amazonensis | N/A | L. (L.) amazonensis | SSU + seq |
| Mousee | L. (L.) amazonensis | N/A | L. (L.) amazonensis | SSU + seq |
| Mousee | L. (V.) braziliensis | L. (V.) braziliensis | L. (V.) braziliensis | g6pd PCR |
| Phlebotominef | L. (L.) infantum chagasi | N/A | L. (L.) infantum chagasi | SSU + seq |
| Phlebotomineg | L. (V.) braziliensis | L. (V.) braziliensis | L. (V.) braziliensis | g6pd PCR |
Discussion
The establishment of optimized protocols for the detection and identification of the aetiological agents of Leishmaniases are extremely useful tools in a clinical context. Identifying the species can lead to species-specific treatment protocols to promote a better efficacy of treatment, assessing the need for patient follow up as well as the development and understanding of the mode of action of potential new drugs.
Several methodologies targeting different genomic or mitochondrial DNA have been described in the past 20 years, and PCR is currently the preferred method in studies involving the detection and identification of Leishmania. These methodologies have been developed by designing primers that exploit species-specific sequence polymorphisms in different targets, such as kDNA [22], the SSU rDNA gene [20, 23], the glucose-6-phosphate dehydrogenase gene (g6pd) [21, 24], rDNA internal transcribed spacers (ITSs) [25], hsp70 [13–17] and cysteine proteinase B gene (cpb) [7, 26]. However, none of these methods represents a gold standard because the targeted polymorphisms were unsuitable for simple and direct identification protocols. These PCR analyses involved the use of multiple targets requiring a combination of several primers creating the need of running more than one reaction to identify a single sample. The multiplex PCR that uses several pair of primers in one reaction and restriction fragment length polymorphism analysis (RFLP) of PCR products both need of a subsequent DNA fractionation by gel electrophoresis. These procedures require experienced operators to interpret the results, besides the risk of laboratory contamination with amplicons, due to the manipulation of PCR product.
Another way to exploit DNA polymorphisms is the determination of the C+G composition of PCR products from conserved regions by calculating the Tm of the amplicon in a melting curve. HRM methodology has been successfully used for Leishmania identification using different targets, such as the 7SL RNA gene that discriminated L. tropica, L. major and species that cause visceral Leishmaniases in clinical samples [5, 6]. Additionally, using the same target, researchers determined that rodent Ctenodactylus gundi is a potential host of L. tropica in Tunisia [5]. Polymorphisms on haspb (Hydrophilic Acylated Surface Protein B gene) analyzed by HRM allowed the differentiation of strains of L. (L.) donovani from distinct regions of East Africa [7]. In Southeastern Iran, the rRNA ITS sequence incriminated Phebotomus sergenti as a natural vector of L. (L.) tropica [10], or the discrimination between L. (L.) tropica and L. (L.) infantum in Turkey [9]. HRM analysis of the ITS-1 rRNA region discriminated L. (L.) major, L. (.L) tropica, L. (L.) aethiopica and L. (L.) infantum in samples from Middle East, Asia, Africa and Europe [8]. The combination of two targets, hsp70 and the rRNA ITS1 sequence, using the absolute HRM values allowed for the discrimination of six American Leishmania species [11] and MPI/6PGD-FRET PCR distinguished L. (V.) braziliensis from L. (V.) peruviana [12].
Here, we described an algorithm using HRM methodology for the rapid detection and discrimination of Leishmania species circulating in Brazil and Eurasia/Africa (Fig 6). We used the sequence coding for hsp70, but in order to obtain a discriminatory PCR product, we designed the primers to encompass a region that was no larger than 144 bp and that had relevant polymorphisms for HRM analysis, that is, shifts of AT base pairs to CG or vice-versa. Moreover, to be effective, the total amount of polymorphisms was taken into account, and compensatory changes were avoided. Using these criteria, we obtained two PCR products: amplicon 1 and amplicon 2. Using the algorithm described in Fig 6, the analysis of the produced melting profiles of amplicon 1 for the Brazilian species allowed for the discrimination of L. (L.) i. chagasi, L. (L.) amazonensis/L. (L.) mexicana/L. (V.) lainsoni, L. (V.) braziliensis/L (V.) guyanensis, L. (V.) naiffi and L. (V.) shawi using differences in the Tm of at least 0.3°C. For Eurasian samples, amplicon 1 produced values with the same 0.3°C interval to discriminate L. (L.) tropica from L. (L.) major and from L. (L.) donovani/L (L.) infantum, but these two species cannot be discriminated from each other (Fig 2).
Fig 6. Schematic algorithm representation for Leishmania identification in Brazilian or Eurasian/African samples.
Purified DNA was submitted to hsp70 PCR to produce amplicon 1. The melting analysis of hsp70 amplicon 1 for American samples discriminates L. (L.) infantum chagasi, L. (V.) naiffi and L. (V.) shawi. The grouping of L. (V.) braziliensis/L. (V.) guyanensis can be discriminated by producing hsp70 PCR amplicon 2. Amplicon 2 also resolve the grouping L. (L.) amazonensis/L. (L.) mexicana/L. (V.) lainsoni, which is positive for L. (V.) lainsoni, or by sequencing hsp70 PCR amplicon 1 to discriminate between L. (L.) amazonensis and L. (L.) mexicana. For Eurasian/African samples, the melting analysis of hsp70 amplicon 1 discriminates L. (L.) tropica, L. (L.) major and the L. (L.) donovani/L (L.) infantum group, which can be solved by cpb PCR [7].
The occurrence of an overlap in the Tm value for the Brazilian species L. (L.) amazonensis and L. (L.) lainsoni after a positive reaction of amplicon 1 can be solved by a positive reaction of amplicon 2. This amplicon sequence is specific for Leishmania (Viannia) species, so L. (L.) amazonensis will not be amplified and L. (V.) lainsoni will present the corresponding Tm value (Fig 5). The occurrence of an overlap in the Tm value for the American species L. (L.) amazonensis and L. (L.) mexicana can be solved by amplicon 1 sequencing because this amplicon is not identical, but there are two mismatches (position 82 A to G and position 100 G to T in L. (L.) amazonensis and L. (L.) mexicana, respectively (Fig 1), that are compensatory in the melting profile. It is interesting to note that these two species are very closely related. Uliana et al. [23] distinguished L. (L.) amazonensis from L. (L.) mexicana by SSU rDNA, but Castilho et al. [21] also failed to distinguish these species by g6pd because the region of the g6pd sequence that was used is identical in the two species. It is also interesting that Hernandez et al. [11], using a larger amplicon (337 bp) of hsp70, succeeded in differentiating L. (L.) mexicana from L. (L.) amazonensis; however, Fraga et al. [13] failed to distinguish these two species using RFLP in another region of hsp70. However, when the complete nucleotide sequence of the hsp70 PCR fragment of 1268 bp is used, the discrimination between the two species can be achieved [27]. These problems once again emphasize that one gene or a particular sequence of a gene is not reliable to define a species or plot its phylogeny. Recently, Real et al. [28] showed that L. (L.) mexicana and L. (L.) major had, respectively, 5 and 7 species-specific orthologous gene families, while L. (L.) amazonensis had 23 different gene families. Moreover, the geographical parameter can also be used; Uliana et al. used SSU rDNA polymorphism to show that these species present a characteristic distribution in Latin America that correlates to monoclonal antibody profiles [29].
The Tm overlap for Eurasian species occurred for L. (L.) donovani and L. (L.) infantum, which presented identical sequences for amplicon 1. Again, the geographical origin of the sample can be used because L. (L.) donovani is more frequently found in India and East Africa and presents anthroponotic behavior. L. (L.) infantum is found in Africa, China and the Mediterranean and shows zoonotic behavior [30]. However, the two species can be discriminated by multilocus enzyme electrophoresis (MLEE) or multilocus microsatellite typing (MLMT) [30]. Recently, the haspb coding region was initially used in a classical PCR coupled to RFLP [31], while the gene coding for cpb was used as a target in conventional PCR [7]. We propose to use the latter in case of doubt between the two species (Fig 6).
The in silico analysis of amplicon 1 and 2 from other Leishmania species from America or from Eurasia/Africa, also indicated the potentiality of the hsp70 HRM protocol to discriminate L. (V.) peruviana, L. (V.) panamensis and L. (L.) aethiopica/ L. (L.) martiniquensis/L. siamensis from L. (L.) donovani and L. (L.) major but not from L. (L.) tropica. It is interesting to note that the ITS-HRM analysis applied to L. (L.) tropica L. (L.) aethiopica, L. (L.) infantum, L. (L.) major and L. (L.) donovani [8] presented exactly the same degree of resolution of the hsp70 HRM described here.
We also noticed that the initial amount of template DNA influenced the Tm determination (Fig 4). This Tm variation could be important in cases where the Tm values are in the same range and can lead to a misidentification if the reference sample is at a different concentration. This is the case for L. (L.) amazonensis and L. (L.) lainsoni. However, as has been previously explained, the use of hsp70 amplicon 2 allowed for the discrimination between these two species. The two other species that presented an overlapping Tm range depending on the initial amount of DNA were L. (V.) braziliensis and L. (V.) guyanensis, which could be discriminated by the use of an HRM analysis on the same amplicon 2.
In fact, when we applied the protocol described here to other Leishmania isolates, the obtained “call” (the identification of the problem sample in relation to the reference samples) presented a 100% correlation with the reference strains (Table 3).
The test of sixteen samples consisting of fresh hamster tissue from animals injected with human or dog biopsy macerates, fresh or paraffin embedded human biopsies, tissues of experimentally infected BALB/c mice or even naturally infected phebotominae, produced identification “calls” comparable to the identification results using SSU rDNA sequencing or g6pd PCR (Table 4), showing that the source of the sample as well as its conservation do not interfere in the HRM protocol. Moreover, the use of HRM protocol is easier than the use of SSU rDNA and/or g6pd PCR, since those methods require either sequencing of the product or three or more distinct PCRs followed by gel electrophoresis analysis.
Overall, the hsp70 HRM protocol described herein accurately and sensitively identified Leishmania species that are important in the majority of cases of Leishmaniases in the Brazil and Eurasia. The test is simple and rapid, and its use in the clinic or in research samples has many advantages, such as a lower total cost for the identification of a sample and other characteristics that facilitate its application. There is no need for sequencing or gel fractionation to analyze the product, thus avoiding laboratory contamination with PCR products because these products are discarded without being manipulated. It also reduces the need for trained personnel to analyze the fractionation profile of an electrophoretic gel or sequencing data to provide a result. Also the HRM assay presents a possibility of quantifying parasites present in samples because it is a real-time PCR-based technique. Moreover, the whole process can be automated because the analyzer software will produce the “call” result by comparing the tested samples to the reference sample identities, which must always be included in the reactions.
In conclusion, the protocol described herein is a low cost, reliable, easy to apply, potentially automated procedure that is a good alternative for the detection, quantification and identification of Leishmania species in biological and clinical samples.
Supporting Information
The underlined sequences indicate the position of the primers used in real-time PCR assays; the grey boxed nucleotides represent the mutation points found among reference strains of Leishmania. The black boxed nucleotides represent mismatches that prevent the annealing of oligonucleotide hsp70F1 to the L. (Leishmania) spp. complementary sequence.
(TIFF)
hsp70 amplicons 1 (A) and hsp70 amplicons 2 (B) were fractioned by electrophoresis in 1.5% agarose gel and stained with ethidium bromide. DNA from reference strains of Leishmania are named as follows: (Lt): L. (L.) tropica; (Ld): L. (L.) donovani; (Lc): L. (L.) infantum chagasi; (Lj): L. (L.) major; (La): L. (L.) amazonensis; (Lx): L. (L.) mexicana; (Ll): L. (V.) lainsoni; (Lb): L. (V.) braziliensis; (Lg): L. (V.) guyanensis; (Ln): L. (V.) naiffi and (Ls): L. (V.) shawi. (L): 100 bp DNA ladder and (ntc): no template control, without DNA.
(TIFF)
Standard curves were constructed with recombinant plasmids containing amplicon 1 sequence from L. (L.) amazonensis (A), L. (L.) infantum chagasi (B), L. (V.) guyanensis (C) and L. (V.) lainsoni (D). The assays used as a template underwent a 10-fold serial dilution representing 1 x 106 to 1 x 101 plasmid copies per reaction and were performed in duplicate.
(TIFF)
Representative melting profiles of hsp70 amplicon 1 obtained from the genomic DNA of T. cruzi and T. brucei. (A): Normalized melting curves; (B): normalized difference curves and (C): dispersion graph of individual plots from T. cruzi (Tc) and T. brucei (Tb) compared to L. (L.) tropica (Lt).
(TIFF)
The hsp70 regions compassing amplicon 1 or amplicon 2 were retrieved from GenBank Database [32] using the sentence “heat shock protein 70 kDa” as descriptor words in “search” field. The obtained sequences were formatted as FASTA files and aligned on BioEdit Sequence Alignment Editor v.7.1.8 [33]. The identity indexes were obtained by pairwise alignments on BioEdit software. Only sequences encompassing the whole amplicon were analyzed. Theoretical melting temperatures of hypothetic amplicons were calculated using OligoCalc oligonucleotide properties on-line calculator [34].
(DOCX)
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
This work was funded by: Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) www.fapesp.br; and Conselho Nacional para o Desenvolvimento Científico e Tecnológico (CNPq) www.cnpq.br. The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.
References
- 1.Alvar J, Velez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. Leishmaniasis worldwide and global estimates of its incidence. PLoS One. 2012;7(5):e35671 10.1371/journal.pone.0035671 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.World Health O. Control of the leishmaniases. World Health Organization technical report series. 2010(949):xii-xiii, 1–186, back cover. [PubMed] [Google Scholar]
- 3.Desjeux P. Leishmaniasis: current situation and new perspectives. Comparative immunology, microbiology and infectious diseases. 2004;27(5):305–18. [DOI] [PubMed] [Google Scholar]
- 4.Reithinger R, Dujardin JC. Molecular diagnosis of leishmaniasis: Current status and future applications. J Clin Microbiol. 2007;45(1):21–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bousslimi N, Ben-Ayed S, Ben-Abda I, Aoun K, Bouratbine A. Natural Infection of North African Gundi (Ctenodactylus gundi) by Leishmania tropica in the Focus of Cutaneous Leishmaniasis, Southeast Tunisia. American Journal of Tropical Medicine and Hygiene. 2012;86(6):962–5. 10.4269/ajtmh.2012.11-0572 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Nasereddin A, Jaffe CL. Rapid Diagnosis of Old World Leishmaniasis by High-Resolution Melting Analysis of the 7SL RNA Gene. J Clin Microbiol. 2010;48(6):2240–2. 10.1128/JCM.00553-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Zackay A, Nasereddin A, Takele Y, Tadesse D, Hailu W, Hurissa Z, et al. Polymorphism in the HASPB Repeat Region of East African Leishmania donovani Strains. PLoS neglected tropical diseases. 2013;7(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Talmi-Frank D, Nasereddin A, Schnur LF, Schonian G, Toz SO, Jaffe CL, et al. Detection and Identification of Old World Leishmania by High Resolution Melt Analysis. PLoS neglected tropical diseases. 2010;4(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Toz SO, Culha G, Zeyrek FY, Ertabaklar H, Alkan MZ, Vardarli AT, et al. A real-time ITS1-PCR based method in the diagnosis and species identification of Leishmania parasite from human and dog clinical samples in Turkey. PLoS neglected tropical diseases. 2013;7(5):e2205 10.1371/journal.pntd.0002205 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Aghaei AA, Rassi Y, Sharifi I, Vatandoost H, Mollaie H, Oshaghi MA, et al. First report on natural Leishmania infection of Phlebotomus sergenti due Leishmania tropica by high resolution melting curve method in South-eastern Iran. Asian Pacific journal of tropical medicine. 2014;7(2):93–6. 10.1016/S1995-7645(14)60002-X [DOI] [PubMed] [Google Scholar]
- 11.Hernandez C, Alvarez C, Gonzalez C, Ayala MS, Leon CM, Ramirez JD. Identification of Six New World Leishmania species through the implementation of a High-Resolution Melting (HRM) genotyping assay. Parasites & vectors. 2014;7:501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Tsukayama P, Nunez JH, De Los Santos M, Soberon V, Lucas CM, Matlashewski G, et al. A FRET-based real-time PCR assay to identify the main causal agents of New World tegumentary leishmaniasis. PLoS neglected tropical diseases. 2013;7(1):e1956 10.1371/journal.pntd.0001956 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Fraga J, Montalvo AM, De Doncker S, Dujardin JC, Van der Auwera G. Phylogeny of Leishmania species based on the heat-shock protein 70 gene. Infection, genetics and evolution: journal of molecular epidemiology and evolutionary genetics in infectious diseases. 2010;10(2):238–45. 10.1016/j.meegid.2009.11.007 [DOI] [PubMed] [Google Scholar]
- 14.Montalvo AM, Fraga J, Monzote L, Montano I, De Doncker S, Dujardin JC, et al. Heat-shock protein 70 PCR-RFLP: a universal simple tool for Leishmania species discrimination in the New and Old World. Parasitology. 2010;137(8):1159–68. 10.1017/S0031182010000089 [DOI] [PubMed] [Google Scholar]
- 15.Garcia L, Kindt A, Bermudez H, Llanos-Cuentas A, De Doncker S, Arevalo J, et al. Culture-independent species typing of neotropical Leishmania for clinical validation of a PCR-based assay targeting heat shock protein 70 genes. J Clin Microbiol. 2004;42(5):2294–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Montalvo AM, Fraga J, Maes I, Dujardin JC, Van der Auwera G. Three new sensitive and specific heat-shock protein 70 PCRs for global Leishmania species identification. European journal of clinical microbiology & infectious diseases: official publication of the European Society of Clinical Microbiology. 2012;31(7):1453–61. [DOI] [PubMed] [Google Scholar]
- 17.Graça GC, Volpini AC, Romero GA, Oliveira Neto MP, Hueb M, Porrozzi R, et al. Development and validation of PCR-based assays for diagnosis of American cutaneous leishmaniasis and identification of the parasite species. Mem Inst Oswaldo Cruz. 2012;107(5):664–74. [DOI] [PubMed] [Google Scholar]
- 18.Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic acids research. 1988;16(3):1215 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.de Lima AC, Zampieri RA, Tomokane TY, Laurenti MD, Silveira FT, Corbett CE, et al. Leishmania sp. identification by PCR associated with sequencing of target SSU rDNA in paraffin-embedded skin samples stored for more than 30 years. Parasitology research. 2011;108(6):1525–31. 10.1007/s00436-010-2208-0 [DOI] [PubMed] [Google Scholar]
- 20.Uliana SR, Nelson K, Beverley SM, Camargo EP, Floeter-Winter LM. Discrimination amongst Leishmania by polymerase chain reaction and hybridization with small subunit ribosomal DNA derived oligonucleotides. The Journal of eukaryotic microbiology. 1994;41(4):324–30. [DOI] [PubMed] [Google Scholar]
- 21.Castilho TM, Shaw JJ, Floeter-Winter LM. New PCR assay using glucose-6-phosphate dehydrogenase for identification of Leishmania species. J Clin Microbiol. 2003;41(2):540–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lopez M, Inga R, Cangalaya M, Echevarria J, Llanos-Cuentas A, Orrego C, et al. Diagnosis of Leishmania using the polymerase chain reaction: a simplified procedure for field work. The American journal of tropical medicine and hygiene. 1993;49(3):348–56. [DOI] [PubMed] [Google Scholar]
- 23.Uliana SR, Affonso MH, Camargo EP, Floeter-Winter LM. Leishmania: genus identification based on a specific sequence of the 18S ribosomal RNA sequence. Experimental parasitology. 1991;72(2):157–63. [DOI] [PubMed] [Google Scholar]
- 24.Castilho TM, Camargo LM, McMahon-Pratt D, Shaw JJ, Floeter-Winter LM. A real-time polymerase chain reaction assay for the identification and quantification of American Leishmania species on the basis of glucose-6-phosphate dehydrogenase. The American journal of tropical medicine and hygiene. 2008;78(1):122–32. [PubMed] [Google Scholar]
- 25.Cupolillo E, Grimaldi Junior G, Momen H, Beverley SM. Intergenic region typing (IRT): a rapid molecular approach to the characterization and evolution of Leishmania. Molecular and biochemical parasitology. 1995;73(1–2):145–55. [DOI] [PubMed] [Google Scholar]
- 26.Quispe Tintaya KW, Ying X, Dedet JP, Rijal S, De Bolle X, Dujardin JC. Antigen genes for molecular epidemiology of leishmaniasis: polymorphism of cysteine proteinase B and surface metalloprotease glycoprotein 63 in the Leishmania donovani complex. The Journal of infectious diseases. 2004;189(6):1035–43. [DOI] [PubMed] [Google Scholar]
- 27.Van der Auwera G, Ravel C, Verweij JJ, Bart A, Schonian G, Felger I. Evaluation of four single-locus markers for Leishmania species discrimination by sequencing. J Clin Microbiol. 2014;52(4):1098–104. 10.1128/JCM.02936-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Real F, Vidal RO, Carazzolle MF, Mondego JM, Costa GG, Herai RH, et al. The genome sequence of Leishmania (Leishmania) amazonensis: functional annotation and extended analysis of gene models. DNA research: an international journal for rapid publication of reports on genes and genomes. 2013;20(6):567–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Uliana SR, Ishikawa E, Stempliuk VA, de Souza A, Shaw JJ, Floeter-Winter LM. Geographical distribution of neotropical Leishmania of the subgenus Leishmania analysed by ribosomal oligonucleotide probes. Trans R Soc Trop Med Hyg. 2000;94(3):261–4. [DOI] [PubMed] [Google Scholar]
- 30.Pratlong F, Lami P, Ravel C, Balard Y, Dereure J, Serres G, et al. Geographical distribution and epidemiological features of Old World Leishmania infantum and Leishmania donovani foci, based on the isoenzyme analysis of 2277 strains. Parasitology. 2013;140(4):423–34. 10.1017/S0031182012001825 [DOI] [PubMed] [Google Scholar]
- 31.Haralambous C, Antoniou M, Pratlong F, Dedet JP, Soteriadou K. Development of a molecular assay specific for the Leishmania donovani complex that discriminates L. donovani/Leishmania infantum zymodemes: a useful tool for typing MON-1. Diagnostic microbiology and infectious disease. 2008;60(1):33–42. [DOI] [PubMed] [Google Scholar]
- 32.Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW. GenBank. Nucleic Acids Res. 2013. January;41 (Database issue):D36–42. 10.1093/nar/gks1195 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Hall TA 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41:95–98. [Google Scholar]
- 34.Kibbe W.A. 'OligoCalc: an online oligonucleotide properties calculator'. (2007)Nucleic Acids Res. 35 (webserver issue): May 25. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
The underlined sequences indicate the position of the primers used in real-time PCR assays; the grey boxed nucleotides represent the mutation points found among reference strains of Leishmania. The black boxed nucleotides represent mismatches that prevent the annealing of oligonucleotide hsp70F1 to the L. (Leishmania) spp. complementary sequence.
(TIFF)
hsp70 amplicons 1 (A) and hsp70 amplicons 2 (B) were fractioned by electrophoresis in 1.5% agarose gel and stained with ethidium bromide. DNA from reference strains of Leishmania are named as follows: (Lt): L. (L.) tropica; (Ld): L. (L.) donovani; (Lc): L. (L.) infantum chagasi; (Lj): L. (L.) major; (La): L. (L.) amazonensis; (Lx): L. (L.) mexicana; (Ll): L. (V.) lainsoni; (Lb): L. (V.) braziliensis; (Lg): L. (V.) guyanensis; (Ln): L. (V.) naiffi and (Ls): L. (V.) shawi. (L): 100 bp DNA ladder and (ntc): no template control, without DNA.
(TIFF)
Standard curves were constructed with recombinant plasmids containing amplicon 1 sequence from L. (L.) amazonensis (A), L. (L.) infantum chagasi (B), L. (V.) guyanensis (C) and L. (V.) lainsoni (D). The assays used as a template underwent a 10-fold serial dilution representing 1 x 106 to 1 x 101 plasmid copies per reaction and were performed in duplicate.
(TIFF)
Representative melting profiles of hsp70 amplicon 1 obtained from the genomic DNA of T. cruzi and T. brucei. (A): Normalized melting curves; (B): normalized difference curves and (C): dispersion graph of individual plots from T. cruzi (Tc) and T. brucei (Tb) compared to L. (L.) tropica (Lt).
(TIFF)
The hsp70 regions compassing amplicon 1 or amplicon 2 were retrieved from GenBank Database [32] using the sentence “heat shock protein 70 kDa” as descriptor words in “search” field. The obtained sequences were formatted as FASTA files and aligned on BioEdit Sequence Alignment Editor v.7.1.8 [33]. The identity indexes were obtained by pairwise alignments on BioEdit software. Only sequences encompassing the whole amplicon were analyzed. Theoretical melting temperatures of hypothetic amplicons were calculated using OligoCalc oligonucleotide properties on-line calculator [34].
(DOCX)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.