Human placental renin–angiotensin system in normotensive and pre‐eclamptic pregnancies at high altitude and after acute hypoxia–reoxygenation insult

Key points

• The development of the human placenta occurs in a low oxygen environment which stimulates angiogenesis and vascularization.

• Placental expression of the renin angiotensin system (RAS) is highest in early pregnancy. Although both the RAS and oxygen stimulate angiogenesis, it is not known how they interact during placental development.

• Pre‐eclampsia (PE), a condition characterized by poor placental development and elevated oxidative stress has increased incidence in populations living at high altitude and thus exposed to hypobaric hypoxia.

• This study aimed to investigate the effects of various forms of oxidative stress on the placental RAS.

• The results suggest that the placental RAS is activated by oxidative insults but the component type and the degree of activation is dependent on the nature of the insult.

Abstract

A functioning placental renin–angiotensin system (RAS) appears necessary for uncomplicated pregnancy and is present during placentation, which occurs under low oxygen tensions. Placental RAS is increased in pre‐eclampsia (PE), characterised by placental dysfunction and elevated oxidative stress. We investigated the effect of high altitude hypoxia on the RAS and hypoxia‐inducible factors (HIFs) by measuring mRNA and protein expression in term placentae from normotensive (NT) and PE women who delivered at sea level or above 3100 m, using an explant model of hypoxia–reoxygenation to assess the impact of acute oxidative stress on the RAS and HIFs. Protein levels of prorenin (P = 0.049), prorenin receptor (PRR; P = 0.0004), and angiotensin type 1 receptor (AT1R, P = 0.006) and type 2 receptor (AT2R, P = 0.002) were all significantly higher in placentae from NT women at altitude, despite mRNA expression being unaffected. However, mRNA expression of all RAS components was significantly lower in PE at altitude than at sea level, yet PRR, angiotensinogen (AGT) and AT1R proteins were all increased. The increase in transcript and protein expression of all the HIFs and NADPH oxidase 4 seen in PE compared to NT at sea level was blunted at high altitude. Experimentally induced oxidative stress stimulated AGT mRNA (P = 0.04) and protein (P = 0.025). AT1R (r = 0.77, P < 0.001) and AT2R (r = 0.81, P < 0.001) mRNA both significantly correlated with HIF‐1β, whilst AT2R also correlated with HIF‐1α (r = 0.512, P < 0.013). Our observations suggest that the placental RAS is responsive to changes in tissue oxygenation: this could be important in the interplay between reactive oxygen species as cell‐signalling molecules for angiogenesis and hence placental development and function.

Key points

• The development of the human placenta occurs in a low oxygen environment which stimulates angiogenesis and vascularization.

• Placental expression of the renin angiotensin system (RAS) is highest in early pregnancy. Although both the RAS and oxygen stimulate angiogenesis, it is not known how they interact during placental development.

• Pre‐eclampsia (PE), a condition characterized by poor placental development and elevated oxidative stress has increased incidence in populations living at high altitude and thus exposed to hypobaric hypoxia.

• This study aimed to investigate the effects of various forms of oxidative stress on the placental RAS.

• The results suggest that the placental RAS is activated by oxidative insults but the component type and the degree of activation is dependent on the nature of the insult.

Abbreviations

AGT

angiotensinogen

Ang II

angiotensin II

Ang IV

angiotensin IV

Ang (1–7)

angiotensin‐(1–7)

AT1R

angiotensin type 1 receptor

AT2R

angiotensin type 2 receptor

B2M

beta‐2‐microglobulin

HA

high altitude

HIF

hypoxia‐inducible factor

H/R

hypoxia‐reperfusion

NOX4

NADPH oxidase 4

NT

normotensive

PE

pre‐eclampsia

PHD

prolyl hydroxylase

PRR

prorenin receptor

RAS

renin–angiotensin system

ROS

reactive oxygen species

XO

xanthine oxidase

Introduction

In the early 20th century, Sir Joseph Barcroft famously postulated that the fetus may be considered as ‘Everest in utero’ because of its development in a hypoxic environment equivalent to that probably only experienced at the Earth's highest point – the summit of Mount Everest (Barcroft, 1946).

The transition from acute hypoxia to hypoxic adaptation may involve the renin–angiotensin system (RAS), which has been known as a regulator of systemic blood pressure and vascular function for many decades (reviewed in Nguyen Dinh Cat & Touyz, 2011; Farag et al. 2015). The systemic RAS in male adults is activated by acute exposure to high altitude (Sun et al. 2013) whereas exposure to chronic hypoxia in rat models of primary hypertension causes the RAS to be suppressed (Cervenka et al. 2015).

The RAS may play a significant role not only in differing ways throughout pregnancy but also in the early stages of placentation. Components such as the angiotensin receptors are expressed at very early stages of embryogenesis (Tebbs et al. 1999; Pijacka et al. 2012) and in the placental syncytiotrophoblast and cytotrophoblast (Williams et al. 2010), where they may be responding to maternally derived angiotensin II (Ang II). Both Ang II and the biologically active fragment angiotensin IV (3–8) (Ang IV) promote the invasion and proliferation of trophoblasts (Williams et al. 2010) and angiogenesis in placental tissue, thus supporting the establishment of a placental vasculature. Development of the yolk sac placenta in explanted rat embryos is highly significantly increased by Ang II (Tebbs et al. 1999). Prorenin and angiotensinogen (AGT) proteins are detected in the syncytiotrophoblast and cytotrophoblasts as early as 6 weeks’ gestation (Marques et al. 2011; Pringle et al. 2011) with prorenin also being found in the extravillous trophoblasts and AGT in the villous stroma.

Detailed knowledge on the process of implantation in humans is scarce. One fact is unequivocal: trophoblast invasion clearly correlates with oxygenation of the placenta (Huppertz et al. 2014). Initial reorganisation of the syncytiotrophoblast layer and proliferation of the underlying cytotrophoblasts occurs in the first 5 weeks after implantation under oxygen tensions below 20 mmHg (Rodesch et al. 1992; Jauniaux et al. 2000; Jauniaux et al. 2001). These oxygen tensions in other tissues would be considered ‘hypoxic’ but are physiologically normal for establishment of the placenta (Cindrova‐Davies et al. 2015). The oxygen tension in the underlying decidua basalis at this time is ∼60 mmHg, and so the extravillous trophoblast invasion occurs along an oxygen gradient. Indirect measurements of oxygen tension, using aspirates in the intervillous space, indicate that in the second half of normal pregnancy oxygen tensions decline, from 60 mmHg at 18 weeks’ gestation to 30–40 mmHg at term (Soothill et al. 1986).

In normal pregnancy, placental growth is stimulated by a number of factors including adenosine, which promotes angiogenesis, proliferation, inflammation and protection against oxidative stress (Hasko & Cronstein, 2004). We have previously established that there is a strong positive association between the RAS and adenosine in first trimester placental tissue (Kurlak et al. 2015) when oxygen tensions are low (Rodesch et al. 1992; Jauniaux et al. 2001). The stimulation of adenosine is a response to hypoxia (Poth et al. 2013) and therefore unsurprisingly placental adenosine A2A receptor strongly correlates with HIF‐1α (Kurlak et al. 2015). Is the RAS acting as a signal transduction regulator for both oxygen sensing and angiogenesis? In other cell systems, such as human fibroblasts, co‐operativity between hypoxia‐ and angiotensin‐induced proliferative responses has already been observed (Krick et al. 2005), but a relationship between the RAS and the low oxygen environment in the placenta has not yet been investigated.

The RAS has also been well researched in the context of hypertensive disorders of pregnancy such as pre‐eclampsia (PE) (Symonds et al. 1975; Irani & Xia, 2011), which is defined as de novo hypertension after 20 weeks’ gestation with significant proteinuria (Brown et al. 2001; Tranquilli et al. 2013). It has previously been suggested that in PE, the placental tissue is more hypoxic than in normotensive pregnancy. Since there are no direct measurements of intervillous oxygen tension beyond early second trimester, these assumptions have largely been based on evidence such as upregulation of global gene expression in PE showing similarities to in vitro and in vivo models of placental hypoxia (Soleymanlou et al. 2005) and increases in hypoxia‐inducible factors (HIFs) (Zamudio et al. 2007; Rajakumar et al. 2008). These assumptions are being questioned in light of up‐to‐date evidence (Huppertz et al. 2014), where placental metabolism in PE shows that there is no reduction in energy supplies as would be expected in chronic hypoxia (Bloxam et al. 1987). It has been proposed (Hung & Burton, 2006) that the absolute oxygen concentration in the intervillous space may not be critically important, but rather fluctuations in oxygen tension that may lead to tissue oxidative stress as indicated by rapid degeneration of syncytium (Watson et al. 1998). Sharp rises in oxygen tension within the lobule could induce excessive bursts of production of reactive oxygen species (ROS), which include free radicals such as superoxide anions, nitric oxide and hydroxyl radicals (Hung et al. 2001). Bursts of ROS production that overwhelm local antioxidant defences will result in oxidative stress. PE is characterised by both increased circulatory and increased placental oxidative stress (reviewed in Goulopoulou & Davidge, 2015). There are several sources within the placental tissue that could generate ROS bursts, including mitochondria. These have been proposed as a source of the oxidative stress in PE, as demonstrated by swelling and loss of cristae, increased concentrations of malondialdehyde showing greater potential for lipid peroxidative damage (Wang & Walsh, 1998).

The formation of excessive amounts of free radicals and hence failure of mitochondrial reduction–oxidation balance has been tightly linked to dysregulation in the RAS (Vajapey et al. 2014). One of the main peptides generated from AGT substrate is Ang II, which binds with equal affinity to its type 1 (AT1R) and type 2 (AT2R) receptors (de Gasparo et al. 2000). The binding of Ang II to AT1R activates NADPH oxidase (NOX), which leads to increased generation of cytoplasmic ROS. This Ang II–AT1R–NADPH–ROS signal triggers the opening of mitochondrial potassium (K_ATP) channels and mitochondrial ROS production in a positive feedback loop (Vajapey et al. 2014). The maintenance of ROS balance means that the production of ROS needs to be matched with ROS scavenging mechanisms: Ang II has been implicated not only in activating ROS but also in decreasing the activity of scavenging enzymes (decreasing glutathione peroxidase, superoxide dismutase and catalase), thereby contributing even further to detrimental levels of ROS (Vajapey et al. 2014).

Our group has already suggested a role for RAS components in the establishment of the placenta by demonstrating temporal changes in the Ang II receptors – AT1R, AT2R, AT4R (the receptor for bioactive Ang IV peptide) – through gestation, and a temporal relationship with the pro‐oxidant enzymes – NADPH oxidase isoform (NOX4) and xanthine oxidase (XO) (Williams et al. 2010). Furthermore, the placental RAS is altered in PE with AT1R being more highly expressed in the placenta from women with PE than from normotensive women (Mistry et al. 2013). AT1R expression negatively correlates with infant birthweight and placental glutathione peroxidase 3 protein (Mistry et al. 2013).

Pregnancy at high altitude offers a unique opportunity to investigate the effects of chronic hypoxia on the placenta and PE has an increased incidence at high altitude, being threefold greater in areas above 2500 m (Moore et al. 2011).

On the basis of these considerations, we therefore hypothesised that (i) the placental RAS would be activated by high altitude hypoxia; (ii) that these changes would be magnified in placentae from pre‐eclamptic mothers; and (iii) that oxidative stress induced by hypoxia–reperfusion (H/R) injury might be the activator of the RAS as opposed to hypoxia per se.

We tested this by examining (i) placentae from normotensive women who had delivered at high altitudes compared to those who resided at sea level before and throughout the pregnancy; (ii) placentae from PE pregnancies at altitude compared to women with PE at sea level. In addition, (iii) we cultured term placental tissue explants in vitro under differing conditions of hypoxia and oxidative stress.

Methods

Ethical approval

All samples were collected following provision of informed, written consent conforming to the standards set by the Declaration of Helsinki, and all procedures were approved by the local ethics committee (Hospital Ethics Committee of the Nottingham University Hospitals, University of Colorado Health Sciences Centre (Aurora, CO, USA) and University College Hospital London (London, UK), and the Cambridge Local Research Ethics Committee).

Subjects, selection criteria and sample collection

Normotensive control and PE placentae were collected from women at both sea level and high altitude. PE was stringently defined as per the International Society for the Study of Hypertension in Pregnancy guidelines as a systolic blood pressure of 140 mmHg or more and diastolic pressure (Korotkoff V) of 90 mmHg or more on two occasions after 20 weeks’ gestation in a previously normotensive woman and proteinuria ≥ 300 mg l⁻¹, ≥ 500 mg day⁻¹ or ≥ 2+ on dipstick analysis of midstream urine if a 24 h collection result was not available (Brown et al. 2001). Exclusion criteria included smoking, renal disease, cardiac disease, diabetes, chronic hypertension, pregnancy‐induced hypertension or any other complications of pregnancy, and known risk factors for these conditions. All placentae were from term deliveries, either by elective Caesarean section or vaginal delivery. The high altitude placentae were collected at St Vincent's General Hospital (Leadville, CO, USA; 3100 m) from stable, but recently migrant, populations of European descent. The sea level placentae were collected at the Rosie Hospital (Cambridge, UK) and Nottingham University Hospitals (Nottingham, UK) and University College Hospital (London, UK). By the very nature of the collections, the subject numbers differed in the various parts of the study and will be specified with the results.

Samples were obtained using a systematic random system by which the placenta was divided into five areas (Hung et al. 2001). Two full‐thickness samples were taken from each area, washed in phosphate buffered saline (PBS) to remove blood contamination, snap‐frozen in liquid nitrogen within 10 min of delivery, and maintained at −80°C until further processed. Samples for immunohistochemistry were immediately submersed in formalin to be fixed for 12–24 h. After being treated with 70% ethanol for 24 h, placental samples were further dissected before being embedded in paraffin wax.

Acute hypoxia experiments

Villous samples were taken midway between the chorionic and basal plates, from the periphery of lobules free of visible infarction, calcification, haematoma or tears. After a brief rinse in cold PBS, samples were placed into ice‐cold transport medium (TCS large vessel endothelial cell basal medium; TCS CellWorks, Milton Keynes, UK), containing 2% fetal bovine serum, heparin, hydrocortisone, human epidermal growth factor, human basic fibroblast growth factor, 25 μg ml⁻¹ gentamicin and 50 ng ml⁻¹ amphotericin B, 1 mm vitamin C and 1 mm Trolox) that had been equilibrated with 5% O₂–90% N₂–5% CO₂, as described before (Cindrova‐Davies et al. 2007).

Following transport to the laboratory on ice, placental samples were further dissected into small pieces (about 5 mm in diameter) in ice‐cold culture medium, in a glove box under 10% O₂–85% N₂–5% CO₂. Samples were cultured on individual Costar Netwell (24 mm diameter, 500 μm mesh) supports in 4 ml culture medium per well in six‐well plates. Approximately 6–10 pieces were added to each well, depending on the experimental requirements. Placental explants were incubated in pre‐gassed medium under: (i) normoxic conditions (controls) (10% O₂–85% N₂–5% CO₂), (ii) treatment with 1 mm H₂O₂ under normoxia, or (iii) conditions of repetitive hypoxia±reoxygenation (HR – repetitive cycles of 0.5% O₂–94.5% N₂–5% CO₂ for 6 h and 10 % O₂–85% N₂–5% CO₂ for 6 h) in the ExVivo system (BioSpherix, Parish, NY, USA) for 24 h. The Biospherix incubator was calibrated before each experiment and set to maintain the normoxic cultures under 10% O₂–5% CO₂ in order to mimic the oxygen concentration within the term placenta (Soothill et al. 1986).

RNA extraction and cDNA synthesis

Total RNA was extracted from a known amount of placental tissue (∼100 mg) using QIAzol lysis reagent (Qiagen, Crawley, UK) as previously described (Mistry et al. 2011). RNA concentration and purity were verified spectrophotometrically using the Nanodrop ND‐1000 (Nanodrop Technologies, Labtech, Ringmer, UK); all of the samples had an A ₂₆₀/A ₂₈₀ ratio > 1.96. RNA (1 μg) was reverse transcribed using the QuantiTect Reverse Transcription kit (Qiagen) in a Primus96 thermocycler (Peqlab Ltd, Fareham, UK).

Quantitative real time polymerase chain reaction

Real‐time polymerase chain reaction (PCR) was carried out using SYBR Green chemistry (2× QuantiFast SYBR Green, Qiagen) on an ABI7500 Fast (Life Technologies, UK) using the primers detailed in Table 1. Melt‐curve analysis was performed to confirm the presence of one single product and non‐template controls were run to assess contamination. The standard curve method was used to quantify gene expression. Abundance data for the genes of interest were expressed following normalisation using GeNORM (http://medgen.ugent.be/∼jvdesomp/genorm/), with three stably expressed housekeeping genes, suitable for human placental samples: glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), β‐2‐microglobulin and β‐actin (Murthi et al. 2008; Kurlak et al. 2013) and expressed normalised to copy number.

Table 1.

Details of primers used in qPCR

Gene	Accession number	Primers	Length (bp)
PRR	NM	5′ cctcattaggaagacaaggactatcc 3′	50
		5′ gggttcttcgcttgttttgc 3′
Prorenin	NM	5′ ccacctcctccgtgatcct 3′	46
		5′ gcggatagtactgggtgtccat 3′
AGT	NM_000029	5′ ccccagtctgagatggctc 3′	117
		5′ gacgaggtggaaggggtgta 3′
AT1R	NM_004835	5′ ggctattgttcacccatgaagt 3′	177
		5′ tgggactcataatggaaagcac 3′
AT2R	NM_000686	5′ tatggcctgtttgtcctcattg 3′	115
		5′ ccattgggcatatttctcaggt 3′
HIF‐1α	NM_181054	5′ atccatgtgaccatgaggaaatg 3′	125
		5′ tcggctagttagggtacacttc 3′
HIF‐1β	NM_001197325	5′ tgactcctgttttgaaccagc 3′	95
		5′ ctgctcacgaagtttatccacat 3′
HIF‐2α	NM_001430	5′ ggacttacacaggtggagcta 3′	79
		5′ tctcacgaatctcctcatggt 3′
NOX4	NM_016931.3	5′ tgaactatgaggtcagcctctg 3′	107
		5′ aagcttgtatggtttccagtcat 3′
GAPDH	NM_002046.3	5′ ggaagcttgtcatcaatggaa 3′	102
		5′ tggactccacgacgtactca 3′
β‐Actin	NM_001101.2	5′ ccaaccgcgagaagatga 3′	97
		5′ ccagaggcgtacaggatag 3′
B2M	NM_004048.2	5′ cttatgcacgcttaactatcttaacaa 3′	127
		5′ taggagggctggcaacttag 3′

Immunohistochemical staining of RAS components and markers of hypoxia/oxidative stress

Placental protein expression was analysed by immunohistochemistry. Serial sections of placental tissue were cut (5 μm) in the same orientation from paraffin‐embedded tissue blocks (Sledge Microtome, Anglia Scientific, Norwich, UK) and mounted onto Superfrost Plus glass microscope slides (Menzel‐Glaser, Braunschweig, Germany). Before use, sections were dewaxed by immersion in xylene followed by rehydration in descending concentrations of alcohol.

Immunohistochemical staining was performed using the Dako Envision staining kits (Dako Ltd, Germany). Eight rabbit and two mouse antibodies were used for immunostaining of paraffin‐embedded placental sections. The optimal dilutions and details of all antibodies used are shown in Table 2. Heat‐induced epitope retrieval was achieved by heating in a citrate buffer (pH 6.0) using a microwave oven for 15 min (800 W), followed by incubation for 30 min in normal goat serum (Sigma‐Aldrich, UK) to block non‐specific binding; slides were then incubated with primary antibodies overnight at 4°C. A negative control was performed for each test section by incubation with mouse or rabbit IgG as appropriate. Specificity of antibodies was verified by Western blot analysis with identification of the target protein confirmed by specific bands of correct molecular mass (data not shown). Sections were dehydrated and cleared in ascending concentrations of alcohol and xylene before mounting in DPX (BDH, Poole, UK).

Table 2.

Product descriptions and concentrations for immunohistochemistry

	Product name/description	Concentration (mg ml−1)
PRR	Anti‐ATP6AP2 – Sigma Prestige, HPA003156.	1.8
	Rabbit polyclonal
Prorenin	Anti‐prorenin – Abcam, ab82450.	0.042
	Mouse monoclonal
AGT	Anti‐AGT – Sigma Prestige, HPA0031557.	0.26
	Rabbit polyclonal
AT1R	Anti‐AT1R – Abcam, ab9391.	80
	Mouse monoclonal
AT2R	Anti‐AT2R – Abcam, ab19134	5.2
	Rabbit ployclonal
HIF‐1α	Anti‐HIF‐1α – Sigma Prestige, HPA0031557	0.001
	Rabbit polyclonal
HIF‐1β	Anti‐Arnt – Aviva Systems Biology, ARP30979. Rabbit polyclonal	0.001
HIF‐2α	Anti‐EPAS1 – Aviva Systems Biology, ARP32253.	0.005
	Rabbit polyclonal
NOX4	Anti‐NOX4 – Abcam, ab133303.	1:500
	Rabbit polyclonal
XO	Anti‐XDH – Aviva Systems Biology OAAB05869.	0.5 μg ml−1
	Rabbit polyclonal

For analysis of placental sections, digital images of five randomly selected, high‐power fields (Nikon Eclipse II microscope, ×400 magnification) were captured using NIS‐Elements F2.20 (Nikon UK Ltd, UK). Protein expression was semi‐quantitatively assessed (H‐score) by two blinded observers (L.O.K. and H.D.M.), as described previously (Mistry et al. 2013). Between‐observer agreement for H‐scoring was excellent (kappa 0.97). A visual check was also performed to ensure accurate discrimination of immunolabelled regions.

Statistical analysis

All tests were performed using IBM SPSS Statistics for Windows, version 22 (IBM, Armonk, NY, USA) and Prism, version 6 (GraphPad Software, La Jolla, CA, USA). Summary data are presented as means ± standard deviation (SD) or median and interquartile range (IQR) as appropriate. One‐way ANOVA or Kruskal–Wallis test followed by Gabriel's or Mann–Whitney U post hoc test were used depending on the distribution of the data, after testing using the Kolmogorov–Smirnov test. Correlations between the parameters were tested with a Spearman's rank test. The null hypothesis was rejected where P < 0.05. The data from the in vitro culture experiments were evaluated using repeated measures analysis.

Results

Ex vivo data

Placental RAS in normotensive women at high altitude

mRNA measurements were available from nine placentae collected at sea level (spontaneous vaginal delivery (SVD), n = 4; elective Caesarean section (CS), n = 5) and eight at high altitude (SVD, n = 4; CS, n = 4). For the protein expression study, 16 placentae were collected at sea level (SVD, n = 9; CS, n = 7), and eight at high altitude (SVD, n = 4; CS, n = 4).

The mRNA expression of all RAS components was not significantly affected by altitude in normotensive women, although variation was higher for all components at high altitude (Fig. 1 A). In contrast, the protein levels of prorenin (P = 0.049), prorenin receptor (PRR; P = 0.0004) and both AT1R (P = 0.006) and AT2R (P = 0.002) were all significantly higher in the high altitude placentae (Fig. 1 B), although AGT was not different (P > 0.1). All proteins were confined to the outer layer of the villous syncytiotrophoblast. The ratio between prorenin and its receptor (PRR/prorenin) also rose significantly (P = 0.008): sea level median 0.34 (IQR 0.1–0.6); high altitude median 0.86 (0.75–0.93) whilst that between the AT1R and AT2R was unchanged (P > 0.8): sea level median 0.97 (IQR 0.79–1.4); high altitude median 0.96 (0.82–1.30). The mode of delivery did not influence protein expression of any of the RAS components (P > 0.2 to > 0.7) and therefore we did not consider this as a confounder in further analyses.

Figure 1. Gene and protein expression of placental RAS from normotensive women at sea level or high altitude .

A, normalised mRNA expression (copy number) of all RAS components in placentae from normotensive controls residing and delivering at sea level (n = 9) or at high altitude (n = 8), and pre‐eclamptic women residing and delivering at sea level (n = 11) or at high altitude (n = 8). B, placental protein expression and localisation of RAS components from normotensive controls residing and delivering at sea level (n = 16) or at high altitude (n = 8), and pre‐eclamptic women residing and delivering at sea level (n = 6) or at high altitude (n = 5). Box plots represent median (interquartile range); *P < 0.05; **P < 0.001; ***P < 0.0001. Positive staining (brown) was localised mainly in the syncytiotrophoblast (black arrows). All photomicrographs taken at ×400 magnification, scale bar = 100 μm. PRR: prorenin receptor; AGT: angiotensinogen; AT1R/2R: angiotensin receptors type 1 and 2.

Placental RAS in women with PE at high altitude

mRNA measurements were available from 19 placentae collected at sea level (n = 11) and at high altitude (n = 8). Samples analysed for proteins included six collected at sea level and five at high altitude.

The mRNA expression was significantly lower in placentae from pre‐eclamptic women at high altitude for all RAS components (Fig. 1 A), except the AT1R. In contrast with samples from normotensive women, the variability in mRNA expression was also markedly less. However, the protein levels of PRR, AGT and AT1R were all increased in PE at altitude (Fig. 1 B) although this only reached statistical significance for AGT and AT1R.

Placental HIFs and NOX4 in normotensive and PE pregnancies at high altitude

In the normotensive pregnancies, placental mRNA expression of all HIFs and NOX4 was unaffected by altitude (Fig. 2 A). However, the protein level of all the HIFs (HIF‐1α, P <  0.001; HIF‐1β, P < 0.001; HIF‐2α, P = 0.04)) as well as NOX4 (P = 0.001) was significantly raised in high altitude pregnancies (Fig. 2 B). Immunohistochemical staining localised the proteins to the syncytiotrophoblast and around the fetal vessels of the placental villi. The enzyme XO was unaffected by altitude (data not shown).

Figure 2. Gene and protein expression of placental RAS from women with PE, at sea level or high altitude .

A, normalised mRNA expression (copy number) of all hypoxia‐inducible factor (HIF) components and NADPH oxidase (NOX4) in placentae from normotensive controls (NT) and pre‐eclampsia (PE) residing and delivering at sea level or at high altitude. B, placental protein expression and localisation of HIF components and NOX4 from NT and PE women residing and delivering at sea level or at high altitude. Box plots represent median (interquartile range); *P < 0.05; **P < 0.001; ***P < 0.0001. Positive staining (brown) was localised mainly in the syncytiotrophoblast (black arrows), with some staining around fetal vessels (red arrows). All photomicrographs taken at ×400 magnification, scale bar = 100μm.

The effect of altitude on the pattern of expression differed in the placentae from women with PE. Whereas there was no effect of altitude in the normotensive women, the placental mRNA expressions of HIF‐1α, HIF‐1β and NOX4 were all lowered at high altitude compared to the sea level PE women (P < 0.001 for all; Fig. 2 A). When comparing placentae from normotensive and PE women at sea level, HIF‐1α and NOX4 mRNA expression was markedly higher in the PE compared to normotensive controls (P = 0.01 and P = 0.001 respectively). At high altitude, HIF‐2α mRNA expression was lower in PE than the normotensive group (P = 0.003; Fig. 2 A).

Placental protein levels were equally affected by altitude in the PE women: HIF‐1α (P < 0.01), HIF‐1β (P = 0.03), HIF‐2α (P = 0.017) as well as NOX4 (P = 0.004) were significantly lower in high altitude pregnancies in women with PE (Fig. 2 B). XO protein was not altered (data not shown).

In high altitude samples, protein levels of HIF‐1α (P = 0.001), HIF‐1β (P = 0.001), HIF‐2α (P = 0.029) and NOX4 (P = 0.019) were significantly lower in women with PE as compared to normotensive women (Fig. 2 B).

In vitro data

In vitro explant culture under experimental oxidative stress conditions

Due to the nature of the explant methodology, sample numbers in each of the treatment groups were 4–6 depending on availability of sufficient quality tissue. Oxidative stress was induced by subjecting explants to repetitive cycles of hypoxia–reoxygenation for 24 h, or by treating explants with hydrogen peroxide under normoxia.

Experimental hypoxia–reperfusion treatment significantly increased the mRNA expression of only AGT (P = 0.04) compared to normoxic conditions. Protein expression followed the same pattern (AGT, P = 0.025; Fig. 3). Treatment with hydrogen peroxide under normoxic oxygen concentrations had no effect on AGT mRNA, although both hydrogen peroxide and hypoxia–reperfusion were associated with significantly increased AGT protein (Fig. 3). No other components of the RAS were significantly altered by any of the treatments.

Figure 3. Placental angiotensinogen mRNA (A) and protein expression (B) of term placental explants (n = 4–6) following incubation in normoxic conditions, following hydrogen peroxide (H₂O₂), and after hypoxia–reperfusion (H/R) .

Data analysed using repeated measures analysis and are represented at means ± standard deviation; **P < 0.001. Positive staining (brown) was localised mainly in the syncytiotrophoblast (black arrows). All photomicrographs taken at ×400 magnification, scale bar = 100μm. AGT, angiotensinogen.

The HIFs and antioxidant enzymes were also measured in these experiments, to establish whether hypoxia was being sensed within this model. There was no observable effect of these experimental conditions on either mRNA expression or protein of any of the HIFs, NOX4, or XO. Interestingly, we identified strong positive correlations in gene expression between HIF‐1β and both angiotensin receptors AT1R (r = 0.77, P < 0.001) and AT2R (r = 0.81, P < 0.001), but only AT2R also correlated with HIF‐1α (r = 0.512, P < 0.013; Fig. 4).

Figure 4. Scatter plots demonstrating associations in placental mRNA expression of AT1R, AT2R, HIF‐1β and HIF‐1α .

HIF‐1β strongly correlated with both AT1R (r = 0.77; P < 0.001) and AT2R (r = 0.81; P < 0.001) under all oxygenation conditions. AT2R also correlated with HIF‐1α (r = 0.512; P < 0.01).

Discussion

Our aim was to investigate the effects of various forms of oxidative stress on the RAS in the human placenta, including exposure to the lower $P_{{\mathrm{O}}_2}$ of high altitude chronic hypoxia, the elevated tissue and circulatory chronic oxidative stress which characterises PE, and the acute experimental oxidative stress induced in vitro by hypoxia–reperfusion or hydrogen peroxide insults. Our results demonstrate, for the first time, that components of the RAS are activated under these conditions. Furthermore, we show that the type of component activated and the degree of activation are dependent on the nature of the insult.

At high altitude, there is a generalised, significant increase in activity of the placental RAS, which, to our knowledge, has not been reported previously. The rise in PRR protein is statistically highly significant. Binding of (pro)renin to this receptor induces a 4‐fold increase in its catalytic efficiency in the generation of angiotensin I (Ang I) from AGT (Nguyen et al. 2002). Thus, changes in receptor expression can have a substantial effect on the generation rate of Ang I, and hence Ang II, even without changes in AGT. Furthermore, our results from the in vitro hypoxia–reperfusion model show a significant increase in both mRNA and protein expression of AGT, supporting our premise that this element of the renin–angiotensin axis may be instrumental in ‘tuning’ the regulation of the placental RAS in a redox environment. When oxidised AGT is reacted with renin in the presence of the PRR, there is a 4‐fold increase in the generation of Ang I (in addition to the 4‐fold increase induced by the binding of prorenin to the receptor), which does not occur if reduced AGT is reacted (Zhou et al. 2010). The hypobaric hypoxia of high altitude might be sufficient to increase the ratio of oxidised:reduced AGT and further stimulate the system. This appears to be corroborated by the rise in AGT observed after an acute hypoxic insult in the experimental model. Our observations suggest that this increase in AGT is not simply a reaction to lower oxygen tension per se, but potentially relates to the increased oxidative stress induced by this model (Cindrova‐Davies et al. 2007). We could only examine total AGT expression, as it is not yet possible to distinguish the oxidised and reduced forms immunohistochemically; total expression was not different at the two altitudes.

Low concentrations of endogenous ROS are important in the activation of signalling pathways which relate to adaptations to hypoxia, such as genes involved in angiogenesis (e.g. VEGF), where the promoter region has a binding site for hydrogen peroxide (Oshikawa et al. 2010), which is essential for full activation of the gene for VEGF receptor 2 (VEGFR2). Accumulating evidence points towards the existence of direct interactions between Ang II and VEGF; a recent study has demonstrated that AT2R mediates the synergistic effect of a combination of Ang II and VEGF‐A to promote differentiation of bone marrow‐derived mesenchymal stem cells into endothelial cells (Ikhapoh et al. 2015). These authors suggest that AT2R could be critical to repair and regenerate damaged vascular endothelium. In other cell systems, such as mouse Lewis lung carcinoma cells, hypoxia appears to upregulate angiotensin‐converting enzyme, Ang II, and AT1R. Most intriguingly, this regulation is diphasic: in the early phase, after 6 h hypoxia, AT1R protein is decreased, whilst AT2R protein is increased; yet if hypoxia is continued up to 24 h this effect is reversed, with AT1R protein significantly increased and AT2R decreased (Fan et al. 2014). Employing specific pharmacological inhibitors, Fan et al. (2014) concluded that this diphasic response may be due to a bi‐directional control mechanism: hypoxia enhances the expression of AT1R and AT2R via increased Ang II, but elevated AT2R inhibits AT1R during the early stage whilst AT1R inhibits AT2R expression as hypoxia continues. This may explain why neither the AT1R nor the AT2R were significantly altered in our hypoxia–reperfusion model. Similarly, Cindrova‐Davies (2009) reported increased HIF‐1α protein in placental explants when challenged with hypoxia–reperfusion for only 7 h but these changes were no longer evident after a longer 24 h period.

HIF‐1β knockout mice die in midgestation having reduced levels of VEGF protein and increased numbers of apoptotic haematopoietic cells (Ramirez‐Bergeron et al. 2006): HIF coordinates early endothelial cell emergence and vessel development by promoting haematopoietic cell survival and paracrine growth factor production. Thus the strong association, observed in this study (Fig. 4), between the angiotensin receptors and oxygen‐sensing proteins, HIF‐1β and HIF‐1α, adds credence to the idea that these receptors are involved in the oxygen sensing mechanism of the syncytiotrophoblast. As expression of AT2R is highest early in pregnancy, the association we have found with both HIF‐1α and HIF‐1β oxygen‐sensing units supports a possible role for RAS in normal placental development.

AT2R may also have a protective role in the repair of oxygenation‐induced damage (Namsolleck et al. 2014), as seen in ischaemic stroke (McCarthy et al. 2009), myocardial ischaemic injury (Parlakpinar et al. 2011; Park et al. 2013) and neurological pathologies (Sumners et al. 2013).

By the same token, prorenin has been shown to stimulate proliferation of retinal endothelial cells to an equivalent degree to that induced by VEGF, and independently of Ang II (Zhu et al. 2015). In pancreatic cancer cells, Ang II induces VEGF, through AT1R and ERK1/2 signalling (Anandanadesan et al. 2008). Studies in AGT‐knockout mice report blunted hypoxia‐induced endothelial progenitor cell function, indicating that AGT is required for hypoxia‐induced vasculogenesis (Choi et al. 2014).

Since hypoxia stimulates the release of ROS, we postulated that the low oxygen partial pressure at altitude (hypobaric hypoxia) would amplify the oxidative stress of PE through increased production of ROS, and thus augment the stimulation of the RAS already observed in PE at sea level. However, this stimulation did not occur. Whereas mRNA expression of the RAS was unaffected in normotensive women at high altitude (Fig. 1 A), it was reduced in PE placentae at high altitude (Fig. 1 A). However, translation followed a very different pattern, showing increased translation (protein expression) in a majority of components of the RAS, in both normotensive and PE women at high altitude.

Concurrent analysis of the mRNA expression of the HIFs (Fig. 2) revealed that there were no detectable differences between sea level and high altitude placentae in the normotensive women; this agrees with previously published data (Tissot van Patot et al. 2004). In contrast, the increases in HIF‐1α, and NOX4 observed in PE compared to normotensive women at sea level were not observed in PE at altitude; indeed, the mRNAs encoding HIF‐1α, HIF‐1β and NOX4 were significantly lower in placentas from PE women at high altitude. Our protein data (Fig. 2) expand the study of Zamudio et al. (2007), which reported increases in the HIF‐1α protein expression at high altitude in normotensive women. However, the observation that placental responses to oxygen deprivation are completely blunted at high altitude in women with PE, as demonstrated by the lower mRNA and protein parameters of all the HIFs, is completely novel. Despite the low sample numbers, these observed differences are striking. This certainly invites the question, do pregnant women who develop PE at altitude have an adaptive response to hypoxia that differs from that of normotensive women? In healthy pregnancies at altitude, placental HIF activity is reduced as seen by lower HIF‐1–DNA binding despite unchanged HIF protein levels (Tissot van Patot et al. 2004); placentae at high altitude display little evidence of oxidative stress following labour normally seen in laboured placentae at low altitude (Tissot van Patot et al. 2010). Rajakumar et al. (2008) suggest that impairment of protein degradation, rather than increased synthesis causes inadequate oxygen‐dependent reduction of HIF‐1α protein in PE and is supported by the fact that, in early‐onset PE placentae at least, there is decreased expression of the prolyl hydroxylases PHD1 and PHD2 (Rolfo et al. 2010). Hence, molecular events leading to the formation of the HIF‐1α:VHL–ubiquitin ligase complex (Ivan et al. 2001), as well as proteasomal trypsin, chymotrypsin and peptidyl glutamyl‐like activities may be the focus of adaptation. In well‐oxygenated cells, PHDs hydroxylate the HIF‐1α subunits, thereby targeting them for proteasomal degradation and resulting in a half‐life of less than 5 min (Wang et al. 1995). PHDs are the key enzymes triggering HIF‐1α desensitization, a feedback mechanism required to protect cells against necrotic cell death and thus to adapt them to chronic hypoxia (Ginouves et al. 2008). Whereas humans living at low altitudes ordinarily maintain low levels of HIF‐1α and HIF‐2α through constitutive hydroxylation and degradation, upon ascent to high altitude, attenuated PHD2 hydroxylase activity due to hypoxia leads to increased levels of HIF‐1α and HIF‐2α. Even so, the Tibetan population shows the strongest support for the hypothesis that multiple genes in the HIF pathway can be reconfigured in response to chronic hypoxia (Bigham & Lee, 2014; Lorenzo et al. 2014), the most convincing candidates for this reconfiguration being PHD2 and HIF‐2α. Tibetans are the first humans in whom a hypo‐responsive HIF system has been demonstrated, and may represent an evolutionary resetting of the HIF system to operate within a hypoxic environment (Petousi et al. 2014). However, this may differentiate populations long‐acclimatised to life at high altitude from those relatively recently arrived, such as the inhabitants of Colorado included in this study.

As noted in the Introduction, deficient spiral artery remodelling may lead to a hypoxia–reperfusion insult. In order to explore the possibility that oxidative stress, and not hypoxia per se, is the driving force behind the activation of the RAS at high altitude and in PE, we used the fully validated experimental model of hypoxia–reperfusion. In this model, increased oxidative stress is demonstrated by the increase in heat shock proteins Hsp27 and Hsp90, lipid peroxidation and formation of peroxynitrite (Cindrova‐Davies et al. 2007) localised mainly to the syncytiotrophoblast. Under these acute conditions of oxidative stress, our study reveals a more specific stimulation of the RAS, as seen by increased mRNA and protein expression of AGT only (Fig. 3). The fact that other RAS components were not increased by the acute oxidative stress of these experimental conditions implies that their generalised stimulation at high altitude may be a response to the chronically reduced oxygen tensions. This is supported by the fact that in a mouse model of alveolar hypoxia, such as may occur in pulmonary diseases (e.g. chronic obstructive pulmonary disease), the RAS is stimulated by the low $P_{{\mathrm{O}}_2}$ (Gonzalez & Wood, 2010) and it is the activation of NOX by the RAS that leads to an inflammatory response. However, if the animals remain under hypoxic conditions for several days, the inflammation resolves and exposure to lower $P_{{\mathrm{O}}_2}$ does not elicit further inflammation, suggesting that the vascular endothelium has ‘acclimatised" to hypoxia (Gonzalez & Wood, 2010). Furthermore, in human lung fibroblast cells, hypoxia directly activates the RAS to induce collagen type I expression, mediated by NF‐κB signalling, which in turn activates AT1R expression (Liu et al. 2013).

Previously, using the different methodology of Western blotting to measure protein in term villi, and a shorter time period of 7 h, hypoxia–reperfusion was found to stimulate HIF‐1α in this model (Cindrova‐Davies, 2009). Using the semi‐quantitative method of immunohistochemical scoring and a longer time period of 24 h, we did not detect this stimulation. Likewise, use of hydrogen peroxide to mimic the effect of oxygen in acutely lowering HIF‐1α, over the longer 24 h period, did not have the same effect as previously.

Hypoxia cannot be merely defined by just the prevailing oxygen tension (Cindrova‐Davies et al. 2015), but must be related to the metabolic demands of the tissue. As Barcroft himself said ‘oxygen is but one of the proximate principles of nourishment’ (Young, 1992). The placenta is an extremely metabolically active tissue (Carter, 2000; Illsley et al. 2010). Oxygen sensing is of fundamental importance to all cells as oxygen consumption is required for ATP generation (Guzy & Schumacker, 2006). In tissue such as the placenta, which is exposed to altered oxygen concentrations and hypoxia–reperfusion insults not only during development, but also within its own lobular structures, oxygen sensing is critical in order to stimulate gene expression and transcription of genes relating to growth processes, including angiogenesis. An ability to control oxygen sensing mechanisms using molecules which do not disrupt oxygen consumption would have a profound impact on a diverse range of pathologies. We have here described such a potential system.

Additional information

Competing interests

There is no conflict of interest for any of the authors.

Author contributions

Conception and design of the experiments: F.B.P. and G.J.B.; collection, assembly, analysis and interpretation of data: H.D.M., L.O.K. and T.C.‐D.; drafting the article or revising it critically for important intellectual content: L.O.K., H.D.M., T.C.‐D., F.B.P. and G.J.B. All authors have approved the final version of the manuscript and agree to be accountable for all aspects of the work. All persons designated as authors qualify for authorship, and all those who qualify for authorship are listed.

Funding

H.D.M. is supported by an ERA‐EDTA Fellowship (ERA LTF 137–2013).