Induction of miR-137 by isorhapontigenin (ISO) direct targeted Sp1 protein translation and mediated its anti-cancer activity both in vitro and in vivo

Abstract

Our recent studies found that isorhapontigenin (ISO) showed a significant inhibitory effect on human bladder cancer cell growth, accompanied with cell cycle G0/G1 arrest as well as down-regulation of Cyclin D1 expression at transcriptional level via inhibition of Sp1 transactivation in bladder cancer cells. In current studies, the potential ISO inhibition of bladder tumor formation has been explored in xenograft nude mouse model, and the molecular mechanisms underlying ISO inhibition of Sp1 expression and anti-cancer activities has been elucidated both in vitro and in vivo. Moreover, the studies demonstrated that ISO treatment induced the expression of miR-137, which in turn suppressed Sp1 protein translation by direct targeting Sp1 mRNA 3′UTR. Similar to ISO treatment, ectopic expression of miR-137 alone led to G0/G1 cell growth arrest and inhibition of anchorage-independent growth in human bladder cancer cells, which could be completely reversed by over-expression of GFP-Sp1. The inhibition of miR-137 expression attenuated ISO-induced the inhibition of Sp1/Cyclin D1 expression, and induction of G0/G1 cell growth arrest and suppression of cell anchorage-independent growth. Taken together, our studies have demonstrated that miR-137 induction by ISO targets Sp1 mRNA 3′UTR and inhibits Sp1 protein translation, which consequently results in reduction of Cyclin D1 expression, induction of G0/G1 growth arrest and inhibition of anchorage-independent growth in vitro and in vivo. Our results have provided novel insights into understanding the anti-cancer activity of ISO in the therapy of human bladder cancer.

Introduction

Bladder carcinoma (BC) is highly prevalent and the second most common genitourinary malignant disease in the USA (1). BC is threatening for human beings when it invades to muscles. Among all the cancer types, BC ranks the fifth in total healthcare cost with an annual expenditure of ~$4 billion in the US alone (2). Although MVAC (methotrexate, vinblastine, adriamycin and cisplatin) chemotherapy has been widely used for treatment of advanced bladder cancers, it is accompanied with major toxic side effects (3). Therefore, development of less toxic alternate chemotherapeutic therapies and/or dietary management strategies is of highly significance for prevention and therapy of this disease (2, 3). Isorhapontigenin (ISO) is a new derivative of stilbene compound isolated from Chinese herb Gnetum cleistostachyum, and its chemical structure is shown in our previous publications (4, 5). Recently, our group have reported that ISO effectively suppresses bladder cancer cell growth in vitro (4, 5), and have found that ISO treatment induces G0/G1 cell growth arrest and inhibits anchorage-independent growth of human bladder cancer cells through down-regulated Cyclin D1 gene transcription via inhibition of Sp1 transactivation in bladder cancer cells (4).

Sp1 is the first transcription factor to be isolated from mammalian cells and belongs to the specificity Protein/Kruppel-like Factor (SP/KLF) family (6), which are characterized by their COOH-terminal domains containing three C₂H₂-type zinc fingers that recognize GC-rich motif in the promoters of their target genes (7). Sp1 is ubiquitously expressed in various mammalian cells and plays an important role in the regulation of numerous genes involved in various cellular processes (8), such as cell differentiation, cell growth and apoptosis. An increasing number of evidence shows that Sp1 is up-regulated in many cancer tissues, including breast carcinomas (9), hepatocellular carcinomas (10), thyroid cancer (11), colorectal cancer (12), pancreatic cancer (13), gastric cancer (14) and lung cancer (15). Furthermore, Sp1 expression is also increased in the bladder epithelium of the mouse exposed to n-butyl-N-(4-hydroxybutyl)-nitrosamine (BBN), a well-characterized mouse carcinogen for invasive bladder cancer induction (16). Sp1 expression increases by 8- to 18- fold in malignant transformed fibroblasts, whereas knockdown of Sp1 expression blocks the tumorigenicity of transformed fibroblasts in xenografts athymic nude mouse model (17). It has been reported that the up-regulation of Sp1 is also associated with poor clinical prognosis among patients with gastric and pancreatic cancer (14, 18, 19), suggesting that Sp1 may act as an onco-protein in tumor development. The pro-oncogenic activity of Sp1 is primarily due to Sp1-regulated genes, which include several genes that play pivotal roles in cancer cell proliferation (Cyclin D1, EGFR), survival (survivin, bcl-2), angiogenesis (VEGF and its receptors (VEGFR1 and VEGFR2)), and inflammation (NF-kB, p65) (4, 20). Thus, Sp1 is considered as an important target for mechanism-based anticancer drugs. Our previous studies have revealed that ISO acts as a novel mechanism-based cancer therapeutic agent against human bladder cancer by inhibition of Sp1 transactivation in different human bladder cancer cell lines (4, 5). However, the anti-cancer effect of ISO in vivo and the molecular mechanisms underlying ISO inhibition of Sp1 expression has never been explored to the best of our knowledge. In current studies, we explored the ISO inhibition of human bladder tumor formation in xenografts athymic nude mouse model and the molecular mechanisms underlying ISO suppression of Sp1 expression both in vitro and in vivo.

Materials and Methods

Plasmids, antibodies and reagents

The Sp1 expression construct, pEGFP-Sp1, and miR-137 expression construct, pcDNA3.2/V5-mmu-mir-137, were obtained from Addgene (Cambridge, MA, USA). Human Sp1 3′-UTR luciferase reporter, being cloned into the pGL3-control luciferase assay vector, were kindly provided by Dr Guido Marcucci from Department of Medicine, Ohio State University, Columbus, OH, USA (21). Sp1 3′-UTR point mutation was amplified from WT template by overlap PCR using primers: forward: 5′- GATCTTTGCTAGGACATCCTAAATTTATATACT T-3′; reverse: 5′-AAGTATATAAATTTAGGATGTCCTAGCAAAGATC-3′. The microRNA-145 expression construct, pBluescript-miR-145 (hsa-miR-145), was kindly provided by Dr. Renato Baserga from Department of Cancer Biology, Thomas Jefferson University, Philadelphia, PA (22). The miR-137 inhibitor expression plasmid (HmiR-AN0175-AM03) was purchased from Gencopoeia (Rockville, MD, USA). The antibody against β-Actin was bought from Cell Signaling Technology (Boston, MA, USA). The antibodies against Cyclin D1, Sp1, Sp4 and GAPDH were bought from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Isorhapontigenin (ISO) with purity more than 99% was purchased from Rochen Pharma (Shanghai, China) and was dissolved in dimethyl sulfoxide (DMSO) to make a stock concentration at 20mM.

Cell culture and transfection

Human bladder cancer cell line UMUC3 was provided by Dr. Xue-Ru Wu (Departments of Urology and Pathology, New York University School of Medicine, New York, NY) in 2010 as described in our previous studies (5). T24T was kindly provided by Dr. Dan Theodorescu (Department of Urology, University of Virginia, Charlottesville, VA, USA) in 2010 and used in our previous studies (4, 5, 23). The UMUC3 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 2mM L-glutamine, and 25μg/ml of gentamycin and the T24T cell was cultured in a 1:1 mixture of Dulbecco’s modified Eagle’s medium (DMEM)/Ham’s F12 medium supplemented with 5% FBS, 2mM L-glutamine, and 25 μg/ml of gentamycin. All cell lines were subjected to DNA tests and authenticated in our previous studies (4). Both cell lines are regularly authenticated on the basis of viability, recovery, growth, morphology and chemical response as well, were most recently confirmed 4–6 months before use by using a short tandem repeat method. The transfections were carried out using PolyJet^™ DNA In Vitro Transfection Reagent (SignaGen Laboratories, Gaithersbur, MD, USA) according to the manufacturer’s instructions. The stable transfection selection of Sp1, miR-137, miR-145 in UMUC3 and T24T cells were subjected to neomycin selection for 4–6 weeks, while miR-137 specific inhibitor stable transfectants were selected by hygromycin for 4–6 weeks. The survived stable transfectants were pooled as stable mass culture as described in our previous studies (24, 25).

Western Blotting

Cells were extracted with cell lysis buffer (10 mM Tris-HCl, pH 7.4, 1% SDS, and 1mM Na₃VO₄) and protein concentrations were determined by NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The cell extracts were subjected to SDS-polyacrylamide gels (SDS-PAGE), transferred to polyvinylidene fluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA), probed with the indicated primary antibodies, and incubated with the AP-conjugated secondary antibody. The protein band specifically bound to the primary antibody was detected by Typhoon FLA 7000 (GE Healthcare, Pittsburgh, PA, USA) using an alkaline phosphatase-linked secondary antibody and an enhanced chemifluorescence Western blotting system as described in our previous studies (5, 23).

Anchorage-independent growth assay

Anchorage-independent growth in soft agar (soft agar assay) was performed as described in our earlier studies. Briefly, the 1×10⁴cells mixed with ISO at final concentration of 10μM or vehicle control in 10% FBS Basal Medium Eagle (BME) containing 0.33% soft agar and were seeded over the basal layer containing 0.5% agar containing 10% FBS/BME in each well of 6-well plates. The plates were incubated in 5% CO₂ incubator at 37°C for 3 weeks. Colonies were captured under a microscope and only colonies with over 32 cells were counted. The results were presented as mean ± SD obtained from three independent experiments.

Cell-cycle analysis

The cells were treated with ISO at 10μM or control vehicle and the cells were then harvested and fixed in 75% ethanol overnight. The cells were suspended in the staining buffer containing 0.1% Triton X-100, 0.2 mg/mL RNase A, and 50 mg/mL propidium iodide (PI) at 4°C and DNA content was then determined by a flow cytometry Epics XL flow cytometer (Beckman Coulter Inc.) and the results were analyzed with EXPO32 software.

RT-PCR

Cells were treated with 10μM of ISO and were then extracted for total RNA using TRIzol reagent (Invitrogen, Grand Island, NY, USA), according to the manufacturer’s instructions. The cDNAs were synthesized with the Thermo-Script RT-PCR system (Invitrogen, Grand Island, NY, USA). The mRNA was evaluated by semi-quantitative reverse transcription (RT)-PCR. The primers for human sp1 were 5′-ATTAACCTCAGTGCATTGGGTA-3′ and 5′-AGGGCAGGCAAATTTCTT CTC-3′; The primers for human β-actin were 5′-AGAAGGCTGGGGCTCATTTG-3′ and 5′-AGG GGCCATCCACAGTCTTC-3′. The PCR products were separated on 2% agarose gels and stained with ethidium bromide, and the results were imagined with Alpha Innotech SP Image system (Alpha Innotech Corporation, San Leandro, CA, USA).

Quantitative RT–PCR for miRNA assay

Total microRNAs were extracted using miRNeasy Mini Kit (Qiagen, Valencia, CA, USA). Total RNA (1μg) was used for reverse transcription and the microRNAs expression was determined by the 7900HT Fast Real-time PCR system (Applied Biosystems, Carlsbad, CA, USA) using the miScript PCR kit (Qiagen, Valencia, CA, USA). The primer for microRNA was purchased from invitrogen (Carlsbad, CA, USA), and U6 was used as a control. Cycle threshold (CT) values was determined, and the relative expression of microRNAs were calculated by using the values of 2^−ΔΔCT.

(³⁵S) methionine pulse assays

T24T cells were cultured in each well of six-well plate till 70%–80% confluence and the cell culture medium was replaced with 0.1% FBS DMEM and incubated for another 24 hours. The cells were then treated with 10μM of ISO diluted in 2% FBS methionine/cysteine free DMEM containing ³⁵S-labeled methionine/cysteine (250μ Ci per dish, Trans ³⁵S-label, ICN) for the indicated time periods. The cells were extracted with lysis buffer (Cell Signaling, Boston, MA, USA) containing complete proteinase inhibitor mixture (Roche, Nutley, NJ, USA). Total lysate of 500mg was incubated with anti-Sp1 antibody-conjugated agarose beads (R&D Systems, Minneapolis, MN, USA) at 4°C overnight. The immunoprecipitate was washed with the cell lysis buffer five times, and heated at 100°C for 5 min after final washing. The protein samples were then subjected to sodium dodecyl sulfate-polyacryl-amide gel electrophoresis analysis. ³⁵S-labeled Sp1 protein was imaging captured with the PhosphorImager (Molecular Dynamics, Kent, MI, USA).

Cancer Tissue Specimens

Twenty six pairs of primary invasive bladder cancer specimens and their paired adjacent non-tumourous bladder tissues were obtained from patients who underwent radical cystectomy at Department of Urology of the Union Hospital of Tongji Medical College between 2012 and 2013. All specimens were immediately snap-frozen in liquid nitrogen after surgical removal. Histological and pathological diagnoses were confirmed by a pathologist based on the 2004 World Health Organization Consensus Classification and Staging System for bladder neoplasms. All specimens were obtained with appropriate informed consent from the patients and the approval was obtained from the Medical Ethics Committee of Tongji Medical College, China.

Luciferase assay

For the determination of Sp1 3′UTR luciferase reporter activity, the cells were transiently co-transfected with Sp1 3′UTR luciferase reporter and TK. The transient transfectants were seeded into each well of 96-well plates (1×10⁴cells per well) and cultured for 24 hrs. The cells were treated with ISO (10μM) for the indicated times and then extracted with lysis buffer (25mmol/L Tris-phosphate (pH7.8), 2mmol/L EDTA, 1% Triton X-100, and 10% glycerol), and the luciferase activity was determined by the microplate luminometer (Microplate Luminometer LB 96V, Berthold GmbH & Co. Bad Wildbad, Germany) using the luciferase assay kit (Promega Corp. Madison, WI, USA).

Tumor xenografts and in vivo ISO treatment

All animal studies were performed in the animal institute of Wenzhou Medical University according to the protocols approved by the Medical Experimental Animal Care Commission of Wenzhou Medical University. The twelve female athymic nude mice (3–4 weeks old) were purchased from Shanghai Silaike Experimental Animal Company, Ltd. (license No. SCXK, Shanghai 2010–0002; Shanghai, China), and the mice at age of 5–6 weeks were randomly divided into two groups, and were then subcutaneously injected with 0.2ml of T24T cells (2×10⁶ suspended in 100μl PBS) in the axillary region. The mice of ISO group were received intraperitoneal injection of 150mg/kg ISO every other day, starting day one after cell inoculation, whereas control mouse were received vehicle only. The nude mice were maintained under sterile conditions according to the protocol of the American Association for the Accreditation of Laboratory Animal Care. These mice were evaluated twice a week for the appearance and size of tumors, and tumors were measured with calipers to estimate the volume. Tumor sizes were evaluated using the formula: Volume (mm³) = (width² (mm²) × length (mm))/2. Six weeks after ISO treatment, the mice were sacrificed and the tumors were surgically removed, photographed, weighed, and used for further pathological and histopathological evaluation. No mouse was died or was sacrificed before the end of the in vivo experiment.

Immunohistochemistry(IHC)

Tumor tissues obtained from the sacrificed mice were formalin-fixed and paraffin-embedded. For immunohistochemical staining (IHC), we used antibodies specific against Sp1 (1:30, Santz Cruz, CA, USA) or Cyclin D1 (1:200, Santz Cruz, CA, USA). The resultant immunostaining images were captured using the Axio Vision Rel.4.6 computerized image analysis system (Carl Zeiss, Oberkochen, Germany). Protein expression levels were analyzed by calculating the integrated optical density per stained area (IOD/area) using Image-Pro Plus version 6.0 (Media Cybernetics, MD, USA). More detailed procedure was described in our previous published studies (26).

Methylation specific PCR (MSP)

Genomic DNA was isolated with DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instruction. 2μg Genomic DNA was treated with sodium bisulfite using EpiTect Bisulfite Kit (Qiagen, Valencia, CA, USA). Methylation specific PCR was performed using 20ng of bisulfite converted DNA and the specific primers. Methylated primer and unmethylated primers for miR-137 promoter were designed according to Shimizu et al (27). PCR products were run on 2% agarose gel and visualized after ethidium bromide staining. Bisulfite converted methylated and unmethylated DNA from EpiTect PCR Control DNA Set (Qiagen, Valencia, CA, USA) was used as positive and negative controls.

Statistical analyses

Student T test was used to determine the significance of differences between different groups. The differences were considered to be significant at P ≤ 0.05. Spearman correlation test was chosen for examining the correlations between Sp1 expression and Cyclin D1 expression and tumor weight.

Results

ISO represses tumor growth via down-regulation of Sp1 protein expression both in vivo and in vitro

Our previous in vitro studies have well demonstrated that ISO treatment induces cell cycle G0/G1 arrest and inhibits cancer cell anchorage-independent growth through targeting Sp1/Cyclin D1 axis in bladder cancer cells (4). To further determine the potent anti-cancer activities of ISO in vivo, we established a xenograft model in mice using human bladder cancer T24T cells, and then treated these mice with ISO. As shown in Figs. 1A & 1B, ISO treatment resulted in a dramatic inhibition of T24T xenograft tumor growth as compared to vehicle control group (p<0.01, n=6). ISO treatment also impaired the expression of Sp1 and Cyclin D1 in the tumor tissues obtained from the tumor-bearing mice (Figs. 1C – 1E), which is consistent with our prior report in vitro (4). In addition, quantitative analysis of Sp1 expression intensity showed that Sp1 was positively associated with tumor weight (r=0.825, p<0.01) and Cyclin D1 expression (r=0.916, p<0.01) in tumor tissues obtained from xenograft nude mice (Figs. 1F & 1G). In combination with our previous report, these findings strongly suggest that down-regulation of Sp1 protein is an important event responsible for anti-cancer activities of ISO. To further test this notion, we used human bladder cancer T24T and UMUC3 cells to establish stable transfectants with GFP-Sp1 or scramble control vector, respectively. As expected, ISO treatment significantly suppressed the expression of endogenous Sp1, but not endogenous Sp4, accompanied by a marked decrease in Cyclin D1 expression in a time-dependent manner (Fig. 2A). However, ISO treatment had no any observable effects on exogenous expression of GFP-Sp1, ectopic expression of which attenuated the suppressive effects of ISO treatment on Cyclin D1 expression in T24T and UMUC3 (Fig. 2B). More interestingly, ectopic expression of Sp1 pronounced abolished the G0/G1 phase arrest and anchorage-independent growth inhibition in T24T and UMUC3 cells upon ISO treatment (Figs. 2C–2F). Taken together, these findings not only showed that anti-cancer activities of ISO both in vitro and in vivo were associated with the down-regulation of Sp1 and Cyclin D1 in human bladder cancer cells, but also emphasized the crucial role for Sp1 down-regulation in ISO anti-cancer effects.

Fig. 1. ISO treatment inhibited human bladder tumor growth accompanied with reduction of Sp1 and Cyclin D1 protein expression in xenograft nude mice.

(A&B) Athymic nude mice were subcutaneously injected with T24T cells in the right axillary region and received intraperitoneal injection with ISO at dose of 150mg/kg body weight or vehicle control as indicated in the section of “Materials and Methods”. Six weeks After ISO treatment, the mice were sacrificed and the tumor will be surgically removed and photographed (A), as well as weighed (B). (C, D, E) The representative IHC imagines showing expression of Sp1 and Cyclin D1 in bladder cancer tissues collected from nude mice. (F) The Sp1 protein expression was positively correlated with tumor weight in nude mice. (G) The representative IHC imagines exhibiting the positively co-relation between Sp1 and CyclinD1 expression in bladder cancer tissues from nude mice.

Fig. 2. Sp1 down-regulation mediated ISO induction of G0/G1 growth arrest and inhibition of anchorage-independent growth of bladder cancer cells.

(A) Protein expression of Sp1, Sp4 and Cyclin D1 in T24T and UMUC3 cells was determined by Western blotting after cells were treated with 10μM ISO for indicated time periods. (B) ISO treatment did not inhibit ectopic expressed GFP-Sp1, which reversed ISO attenuation of Cyclin D1 protein expression in T24T and UMUC3 cells. Ectopic expression of GFP-Sp1 reversed ISO induction of G0/G1 growth arrest (D & E) and inhibition of anchorage-independent growth (C & F) in T24T and UMUC3 cells.

ISO inhibits Sp1 protein translation

Since ISO treatment specifically inhibited endogenous Sp1 expression without altering ectopic GFP-Sp1 protein expression in T24T and UMUC3 cells, we anticipated that the down-regulation of Sp1 expression by ISO treatment might occur at levels of transcriptional, post-transcriptional or translational. We, therefore, examined the potential effects of ISO on Sp1 mRNA expression. The results indicated that ISO treatment did not have any observable effects on Sp1 mRNA expression level, thereby excluding the possibility that ISO treatment modulates Sp1 expression at transcriptional or post-transcriptional levels (Fig. 3A). To further test the notion that ISO treatment might affect Sp1 expression at translational level, we determined the effects of ISO on new Sp1 protein synthesis using short-term ³⁵S-methionine/cysteine pulse-labeling assay in T24T cells following ISO treatment. As expected, the incorporation of ³⁵S-methionine/cysteine into newly synthesized Sp1 protein was gradually elevated along with the incubation time periods in T24T cells, whereas synthesis rate of new Sp1 protein was markedly attenuated in T24T cells that was treated with ISO (Fig. 3B). This result demonstrates that ISO treatment inhibits Sp1 protein translation.

Fig. 3. ISO treatment specifically suppressed Sp1 protein translation.

(A) Total RNA isolated from the T24T cells treated with 10μM ISO for indicated time points, and then subjected to RT-PCR for the determination of Sp1 mRNA expression level. The β-actin was used as a loading control. (B) T24T cells were treated with 10μM ISO, and newly synthesized Sp1 protein was monitored by pulse assay using ³⁵S-labeled methionine/cysteine, and WCL stands for whole cell lysate. Coomassie blue staining was used for protein loading control as described in the section of “Materials and Methods”.

miR-137 induction was crucial for inhibiting Sp1 protein translation by binding to the 3′UTR of Sp1

A large number of regulatory elements in either 3′UTR or 5′-UTR of mRNA have been identified and characterized for their regulation of protein translation (28). To elucidate the mechanisms leading to ISO inhibition of Sp1 protein translation, Sp1 3′UTR luciferase reporter was transiently co-transfected with pRL-TK into T24T and UMUC3 cells, respectively. The transfectants were used to evaluate the effect of ISO on 3′UTR luciferase reporter activity. As shown in Fig. 4A, ISO treatment resulted in a dramatically reduction of Sp1 3′UTR activity in a time-dependent manner in both T24T and UMUC3 cells, indicating that Sp1 mRNA 3′UTR might be regulated by ISO for its inhibition of Sp1 protein translation. micro-RNAs have been reported to bind to mRNA 3′UTR and suppress protein translation (29). Therefore, we used the miRcode, miRWalk and TargetScan database to screen the possible miRNAs that could potential target Sp1 mRNA 3′UTR. The results obtained from comprehensive analysis indicated that miR-29a, miR-29b, miR-29c, miR-137 and miR-145 could have potential binding to 3′UTR of Sp1 mRNA (Fig. 4B). To identify which of these miRNAs was responsible for regulation of Sp1 protein translation, we evaluated these miRNAs expression in the both cell lines treated with ISO. The data showed that ISO treatment induced the expression of miR-145 and miR-137, without affecting the others in both T24T and UMUC3 cells (Figs. 4C&4D), indicating that miR-137 and miR-145 might be involved in down-regulation of Sp1 protein translation followed ISO treatment.

Fig. 4. ISO treatment inhibited Sp1 mRNA 3′UTR activity and induced the expression of miR-137 and miR-145.

(A) Sp1 3′UTR luciferase reporter was transfected into T24T and UMUC3 cells, and the transfectants were treated with ISO (10μM) for indicated time points. The cells were then extracted for determination of luciferase activity. (B) The potential microRNAs binding sites in Sp1 mRNA 3′UTR predictedby the mircode, mirwalk and targetscan database. (C & D) The relative expression levels of microRNAs were evaluated by quantitative real-time PCR in T24T (C) and UMUC3 cells (D) followed ISO (10μM) treatment at the indicated time periods.

To test whether miR-137 and/or miR-145 played a role in regulation of Sp1 protein translation, miR-145 and miR-137 were stably transfected into T24T cells, respectively, and the ectopic expression levels of miR-145 and miR-137 were evaluated by real-time PCR as shown in Figs. 5A & 5B. Over-expression of miR-137 blocked Sp1 3′UTR luciferase reporter activity in a dual-luciferase reporter assay, whereas ectopic expression of miR-145 did not show the observable effect under same experimental conditions (Fig. 5C). Consistently, stable over-expression of miR-137 in UMUC3 also dramatically decreased the Sp1 3′UTR luciferase reporter activity (Figs. 5D&5E). To define whether miR-137 inhibition was due to its specific binding to potential miR-137 binding site at Sp1 mRNA 3′UTR, we constructed mutant of Sp1 3′UTR luciferase reporter as displayed in Fig. 5F. Both wild-type (WT) and mutant of Sp1 3′UTR luciferase reporter were stably transfected into T24T (vector) and T24T (miR-137) transfectants, respectively. As shown in Fig. 5G, miR-137 over-expression significantly reduced wild-type Sp1 3′UTR luciferase reporter activity, while mutation of miR-137 binding site at Sp1 3′UTR luciferase reporter completely attenuated miR-137 inhibition of Sp1 3′UTR luciferase reporter activity, indicating that miR-137 is likely to bind to Sp1 3′UTR direct and regulate Sp1 protein translation. Consistent with miR-137 inhibition of Sp1 3′UTR luciferase reporter activity, over-expression of miR-137 also impaired Sp1 and Cyclin D1 protein expression in both T24T and UMUC3 cells (Fig. 5H) and it did not show any inhibitory effect on exogenous GFP-Sp1 protein expression and GFP-Sp1-mediated Cyclin D1 expression (Fig. 5I).

Fig. 5. Over-expression of miR-137 down-regulated Sp1 and Cyclin D1 protein expression by binding to the Sp1 mRNA 3′UTR.

Over-expression of miR-145 and miR-137 in T24T (A & B) and UMUC3 (D) cells was evaluated by real-time PCR assay. (C & E) miR-137, but not miR-145, specifically inhibited Sp1 3′UTR luciferase reporter activity. (F) Schematic of the construction of miR-137 binding site mutant of pGL3-Sp1 3′UTR luciferase reporter. (G) Attenuation of miR-137 inhibition of sp1 3′UTR luciferase reporter activity in miR-137 binding site mutant of pGL3-Sp1 3′UTR transfectants. (H) Inhibition of Sp1 and Cyclin D1 protein expressions by ectopic expression of miR-137 in T24T and UMUC3 cells. (I) Ectopic expression of GFP-Sp1 reversed the suppression of Cyclin D1 expression caused by miR-137 over-expression in T24T cells.

miR-137 was down-regulated in human bladder cancer tissues and ectopic expression of miR-137 suppressed bladder cancer cell monolayer growth, anchorage-independent growth and induced G0/G1 cell growth arrest in human bladder cancer cells

miR-137 gene locates on chromosome 1p22 and has been reported to be down-regulated in some cancer tissues, such as breast cancer (30), colorectal cancer (31) and non-small cell lung cancer (32). However, the association of miR-137 with human bladder cancer has not been reported yet to the best of our knowledge. To explore this possibility, the expression level of miR-137 in bladder cancer tissues was determined and compared with that in the paired adjacent non-tumourous bladder tissues. The results indicated that miR-137 expression was almost completely impaired in human bladder cancer tissues as compared with that in adjacent normal bladder tissues (Fig. 6A, n=26). To assess the biological role of miR-137 in regulation of human bladder cancer cell growth, we stably transfected miR-137 into T24T cells and the effect of miR-137 over-expression on monolayer growth, anchorage-independent growth and cell cycles were evaluated in comparison with scramble vector transfectants. As shown in Figs. 6B, over-expression of miR-137 could mimic ISO treatment and reduced bladder cancer monolayer growth. Furthermore, over-expression of miR-137 also profoundly inducted G0/G1 growth arrest companied with attenuation of anchorage-independent growth in T24T cells, and these biological effects of miR-137 could be reversed by ectopic expression of GFP-Sp1 (Figs. 6C–6E).

Fig. 6. Down-regulation of miR-137 in human bladder cancer tissues and miR-137 over-expression suppressed anchorage-independent growth and induced G0/G1 growth arrest of human bladder cancer cells.

(A) The relative expression levels of miR-137 in bladder cancer tissues and normal tissues determined by quantitative real-time PCR. Expression was shown as a log₂(miR137/U6) change. (B–D) Over-expressed miR-137 in T24T cells inhibited monolayer growth (B) and induced G0/G1 growth arrest (C) and anchorage-independent growth (D). (E) Ectopic expression of GFP-Sp1 reversed the inhibition of the induction of cell cycle arrest (C) and anchorage-independent growth (E) caused by miR-137 over-expression in T24T cells.

Above results from in vitro human bladder cancer cells demonstrate that miR-137 is induced by ISO treatment, which was crucial for ISO inhibition of Sp1 protein translation by binding to Sp1 mRNA 3′UTR. We next evaluated the ISO effect on miR-137 expression in mouse tumor nodules obtained from in vivo animal studies. The results revealed that miR-137 expression was significantly increased in tumor nodules from mice that were treated with ISO in comparison to these that were treated with control vehicle (Fig. 7A). To provide a direct evidence showing the critical role of miR-137 in ISO inhibition of Sp1 and Cyclin D1 expression as well as in ISO anti-cancer activity, the specific miR-137 inhibitor was stably transfected into T24T cells and the stable transfectants were used to evaluate its role in miR-137 induction by ISO in its inhibition of Sp1 protein expression, Sp1 mRNA 3′UTR activity, Cyclin D1 expression, anchorage-independent growth, as well as the induction of G0/G1 growth arrest in human bladder cancer cells. As illustrated in Fig. 7B, miR-137 inhibitor expression did attenuate miR-137 induction followed ISO treatment. Consistently, the ectopic expression of miR-137 inhibitor also reversed ISO down-regulation of Sp1 3′UTR activity, Sp1 protein expression as well as Cyclin D1 protein expression (Figs. 7C&7D). Moreover, the inhibition of ISO-induced miR-137 expression by miR-137 inhibitor also attenuated ISO induction of G0/G1 cell growth arrest and ISO inhibition of anchorage-independent growth in human bladder cancer T24T cells (Figs. 7E&7F). Collectively, our results clearly demonstrate that ISO-induced miR-137 expression acted as a tumor suppressor by binding to Sp1 mRNA 3′UTR and inhibiting Sp1 protein translation, by which attenuates Cyclin D1 expression, subsequently resulting in cell growth arrest and anchorage-independent growth inhibition in the bladder cancer cells.

Fig. 7. miR-137 inhibitor reversed ISO inhibition of Sp1 and Cyclin D1 protein expression, Sp1 3′UTR activity and anchorage-independent growth, as well as abolished ISO induction of G0/G1 growth arrest in bladder cancer cells.

(A) ISO treatment induced miR-137 expression in tumor nodules from mice (n=6). (B) miR-137 inhibitor inhibited induction of miR-137 by ISO treatment in T24T cells. (C) miR-137 inhibitor reversed ISO inhibition of Sp1 and Cyclin D1 protein expression in T24T cells. (D) miR-137 binding site was crucial for ISO inhibition of Sp1 3′-UTR activity. (E & F) miR-137 inhibitor reversed ISO induction of G0/G1 growth arrest and inhibition of anchorage-independent growth of T24T cells. (G) ISO treatment did not affect miR-137 promoter methylation. (H) The proposed mechanism underlying ISO anti-cancer effect.

DISCUSSION

To acquire more evidences for further translational application of ISO in the management of clinical patients, the in vivo animal verification and extensive mechanistic in vitro studies were carried on in current study. Firstly, the in vivo animal studies demonstrated that the anti-tumor activity of ISO in the subcutaneously transplanted tumor of human bladder cancer in nude mouse model was in line with our previous in vitro studies. Secondly, we consistently highlighted a crucial role of ISO down-regulation of Sp1 protein expression as a key factor mediating its anti-cancer activity both in vivo and in vitro. Our extensive in vitro studies revealed that the anti-cancer effects of ISO was mediated by its down-regulation of Sp1 protein translation via induction of miR-137, which direct binds to Sp1 mRNA 3′UTR region. Although miR-137 expression is reported in a few types of tumors, including colorectal (33), gastric (34), lung (32) and glioblastoma (35), its expression and function in human bladder cancers have not been explored yet to the best of our knowledge. Our studies indicated that miR-137 expression was impaired in human bladder cancer tissues and it acted as a tumor-suppressive miRNA that suppresses the anchorage-independent growth and induces cell cycle G0/G1 arrest in human bladder cancer cells.

Chinese herb Gnetum Cleistostachyum has been used as a traditional Chinese medicine for treatment for arthritis, bronchitis, cardiovascular system disease, and several cancers including bladder cancer almost for a century (36). ISO, a new derivative of stilbene compound, isolated from Gnetum Cleistostachyum and its chemical structure is a 4-methoxyresveratrol (37). Our most recent studies have explored anti-cancer activity of ISO by inducing cell cycle G0/G1 arrest and inhibiting of cancer cell anchorage-independent growth through down-regulating Sp1/Cyclin D1 axis in vitro human bladder cancer cells, suggesting that ISO has a potential being a novel mechanism-based cancer therapeutic agent against human bladder cancer in vitro, and provide a basis for possible clinical utilization of ISO as a preventive and therapeutic agent against bladder cancers in clinical patients (4). However, the research was dearth of in vivo animal verification and extensive in vitro studies. In present studies, xenograft nude mouse model was used for the intensive studies on the anti-cancer effect of ISO in bladder cancers. Consisting with the findings in vitro, our new results obtained from current studies revealed that ISO is a potent agent for its inhibition of the tumor growth in xenograft nude mouse model. We also observed that Sp1 and its regulated Cyclin D1 expression were also down-regulated in transplanted tumor nodules in mice followed with ISO treatment. The further analysis revealed that Sp1 expression, Cyclin D1 expression, and tumor growth were very well positively correlated. Collecting of current in vivo animal studies together with our early in vitro studies demonstrate that ISO is a novel mechanism-based cancer therapeutic agent that mainly targets Sp1/Cyclin D1 axis in human bladder cancers.

Sp1 is an important transcription factor that is involved in the regulation of many gene expressions and cellular functions (6) and is over-expressed in various cancer cell lines and tumor tissues (9–15). Sp1-regulated genes and oncogenes play an important role in cancer cell proliferation, survival, angiogenesis and inflammation (38–41). The transcription factor is ideal for development of mechanism-based drugs since Sp1 expression is associated with aging (42–44). Several drugs that target Sp1 have been identified and these include the nonsteroidal anti-inflammatory drugs (NSAIDs) tolfenamic acid, COX-2 inhibitors and the nitro-NSAID GT-094, and several natural products including betulinic acid (BA), celastrol and the synthetic triterpenoids methyl 2-cyano-3, 12-dioxooleana-a-dien-28-oate (CDDO-Me) and methyl,2-cyano-3,4-dioxo-18β-olean-1,12-dien- 30-oate (CDODA-Me) (41, 45–47). Our previous studies reveal that Sp1 down-regulation is essential for ISO anti-cancer effect on human bladder cancer cells. However, the mechanisms underlying ISO down-regulation of Sp1 was still unknown. It’s reported that clinically used and mechanism-based anticancer drugs down-regulate Sp1 proteins in cancer cell lines through mutiple pathways that are dependent on the drug and cell context (48). For example, curcumin induces proteasome-dependent down-regulation of Sp1 in bladder cancer cells (40), whereas in pancreatic cancer cells, the effect of curcumin on decreased expression of Sp1 are ROS dependent (39, 48). In pancreatic cancer cells, tolfenamic acid induced degradation of Sp1 (49), but differently, curcumin induces ROS- dpendent down-regulation of Sp1 (39, 48). Our current studies demonstrated that ISO treatment specific inhibited Sp1 protein translation without affecting sp1 mRNA level via its induction of miR-137. MicroRNA, ~22 nucleotides noncoding RNAs, has been reported to be negatively regulator mediating gene expression by modulating mRNA stability or suppressing protein translation by binding to its targeting mRNA 3′UTR (29). It is estimated that the expression of at least 30% of human genes are regulated by miRNAs (50). For example, miR-29b inhibits Sp1 expression in tongue squamous cell carcinoma (51). Therefore, we speculated that microRNAs might involve in the ISO down-regulation of Sp1 expression. The induction of microRNAs, including miR-145 and miR-137, were observed in T24T and UMUC3 cells treated with ISO. Ectopic expression of miR-137 but not miR-145 showed suppression of Sp1 mRNA 3′UTR activity and protein expression in human bladder cancer T24T and UMUC3 cells, while mutation of miR-137 binding site in Sp1 mRNA 3′UTR luciferase reporter attenuated miR-137 inhibition of Sp1 mRNA 3′UTR activity, indicating that miR-137 specifically targeting to Sp1 mRNA 3′UTR for its inhibition of Sp1 protein translation, further revealing the identification of Sp1 being a novel miR-137-targeted gene.

miR-137 locates on human chromosome 1p22 and has been implicated to act as a tumor suppressor in several cancer types. Increasing number of miR-137 target genes have been documented and shown to play important roles in various human cancers. For example, Liu S etal. report that miR-137 regulates EMT and inhibits cell migration via down-regulation of Twist1 in gastrointestinal stromal tumor (52). Chen DL et al. demonstrate that miR-137 suppresses tumor progression and metastasis in colorectal cancer (53). Liu LL et al. recently also report that miR-137 suppresses tumor growth and metastasis in human hepatocellular carcinoma by targeting AKT2 (54). The studies from Shimuzu et al. showed that ectopic expression of miR-137 suppresses bladder cancer cell proliferation (27), whereas another studies indicated that over-expression of miR-137 promotes cell proliferation, migration and invasion of bladder cancer cells (55). In our studies presented here, we found that miR-137 expression level in primary human bladder cancer tissues was dramatically down-regulated as compared with their paired adjacent non-tumorous tissues. Further intensive in vitro studies displayed that miR-137 induction was able to induce G0/G1 cell growth arrest and suppresses monolayer cancer cell growth, anchorage-independent growth in bladder cancer cell lines via inhibiting Sp1/Cyclin D1 axis. It is reported that miR-137 promoter region is frequently methylated in primary bladder tumors than in normal urothelium (27). Thus, we propose that miR-137 down-regulation in human bladder cancer tissues might be due to the hypermethylation of its promoter region, while induction of miR-137 in human bladder cancer cells upon ISO treatment might be associated with reduction of miR-137 promoter methylation followed ISO treatment. However, the results obtained from methylation specific PCR showed that miR-137 promoter methylation was not affected upon ISO treatment (Fig. 7G), revealing that ISO induced miR-137 expression was through miR-137 promoter methylation-independent manner. Further investigation of the mechanisms underlying ISO up-regulation of miR-137 will be of highly significant for providing deep insight into understanding anti-cancer effect of ISO, and is now ongoing project in our research program.

In summary, our studies demonstrated that ISO exhibited anti-cancer effect on human bladder cancer experimental system both in vivo and in vitro via its up-regulation of miR-137 expression, which in turn inhibited Sp1 protein translation and subsequently resulting Cyclin D1 protein expression, leading cell cycle G0/G1 arrest and inhibiting anchorage-independent cell growth of human bladder cancer cells as illustrated in Fig. 7H. The comprehensive studies including in vivo and in vitro studies are crucial for potential translational application of ISO in the management of clinical patients, our studies not only provide a novel insight into understanding the anti-cancer activity of ISO, but also reveal that ISO could be used as a therapeutic drug for treatment of human bladder cancer with miR-137 down-regulation.