Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2016 Mar 7;82(6):1778–1788. doi: 10.1128/AEM.03505-15

The Bacteriome of Bat Flies (Nycteribiidae) from the Malagasy Region: a Community Shaped by Host Ecology, Bacterial Transmission Mode, and Host-Vector Specificity

David A Wilkinson a,b,✉, Olivier Duron c, Colette Cordonin a,b, Yann Gomard a,b, Beza Ramasindrazana a,b,e,f,g, Patrick Mavingui b,d, Steven M Goodman f,g, Pablo Tortosa a,b
Editor: H Goodrich-Blairh
PMCID: PMC4784053  PMID: 26746715

Abstract

The Nycteribiidae are obligate blood-sucking Diptera (Hippoboscoidea) flies that parasitize bats. Depending on species, these wingless flies exhibit either high specialism or generalism toward their hosts, which may in turn have important consequences in terms of their associated microbial community structure. Bats have been hypothesized to be reservoirs of numerous infectious agents, some of which have recently emerged in human populations. Thus, bat flies may be important in the epidemiology and transmission of some of these bat-borne infectious diseases, acting either directly as arthropod vectors or indirectly by shaping pathogen communities among bat populations. In addition, bat flies commonly have associations with heritable bacterial endosymbionts that inhabit insect cells and depend on maternal transmission through egg cytoplasm to ensure their transmission. Some of these heritable bacteria are likely obligate mutualists required to support bat fly development, but others are facultative symbionts with unknown effects. Here, we present bacterial community profiles that were obtained from seven bat fly species, representing five genera, parasitizing bats from the Malagasy region. The observed bacterial diversity includes Rickettsia, Wolbachia, and several Arsenophonus-like organisms, as well as other members of the Enterobacteriales and a widespread association of Bartonella bacteria from bat flies of all five genera. Using the well-described host specificity of these flies and data on community structure from selected bacterial taxa with either vertical or horizontal transmission, we show that host/vector specificity and transmission mode are important drivers of bacterial community structure.

INTRODUCTION

Bats are increasingly recognized as natural reservoirs of a large number of emerging infectious agents (1–4). It is thus implicit that vectors of bat-borne disease will play important roles in the epidemiology and dynamics of infectious agents that can eventually emerge in human populations. Further, bats are hosts to different ectoparasites, including mites, fleas, ticks, and bat flies (5, 6). Bat flies (Diptera: Hippoboscoidea) are obligate blood-sucking parasites that are classically divided into two families—the Streblidae and the Nycteribiidae (7). Together, the Hippoboscidae (louse or ked flies), Streblidae, and Nycteribiidae are referred to as the Pupipara sensu stricto due to their adenotrophic viviparity, where all larval developmental stages occur within the adult female's body and the larva are nourished by milk glands until they are ready to pupate. This particularity of the Pupipara sensu stricto is thought to promote vertical parasite transmission, thus influencing the epidemiological role of these vectors in disease transmission.

To date, studies of microorganisms associated with nycteribiids have mainly focused on two groups of bacteria—Bartonella spp. (8–11) and Arsenophonus-like organisms (referred to here as ALOs) (12–15). These bacterial genera offer contrasting model systems for investigating the biotic factors driving the structures of associated microbial communities. Bartonella species are parasitic intracellular bacteria that infect vertebrate erythrocytes, and many species are considered to be zoonotic (16) and are linked to disease in humans (17–20), including the recently identified bat-associated Bartonella mayotimonensis (21). Nycteribiids are known to host a wide variety of Bartonella spp. (10), and contrasting patterns of Bartonella-bat host associations have been described across Africa (8, 9, 22), South America (23–25), Europe (26), and Asia (27).

In contrast, ALOs are symbiotic organisms that are engaged in complex interactions with a variety of arthropod species (28–30). The group making up the ALOs is a monophyletic lineage that includes different genera, such as Arsenophonus, Aschnera, Riesia, and other unnamed groups (ALO-1 to ALO-3) (12–15). In bat flies, ALOs are primary and obligate endosymbionts that are vertically transmitted from infected mothers to offspring due to the presence of bacteriocytes in the milk glands of all nycteribiid species (12–15). It is thought that ALOs may play a role in the provisioning of B vitamins, which are deficient in vertebrate blood, the only food source for these flies (13). The ubiquity of ALOs in bat flies, in which infection is at fixation, corroborates the hypothesis of an obligate endosymbiont (12–15). Such patterns have been found in other exclusive blood-feeding species like bedbugs (31) and tsetse flies (32), two insect groups which rely on a single food source throughout their developmental cycle and harbor beneficial microbes that provide nutrients absent from their restricted diets.

Nycteribiid species show various levels of bat host specificity. For example, a recent study reported a lack of host specificity and genetic structure in Cyclopodia horsfieldi, found on several fruit bats of the genus Pteropus (Pteropodidae) in southeastern Asia (33). On islands in the western Indian Ocean, it has been observed that members of the genera Penicillidia and Nycteribia are relatively promiscuous with respect to their host associations, exchanging freely between several Miniopterus spp. (Miniopteridae) and Myotis goudoti (Vespertilionidae) (5). Interestingly, these insectivorous bat species are often found living in syntopy (in physical contact within day roosts), which likely facilitates vector sharing (34). The picture is rather different for fruit bat flies belonging to the genus Eucampsipoda, which have been observed to uniquely parasitize pteropodids of the genus Rousettus on continental Africa or on islands in the southwestern Indian Ocean (5) despite these bats often sharing caves as day roost sites with other bat species (35). Similarly, Eidolon fruit bats are infested exclusively by flies from the genus Cyclopodia, with Cyclopodia dubia and Cyclopodia greeffi specifically parasitizing Malagasy Eidolon dupreanum and African Eidolon helvum, respectively. Thus, bat fly communities in Madagascar, neighboring islands in the Comoros archipelago, and continental Africa are composed of species that either are specialists (e.g., Eucampsipoda madagascarensis, Eucampsipoda theodori, Eucampsipoda africana, Cyclopodia dubia, and Cyclopodia greeffi found strictly on Rousettus madagascariensis, Rousettus obliviosus, Rousettus aegyptiacus, Eidolon dupreanum, and Eidolon helvum, respectively) or parasitize a broader range of hosts, such as Penicillidia leptothrinax and Nycteribia stylidiopsis, which are found on several Malagasy Miniopterus spp. as well as on Myotis goudoti. Under these interesting biological circumstances, variations in the patterns of infectious agents that transfer between mammalian and arthropod hosts are likely determined by a number of factors, including the specificity of host-vector interactions, the nature of vector-microorganism interactions (ranging from strict parasitism to mutualism), the transmission mode, and the confounding factors of host ecology (Fig. 1).

FIG 1.

FIG 1

Host specificity between bats and bat flies (Nycteribiidae) in Madagascar and the nearby Comoros archipelago (5).

Here, in order to investigate the associations between bacteria and nycteribiids, we have obtained bacterial 16S gene pyrosequencing data from bat flies of the genera Eucampsipoda, Penicillidia, Nycteribia, Cyclopodia, and Basilia (Paracyclopodia), which were taken from bats sampled in the western Indian Ocean region (Madagascar and the Union of the Comoros). We identify a number of previously undescribed bacterial associations within the Nycteribiidae, compare the phylogenetic relationships of some of these novel bacterial taxa, and propose a model for how host-vector-parasite interactions may shape the bacterial communities hosted by these flies.

MATERIALS AND METHODS

Taxon sampling and identification.

Bats were captured using mist nets and harp traps, generally placed at cave entrances, or butterfly nets to obtain individuals from day roost sites in caves. This study was conducted in strict accordance with the terms of research permits issued by national authorities (Direction du Système des Aires Protégées, Direction environment et des Forêts, and Madagascar National Parks [Madagascar] and Centre National de Documentation et de Recherche Scientifique [Union of the Comoros]), following the laws of these countries, and the associated research permit numbers are listed in Acknowledgments. Upon capture, each individual cataloged bat was placed in a separate clean cloth bag until the collection of relevant biological data, and they were examined for ectoparasites. The ectoparasites were collected with forceps and stored in separate vials containing 70% ethanol. Morphological identification of the ectoparasites was carried out using published keys and descriptions (36), and host bat specimens are housed in the Field Museum of Natural History (FMNH) (Chicago, IL) and in the Département de Biologie Animale, Université d'Antananarivo (UADBA) (Antananarivo, Madagascar). A considerable portion of the nycteribiid specimens used here came from a previous study that evaluated the evolutionary origins of bat flies on the Comoro Islands and Madagascar (5). New samples of Cyclopodia dubia and Basilia (Paracyclopodia) sp. were collected on Madagascar from Eidolon dupreanum and Scotophilus spp., respectively, as part of this study.

Nucleic acid extraction and pyrosequencing design.

Nycteribiid flies were removed from ethanol storage and dried and were then crushed using 2- by 2-mm tungsten beads in a TissueLyser (Qiagen). Nucleic acids were extracted using a Qiagen EZ1 robot with the DNA tissue kit, according to the manufacturer's protocol and as previously published (5). Nucleic acids were pooled by species for 16S gene pyrosequencing as detailed in Table S1 in the supplemental material.

The 16S gene pyrosequencing was performed as previously described (37). Briefly, 16S V3 and V4 variable regions were amplified via PCR-specific primers targeting the upstream and downstream regions of the V3 to V4 segment; the 3′ end of forward (TACGGRAGGCAGCAG) and reverse (GGACTACCAGGGTATCTAAT) bacterium-specific primers were bound at the 5′ end by multiplex identifier (MID) tags, a GS FLX key, and GS FLX adapters. The quantity of each PCR product was then determined with PicoGreen, and all products were mixed together in equimolar concentrations before 454 GS FLX sequencing (Genoscreen).

All reads of <250 bp in length were discarded using the Geneious Pro software package (38). Remaining reads were analyzed using the SILVA online next-generation sequencing (NGS) tool (www.arb-silva.de/ngs). Raw sequence reads were aligned with a gap extension penalty of 2 and a gap penalty of 5. Reads were filtered based on the following quality criteria: minimum length, 250 bp; minimum quality score, 30; maximum percent ambiguities, 1%; minimum base pair score, 30; and maximum percent repetitive, 2%. Remaining reads were clustered into operational taxonomic units (OTUs) at a threshold sequence identity of 99%. OTUs were classified by BLAST score comparison against the SILVA rRNA database version 115, with a classification similarity threshold of 93%. OTUs were used exclusively for initial taxonomic interpretations, and all quantitative data were calculated from the numbers of original sequence reads. The statistical significance of differences in proportions of sequence data was calculated by chi-squared comparisons with a Yates correction.

Sequence data and genetic analyses.

Specific gene fragments were amplified using primer pairs detailed in Table 1. Sequence data were analyzed using the Geneious Pro software package (38). All final sequence data were deposited in GenBank, and the relevant accession numbers are listed in Table 2. Coding sequences were aligned in-frame using the Geneious Pro translation align tool and the standard ClustalW cost matrix. Noncoding sequences were aligned using MUSCLE (39). Network analyses were performed in SplitsTree4 (40) using the neighbor-net algorithm. Maximum likelihood phylogenies were generated through RAxML v8.0.0 (41) using the RAxML GUI (v1.3) with 1,000 bootstrap replicates and the GTR+Gamma substitution model as suggested by JModelTest2 (v.2.1.6) (42). Coding sequence alignments were partitioned by base position, and single or multiple outgroup sequences were specified prior to analysis. The best tree outputs from RAxML were used as topology inputs in the R software package, exploiting the ape (43) and vegan (44) packages in order to test evolutionary congruence using the ParaFit algorithm (45). Bacterial phylogenies used for ParaFit analysis contained only sequences obtained in this study and were compared against a host-nycteribiid phylogeny generated based on cytochrome oxidase I (COI) sequence data. COI sequences were taken from reference 5, and data from Cyclopodia dubia and Basilia (Paracyclopodia) sp. were provided by B. Ramasindrazana and S. M. Goodman (unpublished data).

TABLE 1.

Primers used in this study

Description Forward primer Reverse primer Reference/source
16S gene pyrosequencing TAC GGR AGG CAG CAG GGA CTA CCA GGG TAT CTA AT Genoscreen
16S gene, 1,350 bp AGA GTT TGA TCM TGG CTC AG TAC GGY TAC CTT GTT ACG ACT T Unpublished data (P. Tortosa)
Bartonella gltA GGG GAC CAG CTC ATG GTG G AAT GCA AAA AGA ACA GTA AAC A 23
Bartonella 16S AGA GTT TGA TCM TGG CTC AG TAC GGY TAC CTT GTT ACG ACT T 15
Bartonella rpoB CGC ATT GGC TTA CTT CGT ATG GTA GAC TGA TTA GAA CGC TG 62
Enterobacteriales 16S GGG TTG TAA AGT ACT TTC AGT CGT CCT YTA TCT CTA AAG GMT TCG CTG GAT G 51
Rickettsia gltA GGT TTT ATG TCT ACT GCT TCK TG CAT TTC TTT CCA TTG TGC CAT C 63
Wolbachia wsp GTC CAA TAR STG ATG ARG AAA C CYG CAC CAA YAG YRC TRT AAA 49
Wolbachia hcpA GAA ATA RCA GTT GCT GCA AA GAA AGT YRA GCA AGY TCT G 48
Wolbachia fbpA GCT GCT CCR CTT GGY WTG AT CCR CCA GAR AAA AYY ACT ATT C 48
Wolbachia ftsZ ATY ATG GAR CAT ATA AAR GAT AG TCR AGY AAT GGA TTR GAT AT 48

TABLE 2.

GenBank accession numbers for sequences generated as part of this studya

IDb no. Species Host species Host ID no. Country Bartonella gltA Enterobacteriales 16S Rickettsia
Wolbachia
gltA 16S wsp fbpA ftsZ hcpA
SC1 Basilia (Paracyclopodia) sp. Scotophilus marovaza FMNH 221393 Madagascar KT751157 KT751105 KT751166 KT751134 KT751140 KT751163
SC2 Basilia (Paracyclopodia) sp. Scotophilus marovaza FMNH 221393 Madagascar KT751104
SC3 Basilia (Paracyclopodia) sp. Scotophilus marovaza FMNH 221393 Madagascar KT751103 KT751167 KT751135
SC4 Basilia (Paracyclopodia) sp. Scotophilus marovaza FMNH 221393 Madagascar KT751102
1b Basilia (Paracyclopodia) sp. Scotophilus robustus FMNH 209163 Madagascar KT751147 KT751101
1 Cyclopodia dubia Eidolon dupreanum FMNH 221295 Madagascar KT751146 KT751130
2 Cyclopodia dubia Eidolon dupreanum SMG 17826/FMNH 221296 Madagascar KT751129
3 Cyclopodia dubia Eidolon dupreanum SMG 17827/FMNH 221297 Madagascar KT751128
4 Cyclopodia dubia Eidolon dupreanum SMG 17828/FMNH 221298 Madagascar KT751148 KT751127 KT751164 KT751132 KT751138 KT751161
5 Cyclopodia dubia Eidolon dupreanum SMG 17830/UADBA 32975 Madagascar KT751149 KT751126
6 Cyclopodia dubia Eidolon dupreanum SMG 17831/UADBA 32976 Madagascar KT751150 KT751125 KT751165 KT751133 KT751139 KT751162
7 Cyclopodia dubia Eidolon dupreanum SMG 17832/UADBA 32977 Madagascar KT751151 KT751124
8 Cyclopodia dubia Eidolon dupreanum SMG 17833/UADBA 32978 Madagascar KT751123
9 Cyclopodia dubia Eidolon dupreanum SMG 17834/UADBA 32979 Madagascar KT751122
1c Eucampsipoda madagascarensis Rousettus madagascariensis SMG 17698/FMNH 221366 Madagascar KT751120
3b Eucampsipoda madagascarensis Rousettus madagascariensis SMG 17776/UADBA 32967 Madagascar KT751119
2c Eucampsipoda madagascarensis Rousettus madagascariensis SMG 17777/UADBA 32968 Madagascar KT751158
10 Eucampsipoda madagascarensis Rousettus madagascariensis SMG 17780/UADBA 32971 Madagascar KT751118
6c Eucampsipoda madagascarensis Rousettus madagascariensis SMG 17783/UADBA 32974 Madagascar KT751159
5c Eucampsipoda madagascarensis Rousettus madagascariensis SMG 17781/UADBA 32972 Madagascar KT751131
14c Eucampsipoda madagascarensis Rousettus madagascariensis SMG 17931/UADBA 33647 Madagascar KT751121
J50 Eucampsipoda madagascarensis Rousettus madagascariensis SMG 16259/FMNH 209105 Madagascar KT751117
J13 Eucampsipoda theodori Rousettus obliviosus SMG16715/FMNH 220041 Union of the Comoros KT751116
J14 Eucampsipoda theodori Rousettus obliviosus SMG 16715/FMNH 220041 Union of the Comoros KT751115
J22 Eucampsipoda theodori Rousettus obliviosus SMG 16751/FMNH 220043 Union of the Comoros KT751156
GR16 Nycteribia stylidiopsis Miniopterus gleni SMG 17841/UADBA 33030 Madagascar KT751152 KT751108
GR17 Nycteribia stylidiopsis Miniopterus gleni SMG 17841/UADBA 33030 Madagascar KT751107
GR15 Nycteribia stylidiopsis Miniopterus gleni SMG 17841/UADBA 33030 Madagascar KT751109
GR12 Nycteribia stylidiopsis Miniopterus gleni SMG 17846/FMNH 221333 Madagascar KT751110
GR6 Nycteribia stylidiopsis Miniopterus griveaudi SMG 17654/UADBA 32960 Madagascar
GR8 Nycteribia stylidiopsis Miniopterus griveaudi SMG 17682/UADBA 32962 Madagascar KT751113
GR9 Nycteribia stylidiopsis Miniopterus griveaudi SMG 17689/FMNH 221413 Madagascar KT751111, KT751112
2b Nycteribia stylidiopsis Miniopterus griveaudi SMG 17759/FMNH 221343 Madagascar KT751114
GR19 Nycteribia stylidiopsis Miniopterus griveaudi SMG 17761/UADBA 33004 Madagascar KT751106
11b Penicillidia leptothrinax Miniopterus griveaudi SMG17860/FMNH 221354 Madagascar KT751097
11c Penicillidia leptothrinax Miniopterus aelleni SMG 17922/FMNH 221440 Madagascar KT751143
GR20 Penicillidia leptothrinax Miniopterus griveaudi SMG 17757/FMNH 221341 Madagascar KT751153
GR18 Penicillidia leptothrinax Miniopterus griveaudi SMG 17772/UADBA 33015 Madagascar KT751093, KT751094 KT751171
J35 Penicillidia leptothrinax Miniopterus petersoni SMG16806/FMNH 209186 Madagascar KT751092
J38 Penicillidia leptothrinax Miniopterus petersoni SMG 16806/FMNH 209186 Madagascar KT751160
12b Penicillidia leptothrinax Miniopterus sp. SMG 17865/UADBA 33032 Madagascar KT751096
12 Penicillidia leptothrinax Miniopterus sp. SMG 17866/UADBA 33033 Madagascar KT751144
13 Penicillidia leptothrinax Miniopterus cf. ambohitrensis SMG17867/UADBA 33034 Madagascar KT751095
13b Penicillidia leptothrinax Miniopterus sp. SMG 17866/UADBA 33033 Madagascar KT751145 KT751169 KT751136 KT751141
18b Penicillidia leptothrinax Miniopterus sp. SMG 17884/FMNH 221429 Madagascar KT751170 KT751137 KT751142
GR21 Penicillidia sp. (cf. fulvida) Miniopterus griveaudi SMG 17753/FMNH 221337 Madagascar KT751154 KT751098, KT751099
9b Penicillidia sp. (cf. fulvida) Miniopterus sp. SMG 17878/FMNH 221423 Madagascar KT751100
a

Geographical, arthropod, and bat host information is also presented, along with laboratory and museum identifier codes for the host mammal.

b

ID, identification.

Nucleotide sequence accession numbers.

All PCR-generated sequences in this study were submitted to GenBank under the accession numbers given in Table 2.

RESULTS

Bacterial community composition as revealed by 16S gene pyrosequencing.

Pyrosequencing data were obtained from seven independent samples that originated from seven nycteribiid species: Eucampsipoda madagascarensis, Eucampsipoda theodori, Penicillidia sp. cf. fulvida (a Penicillidia sp. that looks like Penicillidia fulvida), Penicillidia leptothrinax, Nycteribia stylidiopsis, Cyclopodia dubia, and Basilia (Paracyclopodia) sp. Samples contained pooled DNA that was extracted from different numbers of nycteribiid flies. A summary of sample composition, as well as the statistics of pyrosequencing data acquisition, including numbers of reads obtained and quality control results, is presented in Table S1 in the supplemental material.

We then analyzed bacterial diversity at the class level. The bacterial communities associated with all bat fly samples were dominated by three bacterial phyla, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria, which represented 17%, 3%, and 78% of total sequences, respectively. The vast majority of Betaproteobacteria were observed in Eucampsipoda theodori and showed the closest similarity to uncultured bacteria of the family Neisseriaceae. The majority of Neisseriaceae are common commensal bacteria that are often associated with mammals, but Neisseria gonorrhoeae and Neisseria meningitides are the known causative agents of gonorrhea and meningococcal meningitis in humans, respectively.

Of the sequences identified as Alphaproteobacteria, 55% came from Wolbachia, 26% came from Bartonella, and 17% came from Rickettsia. Nearly all Gammaproteobacteria (>99%) came from the order Enterobacteriales, and for all bat fly species but one (Cyclopodia dubia), they were mostly distributed between two genera, Arsenophonus and Aschnera, which clearly belong to the ALO group (12–15). The case of Cyclopodia dubia is subtly different; on the basis of a BLAST search, most of the bacterial sequences from this bat fly species were found to have identity to Enterobacteriales members other than ALOs, such as Providencia, Erwinia, and Dickeya. Interestingly, the bacteria originating from Cyclopodia dubia may actually form a new Enterobacteriales group (see below).

Bacterial community data are summarized in Fig. S1 in the supplemental material.

We then further investigated bacterial taxa by sequencing additional loci. Taxa were selected because of their possible medical importance, such as the genera Rickettsia and Bartonella because of their relation to pathogenic strains causing rickettsioses and bartonellosis, respectively, or because they were common to multiple species of nycteribiid fly and represented a significant proportion of the total number of reads obtained by pyrosequencing, such as Wolbachia and Enterobacteriales (threshold retrospectively set at 2.5% of the total number of reads).

Rickettsia.

During pyrosequencing, 16S sequences closely related to Rickettsia were obtained from Eucampsipoda madagascarensis and Penicillidia leptothrinax. These sequences represented 5.5% and 15.3% of reads in Eucampsipoda madagascarensis and Penicillidia leptothrinax, respectively. The gltA locus of Rickettsia was amplified from Eucampsipoda madagascarensis and Penicillidia leptothrinax samples. Classification using BLASTx showed that the obtained gltA sequences showed little homology to known species of Rickettsia, with the strongest match showing 90% identity to gltA from Rickettsia raoultii, a bacterium identified in hard ticks from China (46). In addition, a 1,350-bp fragment of the 16S gene of Rickettsia was amplified from Eucampsipoda madagascarensis. Although the phylogeny of Rickettsia could only be poorly resolved based on these data (not shown), sequence similarity was strongest with Rickettsia gravesii, Rickettsia barbariae, and Rickettsia tarasevichiae, bacteria previously shown to be associated with hard ticks belonging to the genera Amblyomma and Ixodes.

Wolbachia.

Pyrosequencing of the 16S locus revealed that Wolbachia was present in all sampled fly species except Eucampsipoda madagascariensis and Eucampsipoda theodori. The percentage of reads matching Wolbachia ranged from <1% in Nycteribia stylidiopsis to nearly 40% in Basilia (Paracyclopodia) sp. PCR-based screening using the wsp system (47) was then used to test individual nycteribiid samples for the presence of Wolbachia. In accordance with the pyrosequencing results, Wolbachia was identified in Penicillidia leptothrinax (14/23; 61%), Penicillidia sp. (cf. fulvida) (1/1; 100%), Cyclopodia dubia (6/9; 67%), and Basilia (Paracyclopodia) sp. (5/5; 100%).

A selection of DNA fragments from the Wolbachia wsp, fbpA, ftsZ, and hcpA genes (48) was amplified from Cyclopodia dubia, Basilia (Paracyclopodia) sp., and Penicillidia leptothrinax. Sequence data were additionally obtained from the wsp gene of Wolbachia from Penicillidia sp. (cf. fulvida), showing 100% identity to those sequences obtained from Wolbachia infecting Penicillidia leptothrinax; however, attempts to amplify other loci were unsuccessful for these samples. As has been observed elsewhere (49, 50), network analysis of wsp gene data against reference sequences from the Wolbachia multilocus sequence typing (MLST) database (http://pubmlst.org/wolbachia/) suggested high levels of diversification and recombination between Wolbachia spp. from well-defined phylogenetic groups (see Fig. S2 in the supplemental material), and thus, the wsp gene data were abandoned for phylogenetic characterization of the sequences obtained from our bat fly samples.

Network and phylogenetic analyses of concatenated sequences (fbpA, ftsZ, and hcpA) suggested that all identified bat fly Wolbachia species belong to the F subgroup (Fig. 2). Sequence types from different nycteribiid species were grouped by host species and were paraphyletic, sharing identity with Wolbachia strains from multiple host types and geographical origins, which is suggestive of independent evolutionary histories and multiple introductions of Wolbachia into bat fly populations.

FIG 2.

FIG 2

Wolbachia network analysis and group F phylogeny. The presented analyses are based on concatenation of three gene loci (fbpA::ftsZ::hcpA); reference data were acquired from the Wolbachia MLST database (http://pubmlst.org/wolbachia/). The presented network structure was generated from aligned sequence data in SplitsTree4 using the neighbor-net algorithm. The phylogenetic tree was produced using RAxML, and bootstrap support from 1,000 replicates is indicated by dots of different sizes on each internal node. Sequences from this study are highlighted in red, orange, and blue, representing host origins from Cyclopodia dubia, Basilia (Paracyclopodia) sp., and Penicillidia leptothrinax, respectively. Asterisks indicate that the hcpA region was missing from the sequence data originating from P. leptothrinax. However, it should be noted that identical, but less well supported, topologies were generated when using only fbpA and ftsZ (data not shown).

Arsenophonus-like organisms.

The Enterobacteriales were by far the most predominant bacterial taxa identified in pyrosequencing analyses, with 73% of all sequencing data identified as either ALOs or as a new and unnamed Enterobacteriales group. Further 16S data were obtained from multiple samples of each nycteribiid species. Network analysis was performed using reference strains listed in Table S2 in the supplemental material. Nycteribiid endosymbionts belonging to the Enterobacteriales fell into three distinct groups (Fig. 3). Insectivorous bat-associated Nycteribia and Penicillidia possessed ALOs associated with the Aschnera subgroup, whereas fruit bat-associated Eucampsipoda and insectivorous bat-associated Basilia (Paracyclopodia) sp. possessed ALOs belonging to the Arsenophonus subgroup. Interestingly, network analysis suggested that the endosymbionts from Cyclopodia dubia form their own, new group within the Enterobacteriales family, which is closely related to the known ALO members (Cyclopodia group in Fig. 3).

FIG 3.

FIG 3

Enterobacteriales network diagram generated from 16S gene sequence data. The presented network structure was generated from aligned sequence data in SplitsTree4 using the neighbor-net algorithm. The Cyclopodia group contained only sequences from this study and refers to a newly identified taxon of the Enterobacteriales, all originating from C. dubia. Sequences used to generate this representation can be found in Tables S3 and S4 in the supplemental material. All sequences from bat flies in this study are indicated by colored circles, as identified in the key.

Bartonella.

Bartonella sequences were detected by pyrosequencing in all bat fly species. Eucampsipoda theodori, the only bat fly in this study from the Union of the Comoros and parasitizing Rousettus obliviosus, showed significantly higher proportions of sequences from Bartonella (P < 0.0001) than those of its sister species Eucampsipoda madagascarensis from Madagascar occurring on Rousettus madagascariensis. The percentage of reads derived from Bartonella ranged from <1% in Basilia (Paracyclopodia) sp., Penicillidia leptothrinax, and Nycteribia stylidiopsis to 17.4% in Eucampsipoda theodori.

The gltA locus was amplified from these nycteribiid samples. Only 15 sequences that demonstrated clear identity to unambiguously annotated Bartonella strains in BLAST searches and that were monophyletic (with Bartonella reference sequences in preliminary phylogenetic studies) were retained for analysis. Bartonella sequences were obtained from all bat fly species except Eucampsipoda madagascarensis. Additional Bartonella-specific amplifications based on the 16S and rpoB loci were also attempted but were largely unsuccessful.

The gltA sequences obtained from the nycteribiids of Madagascar and the Comoros archipelago were seen to cluster into five distinct groups (Fig. 4). Potential limitations of the gltA locus have been discussed elsewhere (10).

FIG 4.

FIG 4

Bartonella phylogeny based on the gltA locus, generated using 1,000 bootstrap replicates in RAxML. Dots on internal nodes represent bootstrap support of >0.75. Sequences from this study, and similar bat- and bat fly-associated sequences from other studies, are grouped into monophyletic groups by color. Bats drawn on leaves indicate sequences that originated from bats or bat fly specimens. The key at the bottom of the figure details bat fly and host bat origins of the associated sequences. Abbreviations used for bat flies are as follows: Cy., Cyclopodia; Eu., Eucampsipoda; P, Penicillidia; N, Nycteribia. Abbreviations used for bats are as follows: Ei., Eidolon; Mi., Miniopterus; My., Myotis; R., Rousettus; Sc., Scotophilus. Numbers in parentheses represent the numbers of identical sequences that were grouped into operational taxonomic units in RAxML.

Evolutionary congruence.

The global-fit method, ParaFit, was used to test the hypothesis of evolutionary congruence between nycteribiids and the bacteria detected in this study, by comparing phylogenetic structures to those obtained using COI data from bat flies. ALOs demonstrated a significant level of congruence (P < 0.001), whereas congruence was not significant for Bartonella (Table 3). As the topological structure may result from a difference in levels of polymorphism of the chosen markers (16S for ALOs and gltA for Bartonella), we compared their nucleotide diversities (pi value) using DnaSP v5 (http://www.ub.edu/dnasp/). This revealed that 16S was actually less polymorphic than gltA (pi, 0.056 and 0.117 for 16S and gltA, respectively), thus allowing us to reject the hypothesis of an artifactual topology of ALOs resulting from higher resolution of the 16S locus. It was not possible to test Wolbachia or Rickettsia lineages using this methodology due to the limited number of relevant bacterial taxa identified in nycteribiid hosts.

TABLE 3.

Evolutionary congruence between Nycteribiidae and associated bacteriaa

Parameter Wolbachia Arsenophonus-like organisms Bartonella
ParaFit Global NAb 0.087 0.060
P value NA 0.001 0.172
a

Congruence testing for Wolbachia was not possible due to the presence of only three independent taxa.

b

NA, not available.

DISCUSSION

Here, we provide characterization of the bacterial microbiota associated with numerous species of Nycteribiidae bat flies occurring in Madagascar and the nearby Comoros archipelago and provide more detailed taxonomic information for some bacterial taxa of particular interest.

Bacterial communities associated with the nycteribiid bat fly genera Eucampsipoda, Penicillidia, Nycteribia, Cyclopodia, and Basilia (Paracyclopodia) were described by pyrosequencing of the 16S locus. Variation was found in community composition in different species of Nycteribiidae; however, these may be due to stochastic infection effects, differences in sample pooling between species, and/or limits in sequencing repeatability. It should also be noted that taxon sampling was subject to amplification bias due to the primers used to amplify the 16S locus (see Table S1 in the supplemental material). Although we cannot quantify the significance of these effects, our data suggest that the vast majority of bacterial diversity in all samples can be described by the presence of not more than two bacterial classes—the Alphaproteobacteria and the Gammaproteobacteria. While the ALOs (Gammaproteobacteria) have been previously described as obligate, primary symbionts in bat flies (12–15), the nature of the interactions between other bacteria and bat flies remains unknown. The overall homogeneity of the bacterial community structure across nycteribiid species, independent of bat host species, suggests that infection is not merely opportunistic, but selected and commonly occurring taxa likely form beneficial, positively selected interactions with their arthropod hosts. On the other hand, strongly significant differences between samples from Madagascar and the Comoros archipelago (Betaproteobacteria in Eucampsipoda theodori) suggest that environmental variables will also determine which interactions can be sustained.

Our results along with previous studies (12–15) corroborate the widespread presence of ALOs in bat flies while identifying a likely new genus of endosymbiont of the Enterobacteriales that infects the fruit bat (Eidolon dupreanum)-associated nycteribiid Cyclopodia dubia. While ALOs, and especially Arsenophonus, are globally common symbionts estimated to infect ca. 5% of insect species (28, 51), we further confirm that bat flies harbor the highest diversity of Enterobacteriales strains reported to date (Arsenophonus, Aschnera, and the Cyclopodia-associated group). We also found congruent patterns of codivergence between bat flies and ALOs, a result likely due to the association between members of the Nycteribiinae subfamily (which includes Penicillidia leptothrinax, Penicillidia sp. [cf. fulvida], and Nycteribia stylidiopsis) and Aschnera, which are known to have codiverged over a long evolutionary period (8, 26). However, the evolutionary history of these endosymbionts in bat flies is complex; all strains found here do not cluster within a specific bat fly clade but rather exhibit distinct evolutionary origins showing that they underwent repeated horizontal transfer between distantly related host species. This pattern is well illustrated by the presence, in some bat fly species, of Arsenophonus strains, which are closely related to strains from very diverse insect species, such as aphids and parasitoid wasps. Two distinct evolutionary strategies are thus acting on ALO endosymbiosis; Aschnera is highly specialized with regard to its hosts, with ancient acquisition followed by codiversification, while Arsenophonus is more generalist and acquired through recent horizontal transfers. The presence of a previously unidentified group of bacteria in Cyclopodia dubia testifies to the diverse nature of symbiotic interactions, and further work will be required to better understand how these findings modify our understanding of the evolutionary history of nycteribiid-endosymbiont interactions.

The genus Wolbachia was observed to infect Penicillidia spp., Cyclopodia dubia, and Basilia (Paracyclopodia) sp. This common reproductive manipulator has previously been identified in bat flies (13); however, it is of note that we observe Wolbachia in multiple nycteribiid species. Interestingly, all Wolbachia species that were identified in bat flies belonged to the F supergroup, an emerging supergroup of Wolbachia that has been associated with a broad spectrum of arthropod hosts, including the orders Scorpiones, Blattodea, Coleoptera, Hemiptera, Isoptera, Neuroptera, Orthoptera, Phthiraptera, Thysanoptera (52), and Diptera (the order containing the Nycteribiidae), which are more commonly associated with supergroups A and B (51, 53). Eucampsipoda did not harbor Wolbachia, and only a subset of bat flies infesting insectivorous bats tested positive for Wolbachia, showing that, unlike the ALOs, Wolbachia is not an obligate endosymbiont of nycteribiid flies. Although the number of samples that could be sequenced in greater detail was relatively limited, nycteribiid-Wolbachia sequences appeared to be species specific but paraphyletic through MLST analyses, suggesting multiple introductions of independent lineages to different nycteribiid species. However, a common lineage of Wolbachia was observed in Penicillidia leptothrinax and Penicillidia sp. (cf. fulvida). Facultative association between nycteribiid Wolbachia suggests that their interaction over evolutionary history is more recent than that of the ALOs despite the fact that fluorescence in situ hybridization-based physiological studies suggest a common mechanism of vertical transmission for all nycteribiid bacterial endosymbionts (13). This is in keeping with observations in other arthropod species, where Wolbachia strains are seen to have complex phylogenetic histories due to their dual capacity to form stable coexisting mixed populations within arthropod communities (54, 55) and to invade entire populations by manipulating host reproduction (56). While the potential of Wolbachia to manipulate the reproduction of bat flies is unknown, it is interesting to note that a recent study observed biased sex ratios in bat fly populations (Trichobius frequens) in Puerto Rico (57).

The data generated in this study also add to the knowledge of the increasing diversity of Bartonella subgroups that are associated with bat flies and their bat hosts. It is generally thought that Bartonella species demonstrate specificity to mammalian hosts; however, the exact role of vector-host specificity in establishing host-specific interactions is not fully understood (58). Here, the detection of Bartonella in all tested bat fly species adds credence to the theory that Bartonella and bat flies may form mutually beneficial, positively selected interactions, which may drive host specificity. However, the lack of evolutionary congruence between Bartonella and the Nycteribiidae suggests that any selective benefit is insufficient to generate stable symbiosis despite their likely ability to be transferred vertically from mother to pupa. In the case of the insectivorous bat-infesting Nycteribiidae of Madagascar and the Comoros, transmission through blood-feeding is likely to play a direct role in the horizontal transfer of Bartonella, as multiple nycteribiid flies (i.e., Nycteribia spp. and Penicillidia spp.) feed on the same bat hosts (5). This was seen to be the case here as, for example, a single clade in our phylogenetic analysis (colored orange in Fig. 4) contained Bartonella variants from Nycteribia and Penicillidia as well as from five different bat species. However, the same phylogenetic analysis also suggested exchange between Cyclopodia dubia and Basilia (Paracyclopodia) sp. (group colored blue in Fig. 4), taxa which are not known to interact directly or with the same bat host species. This suggests that other direct or indirect mechanisms may promote exchange between hosts and thus drive the intraspecific diversity of Bartonella observed within the Nycteribiidae. This is in contrast with other members of the Pupipara sensu stricto; ked flies, blood-sucking vectors of ungulates, are thought to form strict interactions with Bartonella, which have resulted in host-specific associations (10). The difference between these two situations is likely not related to vector host specificity, as members of the family Hippoboscidae are highly adapted to their respective hosts (59). Instead, we can imagine that the ecology of different bat hosts may promote the diversity of Bartonella within the Nycteribiidae, where host populations that more frequently come into contact with other hosts undergo more frequent horizontal exchange. This may help explain global Bartonella diversity as well as the previously reported regional differences in host specificity between Bartonella and bats (see the introduction).

Overall, a relatively low diversity of bacteria was seen to be associated with the studied bat flies from Madagascar and the Comoros, with the principal infecting taxa being the Enterobacteriales, Bartonella, and Wolbachia. Various patterns of intraspecific genetic diversity were observed between these models, which we explain by differences in the nature of the bacterium-nycteribiid endosymbiotic relationship, transmission mode, host-vector specificity, and variations in the associated bat host ecology (Fig. 5). The transmission modes of these three bacterial taxa vary; while all three are thought to be transferred vertically from mother to pupa during adenotrophic viviparity, only Bartonella may be transferred in the blood of the bat hosts. Bartonella species, where the highest levels of intraspecific genetic diversity were observed, thus have the opportunity for direct horizontal transfer due to bat fly host promiscuity and may also be transferred by bat-host interactions that are independent of these ectoparasites, such as with other blood-feeding vectors (e.g., Streblidae, mites, or fleas) or habitat overlap with other hosts. The frequency of horizontal transfer of Bartonella is thus likely to be influenced by ecological factors, such as the breeding seasonality of bats as well as their migration patterns, geographical distribution, and colony population size and structure. In contrast, the Enterobacteriales form strict, primary endosymbiotic relationships with their nycteribiid hosts, but evidence of horizontal transfer between hosts that infest the same bat species may be observed, suggesting that proximity likely drives the frequency of horizontal endosymbiont exchange.

FIG 5.

FIG 5

Factors affecting speciation patterns and monospecific microorganism diversity for different host-associated microorganisms.

In conclusion, while the global bacterial community structure associated with the Nycteribiidae is likely primarily driven by the establishment of mutually beneficial relationships between microorganism and host, the origins and evolution of these associations are complex. Additionally, host-associated microorganisms are known to interact (60), and bacterial community structure in insects may be influenced positively by cooperation or negatively by competition or exclusion and in turn may affect the biology of their hosts (reviewed in references 61 and 12). Bartonella species appear to be the only bacteria with known pathogenic potential that form strict relationships with the tested Nycteribiidae bat flies, suggesting that these arthropods may be a true reservoir of Bartonella infection. The presence of other likely pathogenic bacteria such as Rickettsia is only anecdotal and may even remain detrimental to the health of these arthropods. However, these unique vectors remain fascinating from an epidemiological point of view due to the diverse nature of the interactions that they form, especially in tropical settings.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We are grateful to the Département de Biologie Animale, Université d'Antananarivo, the Direction du Système des Aires Protégées, Direction Générale de l'Environnement et des Forêts, and Madagascar National Parks (Madagascar) and to the Centre National de Documentation et de Recherche Scientifique (Union of the Comoros) for kindly providing research and export permits (194/12/MEF/SG/DGF/DCB.SAP/SCB, 032/12/MEF/SG/DGF/DCB.SAP/SCBSE, 283/11/MEF/SG/DGF/DCB.SAP/SCB, 067/12/MEF/SG/DGF/DCB.SAP/SCBSE).

D. A. Wilkinson's postdoctoral fellowship was funded by the European Regional Development Funds ERDF-POCT, La Réunion, ParamyxOI project. B. Ramasindrazana received his postdoctoral fellowship from the RunEmerge project funded by the European Frame work program FP7 Capacities/Regpot and postdoctoral grants from “Fonds de Coopération Régionale” of the Préfecture de La Réunion and from the Ralph and Marian Falk Medical Research Trust to The Field Museum of Natural History, Chicago. This work was supported by European Regional Development Fund/Programme Opérationnel de Coopération Territoriale Réunion, Pathogènes associés à la Faune Sauvage Océan Indien 31189.

Funding Statement

European Commission (EC) provided funding to David Arthur Wilkinson, Colette Cordonin, Yann Gomard, Beza Ramasindrazana, and Pablo Tortosa under the grant RunEmerge.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.03505-15.

REFERENCES

  • 1.Luis AD, Hayman DT, O'Shea TJ, Cryan PM, Gilbert AT, Pulliam JR, Mills JN, Timonin ME, Willis CK, Cunningham AA, Fooks AR, Rupprecht CE, Wood JL, Webb CT. 2013. A comparison of bats and rodents as reservoirs of zoonotic viruses: are bats special? Proc Biol Sci 280:20122753. doi: 10.1098/rspb.2012.2753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Lagadec E, Gomard Y, Guernier V, Dietrich M, Pascalis H, Temmam S, Ramasindrazana B, Goodman SM, Tortosa P, Dellagi K. 2012. Pathogenic Leptospira spp. in bats, Madagascar and Union of the Comoros. Emerg Infect Dis 18:1696–1698. doi: 10.3201/eid1810.111898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wilkinson DA, Melade J, Dietrich M, Ramasindrazana B, Soarimalala V, Lagadec E, le Minter G, Tortosa P, Heraud JM, de Lamballerie X, Goodman SM, Dellagi K, Pascalis H. 2014. Highly diverse morbillivirus-related paramyxoviruses in wild fauna of the southwestern Indian Ocean Islands: evidence of exchange between introduced and endemic small mammals. J Virol 88:8268–8277. doi: 10.1128/JVI.01211-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lei BR, Olival KJ. 2014. Contrasting patterns in mammal-bacteria coevolution: Bartonella and Leptospira in bats and rodents. PLoS Negl Trop Dis 8:e2738. doi: 10.1371/journal.pntd.0002738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tortosa P, Dsouli N, Gomard Y, Ramasindrazana B, Dick CW, Goodman SM. 2013. Evolutionary history of Indian Ocean nycteribiid bat flies mirroring the ecology of their hosts. PLoS One 8(9):e75215. doi: 10.1371/journal.pone.0075215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Dick CW, Gettinger D, Gardner SL. 2007. Bolivian ectoparasites: a survey of bats (Mammalia chiroptera). Compar Parasitol 74:372–377. doi: 10.1654/4264.1. [DOI] [Google Scholar]
  • 7.Morand S, Krasnov BR, Poulin R. 2006. Micromammals and macroparasites: from evolutionary ecology to management. Springer, New York, NY. [Google Scholar]
  • 8.Bai Y, Hayman DT, McKee CD, Kosoy MY. 2015. Classification of Bartonella strains associated with straw-colored fruit bats (Eidolon helvum) across Africa using a multi-locus sequence typing platform. PLoS Negl Trop Dis 9:e0003478. doi: 10.1371/journal.pntd.0003478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kamani J, Baneth G, Mitchell M, Mumcuoglu KY, Gutierrez R, Harrus S. 2014. Bartonella species in bats (Chiroptera) and bat flies (Nycteribiidae) from Nigeria, West Africa. Vector Borne Zoonotic Dis 14:625–632. doi: 10.1089/vbz.2013.1541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Morse SF, Olival KJ, Kosoy M, Billeter S, Patterson BD, Dick CW, Dittmar K. 2012. Global distribution and genetic diversity of Bartonella in bat flies (Hippoboscoidea, Streblidae, Nycteribiidae). Infect Genet Evol 12:1717–1723. doi: 10.1016/j.meegid.2012.06.009. [DOI] [PubMed] [Google Scholar]
  • 11.Billeter SA, Hayman DT, Peel AJ, Baker K, Wood JL, Cunningham A, Suu-Ire R, Dittmar K, Kosoy MY. 2012. Bartonella species in bat flies (Diptera: Nycteribiidae) from western Africa. Parasitology 139:324–329. doi: 10.1017/S0031182011002113. [DOI] [PubMed] [Google Scholar]
  • 12.Duron O, Schneppat UE, Berthomieu A, Goodman SM, Droz B, Paupy C, Nkoghe JO, Rahola N, Tortosa P. 2014. Origin, acquisition and diversification of heritable bacterial endosymbionts in louse flies and bat flies. Mol Ecol 23:2105–2117. doi: 10.1111/mec.12704. [DOI] [PubMed] [Google Scholar]
  • 13.Hosokawa T, Nikoh N, Koga R, Sato M, Tanahashi M, Meng XY, Fukatsu T. 2012. Reductive genome evolution, host-symbiont co-speciation and uterine transmission of endosymbiotic bacteria in bat flies. ISME J 6:577–587. doi: 10.1038/ismej.2011.125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Morse SF, Dick CW, Patterson BD, Dittmar K. 2012. Some like it hot: evolution and ecology of novel endosymbionts in bat flies of cave-roosting bats (Hippoboscoidea, Nycterophiliinae). Appl Environ Microbiol 78:8639–8649. doi: 10.1128/AEM.02455-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Morse SF, Bush SE, Patterson BD, Dick CW, Gruwell ME, Dittmar K. 2013. Evolution, multiple acquisition, and localization of endosymbionts in bat flies (Diptera: Hippoboscoidea: Streblidae and Nycteribiidae). Appl Environ Microbiol 79:2952–2961. doi: 10.1128/AEM.03814-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Jiyipong T, Jittapalapong S, Morand S, Raoult D, Rolain JM. 2012. Prevalence and genetic diversity of Bartonella spp. in small mammals from Southeastern Asia. Appl Environ Microbiol 78:8463–8466. doi: 10.1128/AEM.02008-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Margileth AM, Baehren DF. 1998. Chest-wall abscess due to cat-scratch disease (CSD) in an adult with antibodies to Bartonella clarridgeiae: case report and review of the thoracopulmonary manifestations of CSD. Clin Infect Dis 27:353–357. doi: 10.1086/514671. [DOI] [PubMed] [Google Scholar]
  • 18.Kordick DL, Hilyard EJ, Hadfield TL, Wilson KH, Steigerwalt AG, Brenner DJ, Breitschwerdt EB. 1997. Bartonella clarridgeiae, a newly recognized zoonotic pathogen causing inoculation papules, fever, and lymphadenopathy (cat scratch disease). J Clin Microbiol 35:1813–1818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kerkhoff FT, Bergmans AM, van Der Zee A, Rothova A. 1999. Demonstration of Bartonella grahamii DNA in ocular fluids of a patient with neuroretinitis. J Clin Microbiol 37:4034–4038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bai Y, Kosoy MY, Diaz MH, Winchell J, Baggett H, Maloney SA, Boonmar S, Bhengsri S, Sawatwong P, Peruski LF. 2012. Bartonella vinsonii subsp. arupensis in humans, Thailand. Emerg Infect Dis 18:989–991. doi: 10.3201/eid1806.111750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Veikkolainen V, Vesterinen EJ, Lilley TM, Pulliainen AT. 2014. Bats as reservoir hosts of human bacterial pathogen, Bartonella mayotimonensis. Emerg Infect Dis 20:960–967. doi: 10.3201/eid2006.130956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kosoy M, Bai Y, Lynch T, Kuzmin IV, Niezgoda M, Franka R, Agwanda B, Breiman RF, Rupprecht CE. 2010. Bartonella spp. in bats, Kenya. Emerg Infect Dis 16:1875–1881. doi: 10.3201/eid1612.100601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bai Y, Kosoy M, Recuenco S, Alvarez D, Moran D, Turmelle A, Ellison J, Garcia DL, Estevez A, Lindblade K, Rupprecht C. 2011. Bartonella spp. in bats, Guatemala. Emerg Infect Dis 17:1269–1272. doi: 10.3201/eid1707.101867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bai Y, Recuenco S, Gilbert AT, Osikowicz LM, Gomez J, Rupprecht C, Kosoy MY. 2012. Prevalence and diversity of Bartonella spp. in bats in Peru. Am J Trop Med Hyg 87:518–523. doi: 10.4269/ajtmh.2012.12-0097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Olival KJ, Dittmar K, Bai Y, Rostal MK, Lei BR, Daszak P, Kosoy M. 2015. Bartonella spp. in a Puerto Rican bat community. J Wildl Dis 51:274–278. doi: 10.7589/2014-04-113. [DOI] [PubMed] [Google Scholar]
  • 26.Concannon R, Wynn-Owen K, Simpson VR, Birtles RJ. 2005. Molecular characterization of haemoparasites infecting bats (Microchiroptera) in Cornwall, UK. Parasitology 131:489–496. doi: 10.1017/S0031182005008097. [DOI] [PubMed] [Google Scholar]
  • 27.Lin JW, Hsu YM, Chomel BB, Lin LK, Pei JC, Wu SH, Chang CC. 2012. Identification of novel Bartonella spp. in bats and evidence of Asian gray shrew as a new potential reservoir of Bartonella. Vet Microbiol 156:119–126. doi: 10.1016/j.vetmic.2011.09.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Novakova E, Hypsa V, Moran NA. 2009. Arsenophonus, an emerging clade of intracellular symbionts with a broad host distribution. BMC Microbiol 9:143. doi: 10.1186/1471-2180-9-143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Jousselin E, Coeur d'Acier A, Vanlerberghe-Masutti F, Duron O. 2013. Evolution and diversity of Arsenophonus endosymbionts in aphids. Mol Ecol 22:260–270. doi: 10.1111/mec.12092. [DOI] [PubMed] [Google Scholar]
  • 30.Duron O, Wilkes TE, Hurst GD. 2010. Interspecific transmission of a male-killing bacterium on an ecological timescale. Ecol Lett 13:1139–1148. doi: 10.1111/j.1461-0248.2010.01502.x. [DOI] [PubMed] [Google Scholar]
  • 31.Hosokawa T, Koga R, Kikuchi Y, Meng XY, Fukatsu T. 2010. Wolbachia as a bacteriocyte-associated nutritional mutualist. Proc Natl Acad Sci U S A 107:769–774. doi: 10.1073/pnas.0911476107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Akman L, Yamashita A, Watanabe H, Oshima K, Shiba T, Hattori M, Aksoy S. 2002. Genome sequence of the endocellular obligate symbiont of tsetse flies, Wigglesworthia glossinidia. Nat Genet 32:402–407. doi: 10.1038/ng986. [DOI] [PubMed] [Google Scholar]
  • 33.Olival KJ, Dick CW, Simmons NB, Morales JC, Melnick DJ, Dittmar K, Perkins SL, Daszak P, Desalle R. 2013. Lack of population genetic structure and host specificity in the bat fly, Cyclopodia horsfieldi, across species of Pteropus bats in Southeast Asia. Parasit Vectors 6:231. doi: 10.1186/1756-3305-6-231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Goodman SM. 2011. Les chauves-souris de Madagascar. Association Vahatra, Antananarivo, Madagascar. [Google Scholar]
  • 35.Goodman SM, Raherilalao MJ. 2013. Atlas of selected land vertebrates of Madagascar. Association Vahatra, Antananarivo, Madagascar. [Google Scholar]
  • 36.Theodor O, Rothschild NC. 1967. An illustrated catalogue of the Rothschild collection of Nycteribiidae (Diptera) in the British Museum (Natural History); with keys and short descriptions for the identification of subfamilies, genera, species and subspecies. British Museum (Natural History), London, United Kingdom. [Google Scholar]
  • 37.Wilkinson DA, Dietrich M, Lebarbenchon C, Jaeger A, Le Rouzic C, Bastien M, Lagadec E, McCoy KD, Pascalis H, Le Corre M, Dellagi K, Tortosa P. 2014. Massive infection of seabird ticks with bacterial species related to Coxiella burnetii. Appl Environ Microbiol 80:3327–3333. doi: 10.1128/AEM.00477-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647–1649. doi: 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Huson DH, Bryant D. 2006. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23:254–267. [DOI] [PubMed] [Google Scholar]
  • 41.Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688–2690. doi: 10.1093/bioinformatics/btl446. [DOI] [PubMed] [Google Scholar]
  • 42.Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: more models, new heuristics and parallel computing. Nat Methods 9:772. doi: 10.1038/nmeth.2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Paradis E, Claude J, Strimmer K. 2004. APE: analyses of phylogenetics and evolution in R language. Bioinformatics 20:289–290. doi: 10.1093/bioinformatics/btg412. [DOI] [PubMed] [Google Scholar]
  • 44.Dixon P. 2003. VEGAN, a package of R functions for community ecology. J Vegetat Sci 14:927–930. doi: 10.1111/j.1654-1103.2003.tb02228.x. [DOI] [Google Scholar]
  • 45.Legendre P, Desdevises Y, Bazin E. 2002. A statistical test for host-parasite coevolution. Syst Biol 51:217–234. doi: 10.1080/10635150252899734. [DOI] [PubMed] [Google Scholar]
  • 46.Kang YJ, Diao XN, Zhao GY, Chen MH, Xiong Y, Shi M, Fu WM, Guo YJ, Pan B, Chen XP, Holmes EC, Gillespie JJ, Dumler SJ, Zhang YZ. 2014. Extensive diversity of Rickettsiales bacteria in two species of ticks from China and the evolution of the Rickettsiales. BMC Evol Biol 14:167. doi: 10.1186/s12862-014-0167-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhou W, Rousset F, O'Neil S. 1998. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc Biol Sci 265:509–515. doi: 10.1098/rspb.1998.0324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Baldo L, Dunning Hotopp JC, Jolley KA, Bordenstein SR, Biber SA, Choudhury RR, Hayashi C, Maiden MC, Tettelin H, Werren JH. 2006. Multilocus sequence typing system for the endosymbiont Wolbachia pipientis. Appl Environ Microbiol 72:7098–7110. doi: 10.1128/AEM.00731-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Baldo L, Lo N, Werren JH. 2005. Mosaic nature of the Wolbachia surface protein. J Bacteriol 187:5406–5418. doi: 10.1128/JB.187.15.5406-5418.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Jiggins FM, von Der Schulenburg JH, Hurst GD, Majerus ME. 2001. Recombination confounds interpretations of Wolbachia evolution. Proc Biol Sci 268:1423–1427. doi: 10.1098/rspb.2001.1656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Duron O, Bouchon D, Boutin S, Bellamy L, Zhou L, Engelstadter J, Hurst GD. 2008. The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biol 6:27. doi: 10.1186/1741-7007-6-27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Ros VI, Fleming VM, Feil EJ, Breeuwer JA. 2009. How diverse is the genus Wolbachia? Multiple-gene sequencing reveals a putatively new Wolbachia supergroup recovered from spider mites (Acari: Tetranychidae). Appl Environ Microbiol 75:1036–1043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Werren JH, Windsor DM. 2000. Wolbachia infection frequencies in insects: evidence of a global equilibrium? Proc Biol Sci 267:1277–1285. doi: 10.1098/rspb.2000.1139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Atyame CM, Labbe P, Rousset F, Beji M, Makoundou P, Duron O, Dumas E, Pasteur N, Bouattour A, Fort P, Weill M. 2015. Stable coexistence of incompatible Wolbachia along a narrow contact zone in mosquito field populations. Mol Ecol 24:508–521. doi: 10.1111/mec.13035. [DOI] [PubMed] [Google Scholar]
  • 55.Raychoudhury R, Baldo L, Oliveira DC, Werren JH. 2009. Modes of acquisition of Wolbachia: horizontal transfer, hybrid introgression, and codivergence in the Nasonia species complex. Evolution 63:165–183. doi: 10.1111/j.1558-5646.2008.00533.x. [DOI] [PubMed] [Google Scholar]
  • 56.Werren JH, Baldo L, Clark ME. 2008. Wolbachia: master manipulators of invertebrate biology. Nat Rev Microbiol 6:741–751. doi: 10.1038/nrmicro1969. [DOI] [PubMed] [Google Scholar]
  • 57.Dittmar K, Morse S, Gruwell M, Mayberry J, DiBlasi E. 2011. Spatial and temporal complexities of reproductive behavior and sex ratios: a case from parasitic insects. PLoS One 6:e19438. doi: 10.1371/journal.pone.0019438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Vayssier-Taussat M, Le Rhun D, Bonnet S, Cotte V. 2009. Insights in Bartonella host specificity. Ann N Y Acad Sci 1166:127–132. doi: 10.1111/j.1749-6632.2009.04531.x. [DOI] [PubMed] [Google Scholar]
  • 59.Pospischil R. 2015. Hippoboscidae, louse flies/keds, p 1–4. In Encyclopedia of parasitology. Springer, Berlin, Germany. [Google Scholar]
  • 60.Telfer S, Lambin X, Birtles R, Beldomenico P, Burthe S, Paterson S, Begon M. 2010. Species interactions in a parasite community drive infection risk in a wildlife population. Science 330:243–246. doi: 10.1126/science.1190333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Minard G, Tran FH, Dubost A, Tran-Van V, Mavingui P, Moro CV. 2014. Pyrosequencing 16S rRNA genes of bacteria associated with wild tiger mosquito Aedes albopictus: a pilot study. Front Cell Infect Microbiol 4:59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Renesto P, Gouvernet J, Drancourt M, Roux V, Raoult D. 2001. Use of rpoB gene analysis for detection and identification of Bartonella species. J Clin Microbiol 39:430–437. doi: 10.1128/JCM.39.2.430-437.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Davis MJ, Ying Z, Brunner BR, Pantoja A, Ferwerda FH. 1998. Rickettsial relative associated with papaya bunchy top disease. Curr Microbiol 36:80–84. doi: 10.1007/s002849900283. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES