Erratum to: ‘DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs’

Unfortunately, the original version of this article [1] contained an error. In the Methods part, in the Design and Cloning of Plasmids section, a sentence was included incorrectly. The correct sentence can be found below

"The Insert-2 sequence was previously assembled from four 5'-phosphorilated oligonucleotides (IDT)".

Please also note in table S3 The oligo pDECKO_seq_R is lacking one nucleotide. The correct sequence is ATGTCTACTATTCTTTCCCC