Skip to main content
NCBI home page
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2016 Jan 19;291(11):5765–5773. doi: 10.1074/jbc.M115.711697

NF-κB Essential Modulator (NEMO) Is Critical for Thyroid Function*

Carla Reale ‡,1, Anna Iervolino ‡,1, Ivan Scudiero ‡, Angela Ferravante ‡, Luca Egildo D'Andrea ‡, Pellegrino Mazzone ‡, Tiziana Zotti §, Antonio Leonardi , Luca Roberto ‡, Mariastella Zannini ‖, Tiziana de Cristofaro ‖, Muralitharan Shanmugakonar **, Giovambattista Capasso ‡,‡‡, Manolis Pasparakis §§, Pasquale Vito ‡,§,2, Romania Stilo §,
PMCID: PMC4786713  PMID: 26786105

Abstract

The I-κB kinase (IKK) subunit NEMO/IKKγ (NEMO) is an adapter molecule that is critical for canonical activation of NF-κB, a pleiotropic transcription factor controlling immunity, differentiation, cell growth, tumorigenesis, and apoptosis. To explore the functional role of canonical NF-κB signaling in thyroid gland differentiation and function, we have generated a murine strain bearing a genetic deletion of the NEMO locus in thyroid. Here we show that thyrocyte-specific NEMO knock-out mice gradually develop hypothyroidism after birth, which leads to reduced body weight and shortened life span. Histological and molecular analysis indicate that absence of NEMO in thyrocytes results in a dramatic loss of the thyroid gland cellularity, associated with down-regulation of thyroid differentiation markers and ongoing apoptosis. Thus, NEMO-dependent signaling is essential for normal thyroid physiology.

Keywords: apoptosis, NF-kappaB, NF-kappaB transcription factor, signal transduction, thyroid, thyroid hormone

Introduction

The nuclear factor-κB (NF-κB) signaling pathway controls a variety of important biological functions, including immune and inflammatory responses, differentiation, cell growth, tumorigenesis, and apoptosis (1). Two distinct pathways of NF-κB activation have been reported. The classical, canonical pathway is found in virtually all mammalian cells and depends on the presence of the IKKγ/NF-κB essential modulator (NEMO)3 protein (1). In this pathway, NF-κB activation is mediated by the IKK complex, consisting of the IKK1/IKKα and IKK2/IKKβ catalytic kinase subunits and the NEMO regulatory protein (1). Basically, NF-κB transcription factors are kept inactive in the cytoplasm through binding to members of the I-κB family of inhibitory proteins. Cell activation by a variety of stimuli results in the IKK-dependent phosphorylation of I-κB proteins, followed by their polyubiquitination and their proteasome-dependent degradation, allowing NF-κB dimers to enter the nucleus and catalyze transcription of target genes (1). In specific lymphoid tissues cells, an alternative, non-canonical pathway has been described that relies on IKKα-mediated phosphorylation of I-κB molecules. This pathway seems to be independent of NEMO activity (1). Recent publications have also shown that diverse posttranslational modifications, including ubiquitination, sumoylation, and phosphorylation, regulate the function of NEMO in the IKK complex (2–6).

Gene-targeting experiments have shown that mice lacking p65/RELA, IKK2/IKKβ, or NEMO die during embryonic development due to liver apoptosis (7–12). The evidence that NEMO-deficient mice exhibit a phenotype similar to that of p65/RELA-deficient mice demonstrates the essential role of NEMO in the canonical NF-κB signaling. Experiments based on tissue- and/or organ-specific deletion of NEMO, obtained through Cre-mediated genetic recombination, have given diverse results regarding the physiological role of this protein. In fact, ablation of NEMO in liver parenchymal cells causes spontaneous development of steatohepatitis and hepatocellular carcinoma (13). Instead, intestinal epithelial cell-specific deletion of NEMO results in severe chronic intestinal inflammation due to apoptosis of colonic epithelial cells, impaired expression of antimicrobial peptides, and translocation of bacteria into the mucosa (14). Central nervous system-specific ablation of NEMO results in no apparent abnormalities but rather ameliorates inflammatory and autoimmune pathologies (15). NEMO inactivation in the heart did not affect embryonic cardiac development but led to spontaneous and progressive impairment of cardiac function, progression to dilated cardiomyopathy, and heart failure (16). Finally, genetic abrogation of NEMO in podocytes did not affect normal glomerular development and function under non-stressed conditions (17). Thus, it appears that canonical NF-κB signaling performs different roles and functions, depending on the type of tissue and organ.

In the present work, we have investigated the requirement for NEMO in thyroid development, differentiation, and function by generating a mouse model bearing a thyroid-specific genetic inactivation of NEMO. In these mice, development and differentiation of the thyroid gland appears normal. In contrast, after birth, thyroid-specific NEMO knock-out mice develop progressive loss of thyroid cellularity and thyroid markers, hypothyroidism, and reduced vitality due to extensive apoptosis of thyroid cells. Thus, our data indicate that NF-κB-dependent gene expression is essential for maintaining normal thyroid gland structure and function in the adult.

Experimental Procedures

Ethics

Procedures involving animals were conducted as indicated in the Italian National Guidelines (D.L. 100/2006 and D.L. 116/1992) and in the pertinent European Directives (EEC Council Directive 86/609, 1.12.1987), adhering to the Guide for the Care and Use of Laboratory Animals (United States National Research Council). All of the in vivo experimental activities were approved by the Animal Ethics Committee of Biogem (Italy) with ID number 4713.

Generation of NEMOTS-KO Mice

To inactivate the NEMO gene in thyroid, mice expressing Cre recombinase under the control of endogenous Pax8 promoter (18) and NEMOFlox/+ (12) were bred. NEMOFlox/Y/Pax8Cre/+ mice were named NEMOTS-KO and used as the experimental group, whereas NEMO+/Y/Pax8Cre/+ littermates were used as controls. Genotyping was performed by PCR analysis of a tail biopsy. All experiments were conducted on age- and gender-matched animals.

Metabolic Measurements

Renal parameters were evaluated in 12-month-old mice using metabolic cages as described previously (19). Mice were housed individually in metabolic cages for 5 days at 23 °C with a 12-h dark/light cycle. After 4 days of adjustment, parameters were registered on day 5. 24-h urine output was collected under mineral oil to prevent evaporation. Proteinuria was quantified by a Bradford assay, and urinary electrolytes and creatinine were evaluated using Vitrovet (Scil).

Histology and Immunohistochemistry

Mice were anesthetized by isoflurane and perfused through abdominal aorta with 4% paraformaldehyde. Blood, left kidney, and thyroid were collected before perfusion. The left kidney and one thyroid lobe were used for immunoblotting or PCR, whereas the right kidney and the other thyroid lobe were used for immunohistochemistry. After embedding in paraffin, 4-μm-thick sections were stained with hematoxylin and eosin (Sigma-Aldrich) or with Masson's trichrome kit (Bio-Optica). For immunohistochemistry, sections were incubated overnight in xylene and then progressively in ethanol solution (99-96-70%). Endogenous peroxidase activity was quenched with 35% H2O2 in methanol, and target retrieval was performed in TEG buffer, pH 9.2. Primary antibodies were incubated overnight at 4 °C, and sections were then incubated with secondary anti-rabbit HRP-conjugated antibody (Dako). Chromogenic reactions were carried out with 3,3′-diaminobenzidine (Vector Laboratories), and stained sections were mounted with Eukitt (Bio-Optica).

For immunofluorescence analysis, thyroid sections were incubated overnight at 4 °C with anti-NIS antibody (kindly provided by Prof. M. De Felice). Sections were then incubated with secondary anti-rabbit-conjugated Alexa Fluor 488; DAPI was used as a nuclear counterstain. The primary antibodies used for kidney staining were as follows: anti-AQP2 and anti-NKCC2 provided by Prof. Frische; anti-Pax8, anti-TITF1, and anti-thyroglobulin provided by Prof. De Felice; and anti-cleaved caspase-3 purchased from Cell Signaling Technology. A Zeiss Axioplan 2 microscope was used for image acquisition. All stainings were done at least three times using different biological material as sources.

Immunoblotting

Tissues were homogenized with a TissueLyser (Qiagen) in lysis buffer (300 mm sucrose, 25 mm imidazole, 1 mm EDTA, 1 mm PMSF) with protease and phosphatase inhibitor mixtures (Roche Applied Science). Immunoblottings were performed as described previously (20). Briefly, extracted proteins were separated by SDS-PAGE, transferred onto nitrocellulose membrane, and incubated with primary antibodies followed by horseradish peroxidase-conjugated secondary antibodies (Amersham Biosciences). Blots were developed using the ECL system (Amersham Biosciences). Anti-NEMO, anti-IKKα/β, anti-p65, anti-p50, anti-phospho-CREB, anti-CREB, anti-caspase-3, and anti-β-actin antibodies were obtained from Santa Cruz Biotechnology, Inc. All immunoblots were done at least three times using different biological material as sources.

RNA Extraction and Quantitative PCR

1 μg of total RNA was isolated from a pool of three thyroid lobes using TRIzol reagent (Invitrogen) and reverse-transcribed using the Quantitec reverse transcription kit (Qiagen). Quantitative PCR mixtures contained 7.5 ng of total cDNA, Power PCR Master Mix 16 (Applied Biosystems), and the following primers: Pax8, GCCATGGCTGTGTAAGCAAGA (forward) and GCTTGGAGCCCCCTATCACT (reverse); Titf1, CTACTGCAACGGCAACCTG (forward) and CCCATGCCATCATATATTCAT (reverse); Tg, CATGGAATCTAATGCCAAGAACTG (forward) and TCCCTGTGAGCTTTTGGAATG (reverse); Tpo, CAAAGGCTGGAACCCTAATTTCT (forward) and AACTTGAATGAGGTGCCTTGTCA (reverse); Nis, TCCACAGGAATCATCTGCA (forward) and CCACGGCCTTCATACCACC (reverse); Gapdh, AATGGTGAAGGTCGGTGTG (forward) and GAAGATGGTGATGGGCTTCC (reverse); c-Flip, CCGTGAAGAGACTTACAGGA (forward) and GTTATGTCATGTGACTTGGG (reverse); Bcl-2, GGGGTCATGTGTGTGGAGAG (forward) and GCATGCTGGGGCCATATAGT (reverse); Bfl-1/A1, TGCCCTGGATGTATGTGCTT (forward) and GAGCATTTCCCAGATCTGTC (reverse); Bcl-xL, CCTTGGATCCAGGAGAACGG (forward) and AAGAGTGAGCCCAGCAGAAC (reverse); c-Iap2, AGAGAGGAGCAGATGGAGCA (forward) and CCTGTTCAGTGATGGCCCTT (reverse); c-Iap1, GACCCCTGGATAGAACACGC (forward) and CTGGGGTGTCTGAAGTGGAC (reverse); Xiap, GGAACATGGACATCCTCAGT (forward) and TACCACTTCGCATGCTGTTC (reverse); RNA18S, CGGCTACCACATCCAAGGAA (forward) and GGGCCTCGAAAGAGTCCTGT (reverse). Reactions were run on a 7900HT system (Applied Biosystems). For each sample, expression of the genes of interest was normalized to the expression of RNA18S and/or Gapdh measured under the same conditions (21).

Culture of Primary Mouse Thyrocytes

Mice of different genotypes were anesthetized and sacrificed. Thyroid lobes were dissected aseptically and placed on a microscope slide containing a drop of Eagle's minimum essential medium. The lobes were disrupted mechanically, using two 25-gauge needles to obtain approximately 10 fragments from each lobe. The fragments were transferred to a 1.5-ml tube containing 1 ml of digestion medium, consisting of 112 units/ml type I collagenase (Sigma) and 1.2 units/ml dispase dissolved in Eagle's minimum essential medium. The enzymatic digestion was carried out for 45 min in a 37 °C water bath. The follicles were seeded and cultured in F-12 medium (EuroClone) supplemented with 10% Nu-Serum IV (BD Biosciences), 10 ng/ml somatostatin (Sigma-Aldrich), and 2 ng/ml glycyl-l-histidyl-lysine acetate (Sigma-Aldrich) in a water-saturated incubator, under 95% air, 5% CO2 at 37 °C. Thyroid-stimulating hormone (TSH) and TNFα used for thyrocyte stimulation were obtained from Sigma-Aldrich.

Free T4 and TSH Measurement

Venous blood samples were collected in microtubes without anticoagulant. After clot formation, samples were centrifuged, and the serum fraction was kept at −80 °C. Free T4 was measured using the ELISA kit from DiaMetra according to the manufacturer's instructions. TSH levels were determined by a rat TSH radioimmunoassay kit (Institute of Isotopes, Budapest, Hungary).

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl Tetrazolium Bromide Assay

A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide colorimetric assay for cell viability was performed in a 96-well flat-bottomed tissue culture plates as described previously (22).

Statistics

Data were analyzed by Student's t test. A p value of <0.05 was considered significant.

Results

In order to understand the role of NEMO in thyroid development and function, we applied the Cre-LoxP strategy to specifically delete the NEMO locus in the thyroid gland. For this, females bearing a floxed Nemo allele (NemoFlox/+), which do not show phenotype abnormalities (12), were crossed to the knock-in Pax8Cre/+ mice, which express the Cre recombinase under the control of the endogenous Pax8 gene promoter and mediate efficient Cre recombination in thyroid (18). Mutant mice were observed at the expected Mendelian frequency and were named NEMO thyroid-specific knock-out (NEMOTS-KO). As shown in Fig. 1A, site-specific recombination of the NEMO allele was observed only in NEMO floxed mice expressing the Cre recombinase. Efficient ablation of the NEMO locus was confirmed by immunoblotting analysis on whole-thyroid extracts (Fig. 1B). Functional inactivation of the IKK complex was demonstrated by lack of I-κBα degradation in NEMOTS-KO thyrocytes following exposure to TNFα (Fig. 1C, left). On the other hand, expression of p65, IKKα/β, and p50 were not affected by genetic deletion of NEMO (Fig. 1C, right). Because Pax8Cre/+ mice express Cre recombinase also in the mesonephros and metanephros (18), excision of the Nemo floxed allele was consistently detected also in kidney tissues (Fig. 1, D and E).

FIGURE 1.

FIGURE 1.

Open in a new tab

Generation of thyroid-specific NEMO knock-out mice. A, PCR analysis of thyroid genomic DNA extracted from 1-month-old mice of the indicated genotypes. For amplification of NEMO alleles, two different primer sets were used, one amplifying the floxed region and the other amplifying the allele resulting from excision (12). The Pax8-Cre allele was amplified with a primer set enabling us to distinguish the Cre-encoding allele from the wild-type allele. B, thyroid extracts from 8-week-old NEMOTS-KO mice and littermate control mice were analyzed by an immunoblotting assay. The actin blot served as loading control. C, protein extracts prepared from NEMOTS-KO and wild-type cultured thyrocytes at the indicated time points after TNFα stimulation (10 ng/ml) were assessed for I-κBα degradation (left), and expression of components of the NF-κB pathway (right) was assessed by immunoblotting analysis. D and E, genomic and immunoblotting analysis in the kidney cortex, inner stripe of the outer medulla (ISOM), and inner medulla (IM) of NEMOTS-KO and control mice. MWM, molecular weight markers; WB, Western blotting; CTR, control.

NEMOTS-KO mutant mice appeared undistinguishable from control mice at birth (data not shown). In contrast, starting from 2 months of age, mutant mice developed clearly smaller than control littermates and displayed a significantly reduced body weight (Fig. 2A). NEMOTS-KO mice had a significantly shortened life span, and about 50% of mice die before 8 months of age (Fig. 2B). When compared with control mice, NEMOTS-KO mice presented significantly lower levels of serum-free T4 hormone (Fig. 2C) and increased TSH levels (Fig. 2D), which is indicative of hypothyroidism. Hence, body weight reduction and early lethality observed in these mice might be due, at least in part, to thyroid dysfunction.

FIGURE 2.

FIGURE 2.

Open in a new tab

Early lethality of NEMOTS-KO mice. A, body weight of male NEMOTS-KO and control mice at 1 month after birth (n = 12 for each genotype). p value was calculated with Student's t test comparing both groups. B, survival rates of NEMOTS-KO and control mice (n = 10 for each) during 12 months after birth. C, ELISA assay of free T4 serum level in NEMOTS-KO and control mice (n = 10 for each group) at the indicated months after birth. D, TSH serum level in NEMOTS-KO and control mice at 12 months after birth (n = 7 for each group). CTR, control. Error bars, S.E.

To exclude the possibility that the premature lethality observed in NEMOTS-KO mice was due to renal failure, we carried out a histological and functional analysis on the kidneys of the mutant mice. The result of this analysis, shown in Table 1, indicates that partial loss of NEMO expression in specific kidney tissues was not associated with an overt kidney phenotype. In fact, monitoring of the renal function in NEMOTS-KO mice did not reveal any physiological alteration (Table 1). Kidney histology was assessed by H&E staining and immunohistochemistry for the kidney-specific markers AQP2 and NKCC2. Again, no alteration in immunoreactivity for these markers was detected in NEMOTS-KO kidneys with respect to control mice at 12 months of age (Fig. 3, A–C). From these results, we deduced that NEMOTS-KO do not suffer of renal dysfunction. This conclusion is consistent with a previous observation showing that podocyte-specific NEMO-deficient mice do not show overt changes in kidney morphology and functionality (17).

TABLE 1.

Renal physiology parameters in 12-month-old NEMOTS-KO mice

Parameters NEMOTS-KO
 Control
 p (NEMOTS-KO versus control)
Values n Values n
Weight (g) 26.25 ± 0.77 14 30.02 ± 1.06 11 0.0037
Urine output (μl/min/g body weight) 52.74 ± 4.31 11 46.05 ± 4.50 9 0.454
Proteinuria (mg/24 h) 2.1 ± 0.25 11 1.94 ± 0.22 9 0.65
Urinary pH 7.03 ± 0.39 7 7.06 ± 0.40 7 0.95
Na/creatinine (mm/mm) 36.8 ± 2.76 10 32.28 ± 2.24 9 0.23
K/creatinine (mm/mm) 49 ± 3.82 10 37.59 ± 4.63 9 0.07
Cl/creatinine (mm/mm) 74 ± 3.63 10 73.36 ± 3.48 9 0.89
Open in a new tab

FIGURE 3.

FIGURE 3.

Open in a new tab

NEMOTS-KO mice kidney phenotype analysis. Shown are H&E staining (A) and immunohistochemical analysis (B) of the kidney markers NKCC2 and AQP2 in control and NEMOTS-KO kidney sections at 12 months of age (OM, outer medulla; IM, inner medulla). C, quantification of AQP2-positive cells in the collecting ducts of the inner medulla. The count was carried out on images acquired from five NEMOTS-KO and five control mice. Data shown are representative of at least three independent experiments. CTR, control. Error bars, S.E.

To verify whether NEMO inactivation affects thyroid embryonic development, mutant embryonic day 16.5 embryos were analyzed because Cre recombinase in Pax8Cre/+ mice is active from embryonic day 8.5 (18). At embryonic day 16.5, no alteration in thyroid size and morphology could be detected (Fig. 4A), and similar results were obtained when the same analysis was performed in mice at 1 month of age (Fig. 4A). Hence, these data indicate that canonical NF-κB signaling is not required for embryonic thyroid development and differentiation.

FIGURE 4.

FIGURE 4.

Open in a new tab

Down-regulation of thyroid markers and apoptosis in NEMOTS-KO thyroid. H&E staining (A and B) and immunohistochemical analysis of PAX8 (C), TTF1 (D), thyroglobulin (F), and active caspase-3 (H) in control and NEMOTS-KO thyroid sections at the indicated age. G, Masson's trichromic staining in NEMOTS-KO and control thyroids. Fibrotic material appears as blue staining (black arrows). E, immunofluorescence analysis of NIS in NEMOTS-KO and control mice. I, left, quantitative PCR expression analysis of the indicated genes in thyroids isolated from NEMOTS-KO and control mice at 12 months of age. Each RNA sample was obtained by pooling three thyroids/genotype. Data shown (mean ± S.E., n = 3) are representative of at least three independent experiments done in triplicate. Right, immunoblotting analysis of thyroid markers in thyrocytes isolated from NEMOTS-KO and control mice. J, Western blotting analyses of total and phosphorylated CREB in protein extracts from NEMOTS-KO and control thyrocytes left untreated or stimulated with TSH (1 milliunit/ml) for 30 min. CTR, control. Error bars, S.E.

The effect of NEMO conditional inactivation on thyroid morphology and differentiation was further analyzed. Starting from 2 months of age, thyroid glands of NEMOTS-KO mice appeared considerably smaller compared with controlmice (Fig. 4B). In the surviving 2-month-old NEMOTS-KO mice, significant cell loss was observed, and the thyroid follicular architecture appeared highly variable in diameter with irregular outlines (Fig. 4, B–F). Immunohistochemical and immunofluorescent analysis shows that the expression level of two thyroid-specific transcription factors, namely PAX8 and TTF1, steadily declined over time (Fig. 4, C and D). A similar decline occurred for thyroglobulin and for the Na/I symporter NIS (Fig. 4, E and F). NIS, for instance, appeared barely detectable in thyrocytes isolated from 2-month-old NEMOTS-KO mice (Fig. 4E). Masson's trichrome staining also revealed the presence of fibrotic material in mutant thyroids (Fig. 4G). In all staining, the progressive disorganization and degeneration of the thyroid parenchyma in NEMOTS-KO mutant mice was clearly visible. Also, reduction of cellularity and gland size in NEMOTS-KO mice was accompanied by massive apoptosis, as indicated by the staining for active caspase 3 (Fig. 4H).

Quantitative PCR analysis confirmed the reduced expression of the thyroid markers PAX8, TTF1, TPO, and NIS in NEMO-deleted thyroids (Fig. 4I). The mRNA expression levels of TSH receptor and thyroglobulin were also both significantly reduced (Fig. 4I). Despite its reduced expression, however, TSH receptor signaling does not appear compromised in NEMOTS-KO thyrocytes, as assessed by monitoring phosphorylation of CREB following TSH stimulation (Fig. 4J).

NF-κB controls the expression of several genes, including Bfl-1/A1, Bcl-2, Bcl-xL, c-Flip, and Iap, that protect cells against apoptotic cell death (23–29). Consistently, all of these anti-apoptotic genes appear significantly down-regulated in NEMO-deficient thyrocytes (Fig. 5A). Thus, we verified whether NEMOTS-KO thyrocytes exhibit a greater sensitivity to apoptotic stimuli. As shown in Fig. 5, B–E, lack of NEMO dramatically sensitizes these thyrocytes to the cytotoxic action of both TNFα and TSH. Taken together, these data demonstrate that in adult mice, NEMO is required for thyrocyte survival and contributes to the maintenance of thyrocyte differentiation by regulating the expression of several thyroid markers.

FIGURE 5.

FIGURE 5.

Open in a new tab

Increased sensitivity of NEMOTS-KO thyrocytes to apoptosis. A, quantitative PCR expression analysis of the indicated anti-apoptotic genes in thyrocytes isolated from 12-month-old NEMOTS-KO and control mice left untreated or stimulated with TNFα (10 ng/ml) for 7 h. Each RNA sample was obtained by pooling three thyroids/genotype. Data shown (mean ± S.E., n = 3) are representative of at least three independent experiments done in triplicate. B, thyrocytes from 6-month-old NEMOTS-KO and wild type mice were left untreated or treated with TNFα (10 ng/ml) or TSH (1 milliunit/ml) for 24 h, and cell viability was measured by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay. Data shown (mean ± S.E., n = 3) are representative of at least three independent experiments done in triplicate. C, phase-contrast micrographs of thyrocytes treated as in B. D, immunoblotting assay of caspase-3 from proteic lysates of thyrocytes treated as in B. Activation of caspase-3 can be inferred from processing of the p32 precursor. E, immunoblotting assay (left) and its densitometric analysis (right) of NEMO expression in purified thyrocytes used for the experiments shown above. Data shown are representative of at least three independent experiments. CTR, control. Error bars, S.E.

Discussion

In this paper, we demonstrate that NEMO signaling is essential for normal postnatal thyroid gland structure and function. Although previous studies have clearly established a role for NF-κB in thyroid tumor progression (30–32), this is the first work that examines the role of canonical NF-κB signaling in normal thyroid development and physiology. We show that mice with thyroid-specific ablation of NEMO develop a pronounced impairment of thyroid function, eventually leading to shortened life span. On the other hand, no gross alterations of thyroid gland localization, morphology, and differentiation were observed during embryonic development and in newborn mice, indicating that the NEMO-dependent NF-κB signaling is not required for embryonic thyroid development. Our results indicate that in thyroid, NEMO is required for at least two essential aspects: (i) thyrocyte survival and (ii) maintenance of thyroid marker expression. The critical role of NF-κB in cell survival is widely supported by the available literature. Gene-targeting experiments have in fact shown that mice lacking p65/RELA, IKK2, or NEMO die during embryonic development due to liver apoptosis (7–12). Thus, the extensive apoptosis observed in NEMOTS-KO thyrocytes confirms the requirement for NF-κB in orchestrating cytoprotective pathways. Particularly interesting are the data showing the different behavior of WT and NEMOTS-KO thyrocytes when exposed to TSH. In fact, whereas both wild type and NEMOTS-KO thyrocytes proliferate following TSH stimulation, NEMOTS-KO thyrocytes also undergo extensive apoptosis (Fig. 5). This finding is consistent with previous evidence showing that TSH stimulation on thyrocytes in fact triggers both proliferative and apoptotic responses (33). Our work now shows that NF-κB signaling could play a decisive role in determining the fate of thyrocytes following TSH stimulation.

An interesting aspect of our experiments is the evidence here provided that NF-κB controls, directly or indirectly, the expression level of several thyroid markers. Although an involvement of NF-κB in the regulation of Nis expression has been already reported (34), we now show that, in addition to NIS, NF-κB controls the expression of a panel of thyroid markers, including TTF1, PAX8, TPO, and thyroglobulin. In this context, our work provides a molecular explanation for some phenotypical aspects of human disorders associated with mutations in NEMO. In humans, in fact, mutations in the X-linked NEMO gene cause two distinct genetic diseases. Mutations that completely disrupt the NEMO locus result in Incontinentia Pigmenti, a disease where male patients die in utero, whereas the phenotypic analysis of females is complicated by the fact that NEMO-deficient cells quickly disappear and are replaced by wild-type cells. A second disease, named hypohydrotic ectodermal dysplasia with immune deficiency (HED-ID), is characterized by hypomorphic NEMO mutations that do not completely abolish but rather reduce NF-κB activation. HED-ID is characterized by impaired skin appendage development and severe immune deficiency. Strikingly, hypothyroidism is not uncommon in patients with HED-ID (35–38), as predicted by the data we show here.

In conclusion, our data can be easily interpreted considering the crucial role that NEMO plays in activation of NF-κB, which, in turn, regulates the expression of genes that are critical for cell survival. However, it should not be disregarded that NF-κB-independent functions have been ascribed to NEMO, and these latter are also involved in the control of cell proliferation and cell death (39–41). Hence, it is very possible that NF-κB-independent functions of NEMO may contribute, at least in part, to the cellular degeneration observed in NEMOTS-KO thyrocytes.

Author Contributions

C. R., A. I., A. F., L. E. D. A., P. M., I. S., R. L., T. Z., and T. C. performed the experiments and analyzed data; A. L., M. Z., G. C., M. P., M. S., P. V., and R. S. conceived experiments and analyzed data; P. V. wrote the manuscript.

Acknowledgments

We thank Drs. Antonella Fierro and Marianna Scrima for technical assistance and Prof. Mario De Felice for critical reading of the manuscript.

*

The authors declare that they have no conflicts of interest with the contents of this article.

3
The abbreviations used are:
NEMO
NF-κB essential modulator
IKK
I-κB kinase
TSH
thyroid-stimulating hormone
HED-ID
hypohydrotic ectodermal dysplasia with immune deficiency
CREB
cAMP-response element-binding protein.

References

  • 1. Vallabhapurapu S., Karin M. (2009) Regulation and function of NF-κB transcription factors in the immune system. Annu. Rev. Immunol. 27, 693–733 [DOI] [PubMed] [Google Scholar]
  • 2. Sebban H., Yamaoka S., Courtois G. (2006) Posttranslational modifications of NEMO and its partners in NF-κB signaling. Trends Cell Biol. 16, 569–577 [DOI] [PubMed] [Google Scholar]
  • 3. Shifera A. S. (2010) Protein-protein interactions involving IKKγ (NEMO) that promote the activation of NF-κB. J. Cell. Physiol. 223, 558–561 [DOI] [PubMed] [Google Scholar]
  • 4. Chen Z. J. (2012) Ubiquitination in signaling to and activation of IKK. Immunol. Rev. 246, 95–106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Zotti T., Scudiero I., Settembre P., Ferravante A., Mazzone P., D'Andrea L., Reale C., Vito P., Stilo R. (2014) TRAF6-mediated ubiquitination of NEMO requires p62/sequestosome-1. Mol. Immunol. 58, 27–31 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Zotti T., Uva A., Ferravante A., Vessichelli M., Scudiero I., Ceccarelli M., Vito P., Stilo R. (2011) TRAF7 protein promotes Lys-29-linked polyubiquitination of IκB kinase (IKKγ)/NF-κB essential modulator (NEMO) and p65/RelA protein and represses NF-κB activation. J. Biol. Chem. 286, 22924–22933 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Beg A. A., Sha W. C., Bronson R. T., Ghosh S., and Baltimore D. (1995) Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-κB. Nature 376, 167–170 [DOI] [PubMed] [Google Scholar]
  • 8. Li Q., Van Antwerp D., Mercurio F., Lee K. F., and Verma I. M. (1999) Severe liver degeneration in mice lacking the IkB kinase 2 gene. Science 284, 321–325 [DOI] [PubMed] [Google Scholar]
  • 9. Li Z. W., Chu W., Hu Y., Delhase M., Deerinck T., Ellisman M., Johnson R., and Karin M. (1999) The IKKb subunit of IkB kinase (IKK) is essential for nuclear factor κB activation and prevention of apoptosis. J. Exp. Med. 189, 1839–1845 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Tanaka M., Fuentes M. E., Yamaguchi K., Durnin M. H., Dalrymple S. A., Hardy K. L., and Goeddel D. V. (1999) Embryonic lethality, liver degeneration, and impaired NF-κB activation in IKK-b-deficient mice. Immunity 10, 421–429 [DOI] [PubMed] [Google Scholar]
  • 11. Rudolph D., Yeh W. C., Wakeham A., Rudolph B., Nallainathan D., Potter J., Elia A. J., and Mak T. W. (2000) Severe liver degeneration and lack of NF-kB activation in NEMO/IKKγ deficient mice. Genes Dev. 14, 854–862 [PMC free article] [PubMed] [Google Scholar]
  • 12. Schmidt-Supprian M., Bloch W., Courtois G., Addicks K., Israël A., Rajewsky K., and Pasparakis M. (2000) NEMO/IKKγ-deficient mice model incontinentia pigmenti. Mol. Cell 5, 981–992 [DOI] [PubMed] [Google Scholar]
  • 13. Luedde T., Beraza N., Kotsikoris V., van Loo G., Nenci A., De Vos R., Roskams T., Trautwein C., and Pasparakis M. (2007) Deletion of NEMO/IKKγ in liver parenchymal cells causes steatohepatitis and hepatocellular carcinoma. Cancer Cell 11, 119–132 [DOI] [PubMed] [Google Scholar]
  • 14. Nenci A., Becker C., Wullaert A., Gareus R., van Loo G., Danese S., Huth M., Nikolaev A., Neufert C., Madison B., Gumucio D., Neurath M. F., and Pasparakis M. (2007) Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 446, 557–561 [DOI] [PubMed] [Google Scholar]
  • 15. van Loo G., De Lorenzi R., Schmidt H., Huth M., Mildner A., Schmidt-Supprian M., Lassmann H., Prinz M. R., and Pasparakis M. (2006) Inhibition of transcription factor NF-κB in the central nervous system ameliorates autoimmune encephalomyelitis in mice. Nat. Immunol. 7, 954–961 [DOI] [PubMed] [Google Scholar]
  • 16. Kratsios P., Huth M., Temmerman L., Salimova E., Al Banchaabouchi M., Sgoifo A., Manghi M., Suzuki K., Rosenthal N., and Mourkioti F. (2010) Antioxidant amelioration of dilated cardiomyopathy caused by conditional deletion of NEMO/IKKγ in cardiomyocytes. Circ. Res. 106, 133–144 [DOI] [PubMed] [Google Scholar]
  • 17. Brähler S., Ising C., Hagmann H., Rasmus M., Hoehne M., Kurschat C., Kisner T., Goebel H., Shankland S., Addicks K., Thaiss F., Schermer B., Pasparakis M., Benzing T., and Brinkkoetter P. T. (2012) Intrinsic proinflammatory signaling in podocytes contributes to podocyte damage and prolonged proteinuria. Am. J. Physiol. Renal. Physiol. 303, F1473–F1485 [DOI] [PubMed] [Google Scholar]
  • 18. Bouchard M., Souabni A., and Busslinger M. (2004) Tissue-specific expression of Cre recombinase from the Pax8 locus. Genesis 38, 105–109 [DOI] [PubMed] [Google Scholar]
  • 19. Iervolino A., Trepiccione F., Petrillo F., Spagnuolo M., Scarfò M., Frezzetti D., De Vita G., De Felice M., and Capasso G. (2015) Selective dicer suppression in the kidney alters GSK3β/β-catenin pathways promoting a glomerulocystic disease. PLoS One 10, e0119142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Stilo R., Liguoro D., di Jeso B., Leonardi A., and Vito P. (2003) The α-chain of the nascent polypeptide- associated complex binds to and regulates FADD function. Biochem. Biophys. Res. Commun. 303, 1034–1041 [DOI] [PubMed] [Google Scholar]
  • 21. D'Andrea E.L., Ferravante A., Scudiero I., Zotti T., Reale C., Pizzulo M., De La Motte L. R., De Maio C., Mazzone P., Telesio G., Vito P., and Stilo R. (2014) The Dishevelled, EGL-10 and pleckstrin (DEP) domain-containing protein DEPDC7 binds to CARMA2 and CARMA3 proteins, and regulates NF-κB activation. PLoS One 9, e116062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Scudiero I., Zotti T., Ferravante A., Vessichelli M., Vito P., and Stilo R. (2011) Alternative splicing of CARMA2/CARD14 transcripts generates protein variants with differential effect on NF-κB activation and endoplasmic reticulum stress-induced cell death. J. Cell. Physiol. 226, 3121–3131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Zong W. X., Edelstein L. C., Chen C., Bash J., and Gélinas C. (1999) The prosurvival Bcl-2 homolog Bfl-1/A1 is a direct transcriptional target of NF-κB that blocks TNFα-induced apoptosis. Genes Dev. 13, 382–387 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Micheau O., Lens S., Gaide O., Alevizopoulos K., and Tschopp J. (2001) NF-κB signals induce the expression of c-FLIP. Mol. Cell. Biol. 21, 5299–5305 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Chu Z. L., McKinsey T. A., Liu L., Gentry J. J., Malim M. H., and Ballard D. W. (1997) Suppression of tumor necrosis factor-induced cell death by inhibitor of apoptosis c-IAP2 is under NF-κB control. Proc. Natl. Acad. Sci. U.S.A. 94, 10057–10062 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Wang C. Y., Mayo M. W., Korneluk R. G., Goeddel D. V., and Baldwin A. S. Jr. (1998) NF-κB antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science 281, 1680–1683 [DOI] [PubMed] [Google Scholar]
  • 27. Stehlik C., de Martin R., Kumabashiri I., Schmid J. A., Binder B. R., and Lipp J. (1998) Nuclear factor (NF)-κB-regulated X-chromosome-linked iap gene expression protects endothelial cells from tumor necrosis factor α-induced apoptosis. J. Exp. Med. 188, 211–216 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Khoshnan A., Tindell C., Laux I., Bae D., Bennett B., and Nel A. E. (2000) The NF-κB cascade is important in Bcl-xL expression and for the anti-apoptotic effects of the CD28 receptor in primary human CD4+ lymphocytes. J. Immunol. 165, 1743–1754 [DOI] [PubMed] [Google Scholar]
  • 29. Guiet C., Silvestri E., De Smaele E., Franzoso G., and Vito P. (2002) c-FLIP efficiently rescues TRAF-2−/− cells from TNF-induced apoptosis. Cell Death Differ. 9, 138–144 [DOI] [PubMed] [Google Scholar]
  • 30. Visconti R., Cerutti J., Battista S., Fedele M., Trapasso F., Zeki K., Miano M. P., de Nigris F., Casalino L., Curcio F., Santoro M., and Fusco A. (1997) Expression of the neoplastic phenotype by human thyroid carcinoma cell lines requires NFκB p65 protein expression. Oncogene 15, 1987–1994 [DOI] [PubMed] [Google Scholar]
  • 31. Pacifico F., Mauro C., Barone C., Crescenzi E., Mellone S., Monaco M., Chiappetta G., Terrazzano G., Liguoro D., Vito P., Consiglio E., Formisano S., and Leonardi A. (2004) Oncogenic and anti-apoptotic activity of NF-κB in human thyroid carcinomas. J. Biol. Chem. 279, 54610–54619 [DOI] [PubMed] [Google Scholar]
  • 32. Pacifico F., and Leonardi A. (2010) Role of NF-κB in thyroid cancer. Mol. Cell. Endocrinol. 321, 29–35 [DOI] [PubMed] [Google Scholar]
  • 33. De Gregorio G., Coppa A., Cosentino C., Ucci S., Messina S., Nicolussi A., D'Inzeo S., Di Pardo A., Avvedimento E. V., and Porcellini A. (2007) The p85 regulatory subunit of PI3K mediates TSH-cAMP-PKA growth and survival signals. Oncogene 26, 2039–2047 [DOI] [PubMed] [Google Scholar]
  • 34. Nicola J. P., Nazar M., Mascanfroni I. D., Pellizas C. G., and Masini-Repiso A. M. (2010) NF-κB p65 subunit mediates lipopolysaccharide-induced Na+/I− symporter gene expression by involving functional interaction with the paired domain transcription factor Pax8. Mol. Endocrinol. 24, 1846–1862 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Fryns J. P., Chrzanowska K., and Van den Berghe H. (1989) Hypohidrotic ectodermal dysplasia, primary hypothyroidism, and agenesis of the corpus callosum. J. Med. Genet. 26, 520–521 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Pike M. G., Baraitser M., Dinwiddie R., and Atherton D. J. (1986) A distinctive type of hypohidrotic ectodermal dysplasia featuring hypothyroidism. J. Pediatr. 108, 109–111 [DOI] [PubMed] [Google Scholar]
  • 37. Pabst H. F., Groth O., and McCoy E. E. (1981) Hypohidrotic ectodermal dysplasia with hypothyroidism. J. Pediatr. 98, 223–227 [DOI] [PubMed] [Google Scholar]
  • 38. Sundaravalli P. A., and Shetty M. V. (1980) Congenital hypothyroidism with ectodermal dysplasia. Indian Pediatr. 17, 566. [PubMed] [Google Scholar]
  • 39. Bettermann K., Vucur M., Haybaeck J., Koppe C., Janssen J., Heymann F., Weber A., Weiskirchen R., Liedtke C., Gassler N., Müller M., de Vos R., Wolf M. J., Boege Y., Seleznik G. M., et al. (2010) TAK1 suppresses a NEMO-dependent but NF-κB-independent pathway to liver cancer. Cancer Cell 17, 481–496 [DOI] [PubMed] [Google Scholar]
  • 40. Legarda-Addison D., Hase H., O'Donnell M. A., and Ting A. T. (2009) NEMO/IKKγ regulates an early NF-κB-independent cell-death checkpoint during TNF signaling. Cell Death Differ. 16, 1279–1288 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Comb W. C., Hutti J. E., Cogswell P., Cantley L. C., and Baldwin A. S. (2012) p85α SH2 domain phosphorylation by IKK promotes feedback inhibition of PI3K and Akt in response to cellular starvation. Mol. Cell 45, 719–730 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES