Expression of factor H binding protein in meningococcal strains can vary at least 15-fold and is genetically determined

Significance

Complement is the main line of defense against bacterial pathogens; however, the molecular mechanisms triggering killing are largely unknown. Factor H binding protein (fHbp) is a component of two licensed vaccines against serogroup B meningococcus and a key target of complement-mediated bacterial killing. Selected reaction monitoring was used for the absolute quantification of fHbp on invasive meningococcal strains, showing that expression among strains can vary at least 15-fold and a minimum of 757 molecules separated by not more than 130 nm are required to engage C1q and kill the bacteria. Furthermore, the amount of fHbp is genetically determined by the sequence of the promoter region and correlated with the bactericidal activity. These findings increase the understanding of complement-mediated killing and vaccine protection.

Abstract

Factor H binding protein (fHbp) is a lipoprotein of Neisseria meningitidis important for the survival of the bacterium in human blood and a component of two recently licensed vaccines against serogroup B meningococcus (MenB). Based on 866 different amino acid sequences this protein is divided into three variants or two families. Quantification of the protein is done by immunoassays such as ELISA or FACS that are susceptible to the sequence variation and expression level of the protein. Here, selected reaction monitoring mass spectrometry was used for the absolute quantification of fHbp in a large panel of strains representative of the population diversity of MenB. The analysis revealed that the level of fHbp expression can vary at least 15-fold and that variant 1 strains express significantly more protein than variant 2 or variant 3 strains. The susceptibility to complement-mediated killing correlated with the amount of protein expressed by the different meningococcal strains and this could be predicted from the nucleotide sequence of the promoter region. Finally, the absolute quantification allowed the calculation of the number of fHbp molecules per cell and to propose a mechanistic model of the engagement of C1q, the recognition component of the complement cascade.

Factor H binding protein (fHbp) is a 27-kDa lipoprotein present on the surface of Neisseria meningitidis that improves the survival of the bacterium in human blood by binding human factor H (hfH), a down-regulator of the complement alternative pathway (1, 2). The sequence of the gene in more than 7,000 clinical isolates currently present in the databases identified more than 860 different alleles of the protein that have been divided into three main variants (var1, var2, and var3) or two subfamilies (A and B, corresponding to variants 2/3 and 1, respectively) (3, 4), each of which can be further distinguished in many subvariant or subfamily groups (pubmlst.org/neisseria/fHbp/).

The fHbp gene is present in most circulating meningococcal strains; however, invasive isolates with frameshift mutations abrogating fHbp protein expression have been identified (5). Furthermore, although in fHbp-positive strains level of protein expression varies considerably, as shown by antibody-dependent methodologies (6, 7), its exposure is not influenced by other surface components such as the capsular polysaccharide (8). Upstream of the fHbp gene and similarly oriented is the cbbA gene encoding a fructose-bisphosphate aldolase. Previous studies have shown that the fHbp gene is transcribed from a FNR-regulated promoter, responsible for oxygen-dependent regulation of fHbp, within the upstream intergenic region and at least in some strains is also transcribed in a bicistronic transcript with the cbbA gene (7).

fHbp is a component of Bexsero and Trumenba, two recently licensed vaccines against meningococcus B. Bexsero contains fHbp var1.1 in combination with two additional recombinant proteins (NHBA and NadA) and outer membrane vesicles from the New Zealand outbreak strain NZ98/254 (9). Trumenba contains two recombinant lipidated fHbp subvariants (var1.55 and var3.45) (10). Killing of the bacteria by anti-fHbp antibodies in the presence of human complement (serum bactericidal assay, SBA) is used to predict the efficacy of the vaccine in humans. This assay showed that although fHbp proteins can be cross-protective against strains expressing fHbp subvariants within the same variant group, cross-protection against strains expressing heterologous variants is generally not observed, with the exception of some residual cross-reactivity between fHbp variants 2 and 3.

The expression of fHbp by the different clinical isolates is important to understand the role of the protein in bacterial virulence and as vaccine target. However, so far, the two methodologies used to quantify the expression of the protein are based on ELISA or FACS assays (11). These methods use anti-fHbp antibodies and therefore are significantly affected by sequence diversity of fHbp, so it is unclear whether the results reflect the amount of expressed protein, the antigenic distance, or both.

Selected reaction monitoring (SRM), a quantitative MS technique, emerged as a powerful method for specific and accurate quantification of a selected protein in a complex biological mixture (12). Here we applied, for the first time to our knowledge, SRM-MS technology for the absolute quantification of fHbp protein in a panel of 105 serogroup B meningococcal strains representative of the genetic diversity of N. meningitidis isolates from cases of invasive disease.

The results allowed us to discover that the expression of the protein is genetically determined and linked to the promoter sequence, and that strains carrying var1 express significantly more fHbp compared with var2 and var3 strains. In addition, a clear correlation was found between the amount of protein expressed and the susceptibility to killing in the SBA assay. The number of antigen molecules able to trigger a positive SBA response using rabbit complement ranged from a minimum of 757 to a maximum of 9,390 molecules per cell, which correspond to average distances between two fHbp on the bacterial surface ranging from 115 to 33 nm; this distance is compatible with the binding of two fHbp-Ig complexes to the arms of the complement factor C1q, the first component of the classic complement pathway (13, 14).

Results

Quantitative MS Reveals That Variant 1 Strains Express More fHbp Compared with Variant 2 and Variant 3 Strains.

SRM-MS was used for the targeted quantification of fHbp (15). In this assay, synthetic, ¹³C-¹⁵N-lysine– or -arginine–labeled peptides identical to those deriving from the tryptic digestion of the protein of interest (proteotypic peptides, PTPs) are used as surrogates for the final protein quantification. The PTPs are selected to be uniquely associated to the protein of interest and easily measurable by MS. Starting from the tryptic digestion of selected recombinant fHbp proteins, nine PTPs able to cover the selected fHbp variants were used. Each subvariant was identified by a minimum of two specific peptides, such as in the case of var1.4, to a maximum of five peptides, such as for var1.1, var2.16, var2.19, var3.31, var3.45, and var3.47 (Tables S1 and S2). Further details on the selection and validation of PTPs and the SRM-MS methodology are given in Supporting Information.

Table S1.

List of PTPs used for the SRM analysis and their association with the different fHbp subvariants

	fHbp
	Var1					Var2					Var3
PTP sequence	1.1	1.4	1.13	1.14	1.15	2.16	2.19	2.21	2.24	2.25	3.29	3.30	3.31	3.45	3.47
FDFIR	+	+	+	+	+	+	+	+	+	+
LTYTIDFAAK	+	+	+	+	+	+	+						+	+	+
GTAFGSDDAGGK	+		+	+	+
GLQSLTLDQSVR	+		+
GSYSLGIFGGK	+
AQEIAGSATVK						+	+	+	+	+	+	+	+	+	+
SHAVILGDTR						+	+	+	+	+	+	+	+	+	+
IDSLINQR						+	+	+	+	+		+	+	+	+
FDFVQK											+	+	+	+	+

Table S2.

List of optimized SRM transitions for the selected PTP

	Light			Heavy
PTP sequence	Q1	Q3	CE	Q1	Q3	CE
FDFIR	349.19	435.27	12	354.19	445.28	12
	349.19	550.30	12	354.19	560.31	12
LTYTIDFAAK	571.81	551.28	20	575.82	559.30	20
	571.81	664.37	20	575.82	672.38	20
	571.81	765.41	20	575.82	773.43	20
	571.81	928.48	20	575.82	936.49	20
GTAFGSDDAGGK	541.74	447.22	19	545.75	455.23	19
	541.74	649.28	19	545.75	657.29	19
	541.74	706.30	19	545.75	714.32	19
	541.74	853.37	19	545.75	861.38	19
GLQSLTLDQSVR	658.86	489.28	23	663.87	499.29	23
	658.86	717.39	23	663.87	727.40	23
	658.86	818.44	23	663.87	828.44	23
	658.86	1018.55	23	663.87	1028.56	23
GSYSLGIFGGK	543.28	408.22	19	547.29	416.24	19
	543.28	578.33	19	547.29	586.34	19
	543.28	691.41	19	547.29	699.43	19
	543.28	778.45	19	547.29	786.46	19
AQEIAGSATVK	537.79	562.32	19	541.80	570.33	19
	537.79	633.38	19	541.80	641.37	19
	537.79	746.44	19	541.80	754.45	19
	537.79	875.48	19	541.80	883.50	19
SHAVILGDTR	534.79	674.38	19	539.80	684.39	19
	534.79	773.45	19	539.80	783.46	19
	534.79	844.49	19	539.80	854.50	19
IDSLINQR	479.77	530.30	17	484.77	540.31	17
	479.77	730.42	17	484.77	740.43	17
	479.77	845.45	17	484.77	855.46	17
FDFVQK	392.21	374.24	13	396.21	382.25	14
	392.21	521.31	13	396.21	529.32	14
	392.21	636.33	13	396.21	644.35	14

CE, collision energy (volts); Q1, m/z parental ion; Q3, m/z fragment ion.

SRM-MS was used to quantify fHbp on 35 strains for each of the var1, var2, and var3 antigenic variants, for a total of 105 strains, selected to represent the genetic diversity of serogroup B meningococcus (MenB) (Table S3 and Figs. S1 and S2). Briefly, the prevalence of fHbp variants was analyzed in an internal database of 2,498 invasive MenB clinical isolates from different epidemiological years; in this collection var1, var2, and var3 strains accounted, respectively, for 63.1%, 24.3%, and 12.6% of the total (Table S4), and this was consistent with the recent literature (6, 16, 17). The 35 strains selected for each variant were representative of the relative frequencies of the five most prevalent fHbp subvariants, as well as the genetic diversity of serogroup B meningococcal strains (Tables S3 and S4 and Figs. S1 and S2). Overall, the 15 selected subvariants accounted for roughly 80% of the strains present in the database.

Table S3.

List and main features of the 105 MenB strains selected for the analysis

Isolate	fHbp	ST	CC	Country
DE11238	1.1	2,506	ST-32 complex/ET-5 complex	Germany
H44/76	1.1	32	ST-32 complex/ET-5 complex	Norway
ISS-1970	1.1	2,501	ST-32 complex/ET-5 complex	Italy
LNP24356	1.1	34	ST-32 complex/ET-5 complex	France
M07-0241099	1.1	32	ST-32 complex/ET-5 complex	United Kingdom
M09051	1.1	32	ST-32 complex/ET-5 complex	United States
M11295	1.1	32	ST-32 complex/ET-5 complex	United States
M15564	1.1	32	ST-32 complex/ET-5 complex	United States
M16019	1.1	32	ST-32 complex/ET-5 complex	United States
MC58	1.1	74	ST-32 complex/ET-5 complex	United Kingdom
DE11266	1.4	41	ST-41/44 complex/Lineage 3	Germany
ISS-1992	1.4	7,313	ST-41/44 complex/Lineage 3	Italy
LNP24188	1.4	41	ST-41/44 complex/Lineage 3	France
M07-0240967	1.4	41	ST-41/44 complex/Lineage 3	United Kingdom
M07-0241140	1.4	1,194	ST-41/44 complex/Lineage 3	United Kingdom
M11003	1.4	5,097	ST-41/44 complex/Lineage 3	United States
M18133	1.4	41	ST-41/44 complex/Lineage 3	United States
N23/07	1.4	1,341	ST-41/44 complex/Lineage 3	Norway
DE11301	1.13	1,243	ST-60 complex	Germany
LNP24442	1.13	6,584	ST-41/44 complex/Lineage 3	France
M01-240200	1.13	275	ST-269 complex	United Kingdom
M08-0240031	1.13	1,161	ST-269 complex	United Kingdom
M11048	1.13	60	ST-60 complex	United States
DE11309	1.14	42	ST-41/44 complex/Lineage 3	Germany
ISS-2031	1.14	1,403	ST-41/44 complex/Lineage 3	Italy
LNP24566	1.14	41	ST-41/44 complex/Lineage 3	France
M07-0240901	1.14	3,346	ST-41/44 complex/Lineage 3	United Kingdom
M10573	1.14	44	ST-41/44 complex/Lineage 3	United States
NZ98/254	1.14	42	ST-41/44 complex/Lineage 3	New Zealand
DE11275	1.15	2,693	ST-269 complex	Germany
LNP24350	1.15	269	ST-269 complex	France
M08-0240246	1.15	269	ST-269 complex	United Kingdom
M08-0240303	1.15	1,214	ST-269 complex	United Kingdom
M08-0240312	1.15	1,195	ST-269 complex	United Kingdom
M08449	1.15	1,214	ST-269 complex	United States
961-5945	2.16	153	ST-8 complex/Cluster A4	Australia
M07576	2.16	35	ST-35 complex	United States
M08-0240104	2.16	35	ST-35 complex	United Kingdom
M10182	2.16	35	ST-35 complex	United States
M10703	2.16	457	ST-35 complex	United States
DE11232	2.19	691	ST-41/44 complex/Lineage 3	Germany
DE11455	2.19	839	ST-41/44 complex/Lineage 3	Germany
E-19469	2.19	1,163	ST-269 complex	Spain
E-19740	2.19	1,163	ST-269 complex	Spain
ISS-2046	2.19	414	ST-41/44 complex/Lineage 3	Italy
LNP24266	2.19	1,163	ST-269 complex	France
LNP24622	2.19	146	ST-41/44 complex/Lineage 3	France
M01-240013	2.19	275	ST-269 complex	United Kingdom
M03153	2.19	5,906	ST-41/44 complex/Lineage 3	United States
M04407	2.19	6,160	ST-41/44 complex/Lineage 3	United States
M07-0240679	2.19	1,163	ST-269 complex	United Kingdom
M07-0240852	2.19	146	ST-41/44 complex/Lineage 3	United Kingdom
M08-0240065	2.19	409	ST-41/44 complex/Lineage 3	United Kingdom
M08117	2.19	5,879	ST-41/44 complex/Lineage 3	United States
M09154	2.19	5,968	ST-269 complex	United States
M10994	2.19	44	ST-41/44 complex/Lineage 3	United States
M11053	2.19	275	ST-269 complex	United States
M12566	2.19	5,111	ST-41/44 complex/Lineage 3	United States
M13084	2.19	409	ST-41/44 complex/Lineage 3	United States
M16683	2.19	437	ST-41/44 complex/Lineage 3	United States
DE11478	2.21	162	ST-162 complex	Germany
LNP24651	2.21	32	ST-32 complex/ET-5 complex	France
M11113	2.21	162	ST-162 complex	United States
DE11360	2.24	136	ST-41/44 complex/Lineage 3	Germany
ISS-1995	2.24	1,403	ST-41/44 complex/Lineage 3	Italy
M07-0240702	2.24	3,101	ST-41/44 complex/Lineage 3	United Kingdom
M07639	2.24	5,876	ST-269 complex	United States
M11095	2.24	136	ST-41/44 complex/Lineage 3	United States
ISS-1994	2.25	5836	Singleton	Italy
M14549	2.25	6,063	ST-103 complex	United States
DE11343	3.29	32	ST-32 complex/ET-5 complex	Germany
ISS-1991	3.29	7,315	ST-32 complex/ET-5 complex	Italy
ISS-2033	3.29	3,327	ST-865 complex	Italy
M01-0240988	3.30	213	ST-213 complex	United Kingdom
M14815	3.30	32	ST-32 complex/ET-5 complex	United States
D8300	3.31	32	ST-32 complex/ET-5 complex	Germany
LNP24447	3.31	11	ST-11 complex/ET-37 complex	France
M01-0240364	3.31	11	ST-11 complex/ET-37 complex	United Kingdom
M01-240355	3.31	213	ST-213 complex	United Kingdom
M02441	3.31	96	ST-269 complex	United States
M03369	3.31	1,576	Singleton	United States
M06747	3.31	136	ST-41/44 complex/Lineage 3	United States
M15875	3.31	162	ST-162 complex	United States
M18070	3.31	162	ST-162 complex	United States
TH-167	3.31	162	ST-162 complex	Greece
DE11158	3.45	8,334	ST-213 complex	Germany
DE11419	3.45	8,301	ST-213 complex	Germany
E-19502	3.45	213	ST-213 complex	Spain
E-19528	3.45	3,496	ST-213 complex	Spain
E-19698	3.45	213	ST-213 complex	Spain
LNP24423	3.45	6,765	ST-213 complex	France
LNP24654	3.45	3,496	ST-213 complex	France
LNP24674	3.45	2,899	ST-213 complex	France
M01-240320	3.45	213	ST-213 complex	United Kingdom
M07-0240606	3.45	213	ST-213 complex	United Kingdom
M08-0240192	3.45	213	ST-213 complex	United Kingdom
M18013	3.45	213	ST-213 complex	United States
DE11243	3.47	8,363	ST-461 complex	Germany
E-19559	3.47	7,010	ST-461 complex	Spain
E-19593	3.47	461	ST-461 complex	Spain
ISS-2043	3.47	1,946	ST-461 complex	Italy
LNP24155	3.47	1,946	ST-461 complex	France
LNP24551	3.47	34	ST-32 complex/ET-5 complex	France
M07-0240891	3.47	5,983	ST-461 complex	United Kingdom
M08-0240032	3.47	461	ST-461 complex	United Kingdom

ET, electrophoretic type; ST, sequence type.

Fig. S1.

Strains selected for the analysis are representative of the genetic diversity of circulating serogroup B meningococcal strains.

Fig. S2.

Phylogenetic distribution of fHbp by SplitsTree analysis of the 258 different subvariants present in the strain collection analyzed. The tree shows the clustering of the proteins in the three main variants (Var1, Var2, and Var3) and in the two subfamilies (A and B). The five most representative subvariants for each variant evaluated in this study are indicated.

Table S4.

Absolute and relative frequencies of strains expressing different fHbp variants and subvariants

fHbp variant	fHbp subvariant	Absolute frequency, % on strain collection	Relative frequency, % on main variant	No. of strains selected for the analysis
Var1	1.1	14.9	23.5	10
	1.4	11.7	18.5	8
	1.15	9.3	14.8	6
	1.14	8.4	13.4	6
	1.13	6.4	10.1	5
	1.others	12.4
		Total on strain collection: 63.1	Total on var1: 80.3	Total of var1 selected strains: 35
Var2	2.19	11.6	47.9	20
	2.16	2.6	10.7	5
	2.24	2.6	10.5	5
	2.21	2	8.1	3
	2.25	1.4	5.8	2
	2.others	4.1
		Total on strain collection: 24.3	Total on var2: 82.9	Total of var2 selected strains: 35
Var3	3.45	3.2	25.2	12
	3.31	2.6	20.1	10
	3.47	1.8	14.4	8
	3.29	0.8	6.7	3
	3.30	0.5	3.8	2
	3.others	3.7
		Total on strain collection: 12.6	Total on var3: 70.2	Total of var3 selected strains: 35

The data were obtained from the analysis of an internal strain collection including 2,498 MenB invasive strains from different geographical settings. Within each main variant, strains expressing fHbp in one of the five most prevalent subvariants were considered. From each main variant group 35 strains were chosen, reflecting the relative frequency of subvariants.

The meningococcal strains were found to express from less than 105 pg of fHbp per microgram of cell extract, which is here defined as the lower limit of quantitation (LLOQ), to a maximum of 1,681 pg/µg of cell extract. Assuming MC58 as reference strain to measure the surface area of the bacteria, we can calculate that each cell contains from less than 587 to a maximum of 9,390 fHbp molecules (Table 1, Table S3, and Supporting Information). In other words, the amount of fHbp expressed can vary at least 15-fold.

Table 1.

Bactericidal titers of pooled mice sera immunized with var1, var2, and var3 fHbp subvariants against homologous and heterologous strains

fHbp variant	fHbp subvariant*	Strain	fHbp amount, pg/µg total extract	No. of fHbp per cell	Distance, nm	SBA titers
						Anti-var1.1	Anti-var1.4	Anti-var1.15
var1	1.1	H44/76	721.73	4,031	50	65,536	n.d	256
		M16019	271.26	1,515	81	8,192	n.d.	<64
	1.4	M07-0241140	427.22	2,386	65	2,048	2,048	16
		LNP24188	146.59	818	110	512	512	<16
	1.15	M08449	1,011.85	5,651	42	2,048	n.d.	65,536
		LNP24350	440.92	2,463	64	2,048	n.d.	32,768
						Anti-var2.16	Anti-var2.21	Anti-var3.45	Anti-var3.47
var2	2.16	M08-0240104	1,681.25	9,390	33	8,192	4,096	8,192	n.d.
		M075076	173.79	971	101	512	512	512	n.d
	2.21	M11113	135.45	757	115	<16	512	<16	n.d.
		LNP24651	<LLOQ	<587	>130	<16	<16	<16	n.d.
var3	3.45	M01-0240320	198.99	1,111	95	4,096	2,048	8,192	n.d
		E-19502	<LLOQ	<587	>130	<16	<16	<16	n.d.
		E-19698	<LLOQ	<587	>130	<16	<16	<16	n.d.
	3.47	M08-0240032	165.84	926	104	<16	64	512	4,096
		LNP24155	<LLOQ	<587	>130	16	<16	16	<16

For each subvariant, two or three strains expressing different levels of fHbp (reported as picograms per microgram of total extract and as number of fHbp copies per cell) were selected (indicated with triangles in Fig. 1A). Titers obtained with the homologous sera are in bold. Pooled baby rabbit serum was used as complement source. n.d., not done.

^*The subvariants are ordered with respect to increasing sequence diversity.

Ninety of the 105 strains analyzed provided an SRM signal above the LLOQ (Fig. 1). All strains with fHbp quantities below LLOQ belonged to var2 and var3 fHbp. Within variant 1, 80% of the strains analyzed (28/35) had SRM values above 200 pg/µg of total extract (corresponding to a number of fHbp molecules greater than 1,100), whereas 20% (7/35) had an amount of fHbp below 200 pg/µg of total extract. In marked contrast, among strains carrying var2 or var3 subvariants, 74% and 82%, respectively, had fHbp SRM values below 200 pg (26 strains for var2 and 29 strains for var3) (Fig. 1 A and B). Of note, strain M08-0240104, which carries var2.16, is an outlier within var2 (Fig. 1 A and C) and had the highest fHbp SRM values among the 105 tested strains (1,681.25 pg/µg of total extract). Overall, as shown in Fig. 1C, statistical analysis confirmed that strains carrying var1 fHbp subvariants expressed significantly higher amounts of protein compared with var2 or var3 strains (Mann–Whitney P values <<0.0001). In variant 1, heterogeneity of fHbp levels was observed, whereas strains carrying var2 or var3 had generally a more homogeneous amount of fHbp across subvariants.

Fig. 1.

SRM quantification of fHbp in 105 invasive MenB clinical isolates expressing different fHbp subvariants. (A) Strains are grouped according to the expressed fHbp variant and subvariant, as indicated on the x axis. Symbols represent amount of fHbp (average value obtained from two different trypsin digestion run in three technical replicate experiments) measured by SRM for each strain and expressed as picograms of protein per microgram of total cell extract. Triangles indicate strains used for SBA testing. Dotted line indicates the lower limit of detection (LLOQ) set as 105 pg/µg. (B) For each main variant group, the proportion of strains expressing different levels of fHbp is indicated (P < 0.05). (C) Boxplots showing the 95% frequency intervals (whiskers), interquartile range (solid box), and median (central thick line) of the absolute amount of fHbp measured in SRM (>LLOQ) in var1, var2, and var3 MenB strains. All of the 35 tested var1 strains had a level of fHbp that was measureable in SRM, whereas 2 var2 strains and 13 var3 strains had fHbp level below the assay LLOQ. All undetectable quantifications have been imputed to the half LLOQ in this plot. Statistical analysis indicates highly significant differences of the measureable fHbp expression between var1 and var2 and between var1 and var3, respectively (P < 0.001).

fHbp Expression Can Be Predicted by the cbba–fHbp Intergenic Region and Is Independent of the Clonal Complex.

The observation that the expression of fHbp correlated with the antigenic variant, which is independent of the genetic classification of N. meningitidis in clonal complexes (CCs), led us to investigate the sequence of the cbbA–fHbp intergenic region upstream from the fHbp gene. The region was sequenced in the 105 strains under investigation. Two strains belonging to subvariant 2.19, LNP24622 and M07-0240852, were not considered in the analysis because they contained an insertion sequence (IS30) 73 nt downstream from the stop codon of cbbA.

A phylogenetic tree was constructed from the multiple sequence alignment of the 103 sequences by the unweighted pair group method with arithmetic mean (UPGMA) method (see Fig. S6). The tree allowed the identification of eight major promoter clades (Fig. 2A). Most of the strains of var1 were associated to clades I to IV. As shown in Fig. 2B, clade I contained mostly var1.1, clade II contained mostly var1.15, clade III contained mostly var1.4, and clade IV contained mostly var1.13 and var1.14. Interestingly, all of the strains harboring var2, irrespective of their subvariant, were found in clade V and had very similar and low amounts of the protein (Fig. 2B). Finally, clades VI, VII, and VIII contained strains expressing fHbp subvariants 3.45, 3.31, and 3.47, respectively. When the absolute amount of fHbp measured in each strain was plotted against the clades of the intergenic region, we found that the protein expression was associated with the promoter clade (Fig. 2C). Clades I and II, containing mostly var1.1 and var1.15, showed the highest median SRM-MS quantities, whereas 7 out of 13 strains associated with clade VI and carrying fHbp var3.45 had fHbp values below the LLOQ.

Fig. S6.

Multiple sequence alignment of the cbba–fHbp intergenic regions in the panel of MenB strains analyzed in this study. Dots represent conserved positions, and mismatches are indicated with nucleotides.

Fig. 2.

Association between promoter clades and fHbp variants and subvariants. (A) UPGMA-generated phylogenetic tree obtained from the multiple sequence alignment of the cbbA–fHbp intergenic region of the 105 strains under investigation. Clades I to VIII were numbered progressively to reflect the prevalence of the main subvariants included. Association between clades and var1, var2, and var3 fHbp is indicated in red, blue, and green, respectively. (B) Histogram showing association of clades I to VIII with specific fHbp subvariants. Subvariants associated with each clade are indicated above each bar. (C) Boxplots showing the distribution of SRM-MS values of different strains clustered by promoter clades. Thick bars indicate the median SRM-MS value for each group, each box delimits the interquartile range, and the whiskers mark the 95% frequency intervals of SRM-MS values.

Furthermore, the analysis of fHbp expression in strains belonging to CCs 269 and 41/44, both of which contain strains that either express fHbp var1 or var2, confirmed that the amount of protein expressed correlated with the protein variant and promoter clade irrespective of CC (Fig. S3 and Supporting Information).

Fig. S3.

Boxplots showing the distribution of fHbp SRM values of 47 strains harboring var1 or var2 fHbp subvariants, grouped by CC (n = 15 var1 CC41/44 strains; n = 16 var2 CC41/44 strains; n = 8 var1 CC269 strains; n = 8 var2 CC269 strains). Closely reflecting the measured differences of SRM values across fHbp variants, var1 CC41/44 strains express significantly higher amounts of fHbp compared with var2 CC41/44 strains (Mann–Whitney P < 0.05). Var1 CC269 strains express significantly higher amounts of fHbp compared with var2 CC269 strains (Mann–Whitney P < 0.001).

Complement-Mediated Killing Requires More Than 587 fHbp Molecules per Cell.

To investigate the relationship between antigen quantity and susceptibility to killing in SBA, we used an MC58 ΔfHbp strain complemented with an fHbp gene expressing var1.1 under the control of an isopropyl β-d-1-thiogalactopyranoside (IPTG)-inducible promoter. Following induction with increasing IPTG concentrations, bacteria expressing incremental amounts of fHbp were obtained. The incremental amount of total protein was detected by Western blot (Fig. 3A) and the differential fHbp expression on the bacterial surface was confirmed by flow cytometry (Fig. 3B). Interestingly, when the recombinant MC58 strains were tested in an ex vivo human serum assay, we found that resistance to serum killing was correlated with the amount of fHbp exposed on the surface (Fig. 3 B and C and Supporting Information), thus confirming that in this strain the level of fHbp is directly influencing survival in human serum.

Fig. 3.

Quantification of fHbp in natural and recombinant MC58 strains. (A) Western blot analysis with anti-fHbp var1.1 polyclonal mouse antisera on MC58 WT, MC58 ΔfHbp, and MC58 ΔfHbp strain complemented with fHbp var1.1 induced with increasing concentrations of IPTG (0, 0.0075, 0.03, and 0.1 mM IPTG). (B) FACS analysis performed using polyclonal anti-fHbp var1.1 mouse antisera against the same strains in the same conditions analyzed by Western blot. (C) The level of fHbp expression influences meningococcal survival in human serum; 10⁴ bacterial cfu of the MC58 strains cited above were incubated with 40% human serum, in the presence of increasing concentrations of IPTG. Bacterial survival was monitored for 180 min. Red: MC58WT; gray: MC58ΔfHbp; cyan: MC58 c_fHbpv1.1 (IPTG 0.1 mM); orange: MC58 c_fHbp va1.1 (IPTG 0.03 mM); green: MC58 c_fHbp va1.1 (IPTG 0.0075 mM); blue: MC58 c_fHbpv1.1 (IPTG 0 mM).

The amount of fHbp expressed in the different conditions was then determined by SRM-MS (Table 2). Growth without IPTG and with 0.0075 mM IPTG induced levels of fHbp below the LLOQ, which is 105 pg/µg extract (corresponding to 587 molecules per cell). In contrast, 0.03 and 0.1 mM IPTG induced the expression of 2,928 and 4,765 molecules per cell, respectively. In the bactericidal assay in the presence of antibodies against the homologous var1.1 and rabbit complement, bacteria induced with 0.03 and 0.1 mM IPTG were killed up to a serum dilution of 1/4,096 and 1/16,384, respectively, whereas those expressing levels below LLOQ were not killed, suggesting that 587 fHbp molecules were insufficient to mediate killing of MC58 strain by homologous serum. Table 1 also shows that when using heterologous sera, raised against antigenically diverse protein variants, a higher antigen density was required.

Table 2.

SRM-MS data and SBA results obtained for MC58 expressing increasing amount of fHbp var1.1 as a result of induction with different IPTG concentrations

					SBA results
Strain	IPTG concentration,mM	fHbp amount, pg/µg total extract	No. of fHbp per cell	Distance, nm	Anti-var1.1*	Anti-var1.4*	Anti-var1.15*	Anti-capsule†
MC58 c_fHbp	0	<LLOQ	<587	>130	<16	<16	<16	>65,536
MC58 c_fHbp	0.0075	<LLOQ	<587	>130	<16	<16	<16	>65,536
MC58 c_fHbp	0.03	526.10	2,928	58	4,096	256	<16	>65,536
MC58 c_fHbp	0.1	856.08	4,765	46	16,384	4,096	16	>65,536

Baby rabbit serum was used as source of exogenous complement. Positive titers are considered as titers >16.

^*SBA results were obtained with homologous (anti-var1.1) as well as heterologous mouse antisera (i.e., anti-var1.4 and anti-var1.15).

^†An anti-serogroup B capsular monoclonal antibody (SEAM 12) was used as control of the experiment.

We then tested the bactericidal activity of antisera raised against fHbp var1, var2, and var3 subvariants in a subpanel of 15 natural MenB clinical isolates, expressing the homologous variants at high or low levels (indicated with triangles in Fig. 1A). SBA titers obtained with homologous sera (Table 1) showed a clear and statistically significant correlation with SRM-MS quantifications (Fig. S4). As observed with the recombinant MC58 strain, the clinical isolates with values below LLOQ had negative SBA titers. The lowest number of molecules per cell giving a positive killing was 757, 818, 926, and 971 from variants 2.21, 1.15, 3.47, and 2.16, respectively.

Fig. S4.

Correlation between SBA titers and SRM-MS quantification. SRM fHbp quantifications (horizontal axis) plotted versus their corresponding SBA titers for 11 tested MenB strains (6 var1, 3 var2, and 2 var3 strains). Results for each strain are plotted using variant-specific symbols. The solid line shows the expected SBA titers within the range of measured SRM quantifications, fitted by maximum likelihood estimation of the Poisson regression intercept and slope coefficients. The regression slope was positive and highly statistically significant (P << 0.05), showing that expression of increasing amounts of fHbp, as measured in SRM, corresponds to an increased strain susceptibility to antibody-mediated killing, as measured by SBA titers.

Antisera against fHbp var1.1, var1.15, var2.16, var2.21, and var3.45 were also tested against heterologous strains (Table 1). SBA testing with anti-var1 on var2 and var3 strains, and the contrary, were not performed because no cross-protection is expected between var1 and var2/3 strains (4). Anti-var1.1 sera showed positive titers both against the closely related var1.4 strains (medium and low expressors) and against the more distant var1.15 strains, which express high levels of fHbp; in contrast, anti-var1.15 sera elicited a positive SBA response only against heterologous strains that produce high levels of fHbp, whereas the titers became very low or negative when level of expression was medium or low. Similarly, anti-var2 sera gave positive titers only against medium- and high-expressor strains of heterologous var2 and var3 subvariants, whereas only the homologous anti-var2.21 serum was positive on the low-expressor M11113 strain (titer was lost when using either anti-2.16 or anti-3.45 fHbp antisera). Interestingly, SBA titers obtained against var3.47 strain M08-0240032 (SRM-MS value of 166 pg/µg) decreased proportionally with sequence diversity. Altogether these data indicate that as sequence diversity becomes greater the SRM-MS threshold for bacterial killing becomes higher.

The Antigen Density Required for Killing Is Consistent with C1q Activation.

To understand whether the amount of antigen required for bacterial killing is consistent with what is known about complement activation, we calculated the surface area of a meningococcal cell starting from transmission electron microscopy negative staining images and following previously described procedures (18, 19). We found that in the case of the MC58 strain the surface area is 4.98 µm². Considering that fHbp is uniformly distributed on the bacterial surface (ref. 10 and Fig. S5), we calculated the distance between flanking antigen molecules (d) as a function of the surface area of the bacterium (A) and of the number of molecules (n) present on the bacterial surface, according to the formula d = $\sqrt{2\left(\text{A}/\text{n}\right)}$. Considering MC58 as the reference strain, and assuming that only marginal differences exist in the dimensions of meningococcal strains (20), the distance between adjacent molecules on isolates expressing fHbp at levels compatible with SBA data (Table 1) ranges between 33 nm (strain M08-0240104, n = 9,390) and 115 nm (calculated average distance between two fHbp molecules) (Table 2 and Fig. 4), whereas bacteria with negative SBA had a distance between molecules of 130 nm or more. These data are consistent with the necessity of having at least two antibodies engaging the C1q arms (21) and are in line with theoretical and experimental models of C1q:IgG complexes available in the literature (13, 14, 22). In fact, it has been recently shown that IgG hexamers can form an optimal complex with C1q that in this configuration places its globular distal domains around a circle of 30 nm in diameter. Assuming a certain C1q flexibility and the contribution provided by antigens and antibodies to the antigen–antigen distance, it follows that C1q should be able to engage antigens that are 33–115 nm apart, but not antigens distant 130 nm or more (Fig. 4).

Fig. S5.

Expression of fHbp is uniform on the surface of meningococcal strains. ImmunoGold labeling and transmission electron microscopy analysis of MC58 strain performed with antisera raised in mice against fHbp var1.1.

Fig. 4.

Distance between flanking fHbp molecules on MC58 influences correct engagement of C1q. To calculate the theoretical distances between fHbp molecules onto the bacterial surface, a grid of identical squares was superimposed to the diplococcal surface (A–C). Distance values were calculated by d=$\sqrt{2\left(\text{A}/\text{n}\right)}$ , where d corresponds to the square side of the grid, A represents the diplococcus area (4.98 μm² for MC58 strain), and n is the total number of fHbp molecules. Left panels represent the intermolecular distances calculated for strains expressing fHbp at the LLOQ (n = 587), at n = 757 (strain M11113), and at n = 9,390 (strain M08-0240104), respectively. Right panels depict the theoretical model of the complex between C1q and the Fc portions of IgG immunoglobulins bound to flanking fHbp antigens on the bacterial surface when different fHbp intermolecular distances occur.

Discussion

Quantification of single antigens in whole-cell extracts, usually done by ELISA, immunoblotting, or other immunoassays, becomes very challenging when dealing with antigenically variable antigens, because the antibody recognition depends both on the amount and antigenic variability of the antigen. Here we used the power of SRM-MS to measure the absolute quantity of fHbp in a panel of clinical isolates representative of the global population of N. meningitidis, and this allowed us to make a number of observations that are relevant for understanding the pathogenesis of the bacterium and its susceptibility to fHbp-mediated immunity and for interpreting the structural and molecular mechanisms of the first steps of the complement-mediated killing of the bacteria.

The first observation is that the quantity of fHbp expressed by clinical isolates can differ at least 15-fold and that var1 strains express significantly more protein than var2 and var3 strains. This observation confirms the preliminary studies of Hong et al. (23) showing that fHbp expression was lower in variants 2 and 3 compared with variant 1 strains. Because it is known that meningococcal strains can express alternative hfH binding factors such as NspA and PorB2/3 alleles (24–26) that might contribute to bacterial serum resistance, these findings raise the question of whether the expression of these alternative factors might be higher in var2 and var3 strains to compensate for lower fHbp amount.

The second observation is that the amount of protein expressed can be predicted from the nucleotide sequence of the promoter region and does not correlate with any of the conventional classifications such as serotype, CC, or coding sequence type. This finding, although it reiterates the complexity of the N. meningitidis population, provides a very easy way to predict the amount of protein expressed in clinical isolates, given that sequencing is easily available globally. The amount of fHbp that is present at any time in the bacterium is the result of a tight interplay between gene transcription and mRNA abundance on one hand and the mechanism of posttranslational modifications and protein turnover on the other hand. The correlation found between SRM-detected fHbp protein amount and sequence of the cbbA–fHbp intergenic region indicates that gene transcription plays a major role in determining the final amount of detectable fHbp in the bacterial cell. However, published data suggest that var2 and var3 are less stable than var1 fHbp, as shown by differential scanning calorimetry analysis and by the difficulty in obtaining full-length 3D structures of var2 and var3 fHbp in the absence of hfH as a stabilizing factor (27, 28). As a consequence, although it is not possible to exclude that the overall observed lower amount of fHbp var2 and var3 is the consequence of a faster turnover and degradation of these protein variants compared with the more stable var1 counterpart, the presence of var2 strains such as M08-0240104 that show very high SRM values suggests that protein degradation can only be a minor factor influencing fHbp quantification. Previously it has been shown that expression of fHbp could vary among genetic lineages (29). The data presented here support these findings and in addition show that in those CCs that include strains expressing either var1 or var2 fHbp, the level of expression depends on the fHbp locus (protein variant and promoter clade) and not only on the CC. The third observation is that the susceptibility of the bacteria to complement-mediated killing correlates with the amount of protein expressed. When sera against the homologous protein were used, it was found that at least 135 pg/µg of total extract or 757 molecules per cell were required for killing. When the sera are not raised against the homologous variant, the amount of antigen required is higher. Complement is activated through the classic pathway when the C1q component binds one of its targets on the bacterial surface (14, 30). In meningococci, in the presence of immune sera, the Fc portions of an antigen:antibody complex are the main targets of C1q. Previously it was shown that antigen density and antibody recognition of different epitopes on the same fHbp molecule are important factors that trigger the complement-mediated killing of meningococcal strains (31, 32); the absolute quantification of fHbp molecules on the bacterial cell allowed us to identify the critical threshold of fHbp molecules required for bacterial killing and the optimal distance between flanking antigen molecules that is required to achieve a multivalent, highly stable engagement of C1q component and consequential efficient activation of the complement cascade (13). It was found that bacteria with less than 587 molecules per cell were not susceptible to killing and that 757 molecules per cell were the minimum necessary to properly activate the complement cascade. However, optimal killing was only triggered when more than a thousand molecules per cell were present. These observations are consistent with previous findings that C1q binds a single Fc segment with very low affinity and therefore triggering the complement cascade requires C1q to bind at least two antigen-bound immunoglobulins (13, 21). In our calculations, this requires that the distance between the two antibodies be between about 33 nm to a maximum of 115 nm, which can be achieved with a density of 3,930 and 757 molecules per cell, respectively. In contrast, 587 molecules per cell would be at a distance of 130 nm and are too far apart to engage C1q.

Although this work allows a better understanding of the mechanism of SBA, it has some limitations and raises several questions that can be addressed in future studies. The first one is that in this study, to focus only on the effect of fHbp expression on the classic complement pathway activation, avoiding the presence of competing factors, we deliberately used rabbit complement. However, it is well known that in human serum fH and factor H-related protein 3 (FHR3) compete with antibodies for fHbp binding and therefore the number of molecules required for positive hSBA may prove to be different from in this study and may vary as a result of individual fH and FHR3 levels. The second question to be addressed in future studies is the role of the avidity and subclasses of antibodies. Here we used sera obtained with our standard immunization protocols; however, it is known that different immunization schedules and the use of adjuvants can change both the affinity and the subclasses of the antibodies and these may affect the SBA titers. Finally, whereas our model assumes that only one antibody would bind to fHbp, it is known that simultaneous antibody binding to the same molecule can occur. The dynamics of two antibodies can be studied using monoclonal antibodies. Other factors that we have not fully considered in this study are the impact of the binding of C1q to targets other than antibodies on the bacterial surface, the different affinity of hfH for the fHbp variants, and the actual amount of hfH that is present in the sera of different subjects.

Materials and Methods

Bacterial Strains and Growth Conditions.

N. meningitidis serogroup B strains used in this study are reported in Table S3. Strains were cultured as previously described (33).

Selection of PTPs for fHbp.

PTPs were selected from tryptic peptides obtained from recombinant variants 1.1, 2.16, and 3.45 (Table S1 and Supporting Information). PTPs were synthetized in light- and heavy-labeled forms by incorporating ¹³C-¹⁵N-lysine or -arginine residues (Table S2 and Supporting Information).

SRM-MS analysis.

Bacterial lysates and protein digestions were prepared as described in Supporting Information and the heavy-labeled version of PTP was spiked-in as internal standard for quantification (20 pmol/µL). For each strain two independent digestions were analyzed in triplicate (Dataset S1). SRM measurements were performed following the best practices reported in Carr et al. (15). Additional details on the methods for fHbp quantification and biological reproducibility assessment are given in Supporting Information.

Amplification and Sequencing of the fHbp Intergenic Region and Phylogenetic Analysis.

AccuPrime Taq DNA Polymerase System (Life Technologies) and the primers 1869-2F: GAAGAAATCGTCGAAGGCATCAAAC and fHbp_32 were used for the PCR amplifications (4). Sequence analysis was performed using ContigExpress (Vector NTI). The multiple sequence alignment of the 103 sequenced intergenic loci was performed with MUSCLE v 3.6 (Fig. S6). The phylogenetic tree was computed using the phangorn R package, applying the dist.ml distance modeling function, considering the insertion symbol “-” as a valid character and then applying the UPGMA tree reconstruction method.

Cloning, Expression, Purification, and Formulation of fHbp Subvariants.

The following recombinant fHbp subvariant proteins were expressed and purified: fHbp 1.1, fHbp 1.4 and fHbp 1.15; fHbp 2.16 and fHbp 2.21; and fHbp 3.45 and fHbp 3.47. Corresponding genes were cloned from strains MC58, M01-0240149, M01-0240185, 961-5945, M11113, M01-0240320, and M08-0240032 and expressed in Escherichia coli as His-tag fusion proteins, as previously described (33). For antigen formulation purified fHbp variants (100 µg/mL protein) were adsorbed onto aluminum hydroxide (Alum; 3 mg/mL).

Mouse Immunization Studies and SBA Analysis.

Mice immunization studies and serum bactericidal activity against MenB strains were performed as previously described (33) using pooled baby rabbit serum as the source of exogenous complement (Cederlane).

Inducible Expression of fHbp, Immunoblotting, and FACS.

N. meningitidis strains MC58 WT, MC58 ΔfHbp, and MC58 ΔfHbp complemented with fHbp var1.1 under the control of an IPTG-inducible promoter were grown in the same conditions as for the SBA assay. Increasing amounts of IPTG (Sigma)—0, 0.0075, 0.03, and 0.1 mM—were added to the initial culture medium to modulate the expression of fHbp. Immunoblotting and FACS analyses were performed using anti-fHbp var1.1 polyclonal antisera, as previously described (7, 33).

Survival Experiments in Human Serum.

N. meningitidis strains were grown in the same conditions as for the SBA assay, to an OD₆₀₀ of 0.25. The assay was started by the addition of 10 μL of the bacterial suspension to 190 μL of 40% (vol/vol) human serum diluted in HBSS++ (Sigma). Increasing concentrations of IPTG were added to maintain the expression of the protein over time. Samples were incubated at 37 °C and 5% CO₂, 180 rpm. At various time points an aliquot of each sample was plated in serial dilutions onto Müller–Hinton agar to determine the number of viable bacteria and incubated overnight at 37 °C and 5% CO₂. Experiments were run in duplicate. The culture in GC was used as growth control in bacterial rich medium.

Level of fHbp Expression Is Independent of CC

To assess whether the level of fHbp could be dependent on the strain’s genetic background, we considered a subpanel of 47/105∼45% MenB strains belonging to two of the most important hypervirulent CCs (CC41/44 and CC269) and expressing either var1 or var2 fHbp. Of the 47 strains, 31 belonged to CC41/44 and 16 belonged to CC269. Among the CC41/44 strains, 15 expressed var1 and 16 expressed var2 fHbp. The CC269 strains were equally split, with eight expressing var1 and eight expressing var2 fHbp. Notably, plotting the SRM values against strains expressing var1 or var2 and belonging to different CC, we found that, irrespective of CC, strains carrying var1 fHbp had higher SRM values compared with strains carrying var2 fHbp (Fig. S3). This observation confirms that the fHbp amount measured in SRM-MS is associated with the fHbp protein variant and is independent of the genetic relatedness between strains (i.e., CC).

Selection of PTPs for fHbp Quantification by SRM-MS.

Three recombinant fHbp (variants 1.1, 2.16, and 3.45) were boiled 5 min in 50 mM ammonium bicarbonate containing 0.1% (wt/vol) RapiGestSF (Waters) and digested overnight at 37 °C with trypsin [1/25 (wt/wt), enzyme/substrate ratio]. Peptide mixtures were separated and analyzed by LC-MS/MS on a SynaptG2 HDMS Q-TOF equipped with a nano electrospray ionization (ESI) source run in a data-dependent acquisition mode. Suitable proteotypic peptides were selected on the basis of the following criteria: (i) peptides show strong MS signal intensities either for the parental or fragment ions, (ii) peptides are specific for fHbp, (iii) peptides are present within the sequence of at least one of the 15 fHbp subvariants under investigation, and (iv) peptides do not contain methionine and tryptophan residues, which are susceptible to oxidation, and N-terminal glutamine, to avoid cyclization (Table S1). Selected PTPs were synthetized either in light- and heavy-labeled forms by incorporating ¹³C-¹⁵N-lysine or -arginine residues and quantified by the provider according to amino acid composition analysis (JPT Peptide Technologies GmbH). Synthetic peptides were used to optimize collision energy (CE) values starting from the theoretical value calculated using the formula CE = 0.034 × (parent m/z) + 1.314 (Table S2).

Sample Digestion for SRM-MS.

Bacteria were collected from agar plates and resuspended in 10 mL of PBS to an optical density at 600 nm (OD₆₀₀) of 0.8. Bacterial cells were pelleted by centrifugation at 3,000 × g for 15 min and lysed by boiling for 15 min in 500 μL of 5% (wt/vol) SDS, 100 mM Tris⋅HCl, pH 8, 50 mM DTT, and protease inhibitor mixture (Sigma). The protein concentration was determined using the 2D QuanKit (GE Healthcare) and the samples were stored at −20 °C until their use. Trypsin digestion of lysed bacterial samples was performed in duplicate using a filter-aided sample preparation protocol. The efficacy of the digestion was checked by SDS/PAGE and by assessing the number of missed cleavages inferior to 10% of identified peptide by LC-MS/MS as described above.

SRM-MS Analysis.

SRM analysis was performed on a TQ Xevo triple quadrupole mass spectrometer (Waters) equipped with an ESI source (Waters). Chromatographic separations of peptides were performed on an Acquity LC system (Waters) equipped with a 1- × 150-mm 1.7 μm CSA C18 column (Waters) by a 10-min linear gradient of 5–40% acetonitrile in water, containing 0.1% formic acid, with a flow rate of 80 μL/min. Both Q1 and Q3 were set at unit resolution (FWHM 0.7 Da). A spray voltage of 1,700 V was used with a heated ion transfer setting of 270 °C for desolvation. Data were acquired using MassLynx software (version 2.1.0; Waters). The dwell time was set to 30 ms and the scan width to 0.02 m/z. The peak area quantification was determined with TargetLynx software (version 1.0.0.1; Waters) after confirming the coelution of all transitions for each peptide and following the best practices reported in Carr et al. (15).

PTP Dose-Range Linearity Responses and fHbp Quantification.

The dose-range linearity response of the selected PTPs was assessed in a lysed bacterial sample prepared from MC58 ΔfHbp strain used as reference background to take into account the matrix effect. For fHbp quantification, labeled PTPs (final concentration 20 fmol/μL) and nonlabeled PTPs (final concentration from 1.9 to 300 fmol/μL) were spiked in 100 μg of total cell lysate prior to trypsin digestion, and SRM experiments were performed in triplicate, injecting 20 μg of lysate onto the column for LC-SRM analysis. For each PTP, concentrations were plotted as ratio of peak area light (variable)/peak area heavy (constant) and the fitted curve was used to deduce the concentration of selected PTP. The LLOQ for each PTP was set as the lowest concentration point on the fitted curve with an accuracy deviation ≤20%. The fHbp concentrations were reported in picograms per microgram of total protein extract, considering for all proteins the molecular mass of the fHbp var1.1.

Biological Reproducibility of the SRM-MS Assay.

To evaluate the biological reproducibility of our assay, we performed the quantification of fHbp from four randomly selected strains (var1.14, NZ98/254; var2.16, 961-5945; var2.16, M08-0240104; and var2.19, M10994) covering a wide range of expected fHbp expression values. These strains were grown in three different experimental sessions, varying growth medium lots and operator. The coefficient of variation (CV%) of fHbp expressions quantified in each of these three independent experiments ranged from 11 to 17%, showing a low overall data variability (Table S2). Estimated median SRM quantifications were 169.6, 301.6, 355.1, and 1,514.8 pg/µg of total extract for the strains 961-5945, M10994, NZ98/254, and M08-0240104, respectively, their smallest difference being (355.1 − 301.6)/355.1 ≈ 15%. A log-linear multiple regression was fitted to the measured SRM quantifications to estimate the component of data variability imputable to biological replication. The adjusted R square was over 99%, showing that this model explains virtually all data variability. Median SRM quantifications were found to vary about these estimates within a range of ±3% across different technical replicates and between −6% and +9% among the biological replicates. Because the smallest difference across median SRM quantifications (15%) was larger than 9%, these results demonstrate that neither technical nor biological variability hampers the detection of differences in fHbp SRM expression across different strains.

Calculation of fHbp Copy Number per Cell from SRM-MS Data.

Previous data have reported that 1 mL of liquid culture of strain MC58 at OD₆₀₀ = 0.5 corresponded to ∼2.5 × 10⁸ cfu of bacteria (33). Assuming that each cfu is originated from one single bacterial cell, it is possible to translate the fHbp concentrations obtained from SRM data (Table S3 and Dataset S1) to approximate numbers of fHbp copies per cell using the following formula:

$$\mathit{n}°=\frac{\left[\mathrm{C}\right]\mathrm{\cdot }\mathrm{V}}{\mathrm{n}}\mathrm{\cdot }\mathit{Na}\mathrm{,}$$

where n° is the fHbp copy number per cell, [C] is the fHbp concentration (femtomoles per microliter) calculated by SRM-MS data, V is the equivalent growth culture volume injected column for SRM-MS (5 × 10⁻⁵ L for all samples), n is the cfu number present in the volume V (considered 4 × 10⁶ for all samples), and Na is the Avogadro number (6.022 × 10²³ molecules per mole).

Calculation of the Distance Between Flanking fHbp Molecules on the Surface of MC58 Strains

Negative stain transmission electron microscopy images of MC58 WT allowed us to measure the 2D parameters length (l) and radius (r) of the bacterial cell and to calculate from those the total surface area (A). Assuming that bacteria can be considered as cylinders with hemispherical caps the area of an MC58 bacterial cell can be calculated by the equation A ≈ 2πrl + πr2 + πr2, resulting in a value of 4.98 μm², which is in agreement with previously published data of different diplococcal bacteria (18, 19). Because fHbp is homogeneously distributed on the bacterial surface (ref. 9 and Fig. S5), we subdivided A into squares of identical dimensions, necessary and sufficient to contain only two molecules of fHbp. Within each square, the two fHbp molecules can be placed on two adjacent square vertices or at the opposite diagonal apices. Distance values (d) were calculated by d =$\sqrt{2\left(\text{A}/\text{n}\right)}$ , where d corresponds to the square side of the grid, A represents the diplococcus area, and n is the total number of fHbp molecules.