Skip to main content
Chinese Medical Journal logoLink to Chinese Medical Journal
. 2015 Nov 20;128(22):3062–3068. doi: 10.4103/0366-6999.169093

Variants of Interleukin-7/Interleukin-7 Receptor Alpha are Associated with Both Neuromyelitis Optica and Multiple Sclerosis Among Chinese Han Population in Southeastern China

Jing-Cong Zhuang 1, Lei Wu 2, Mei-Zhen Qian 1, Ping-Ping Cai 1, Qi-Bing Liu 1, Gui-Xian Zhao 3, Zhen-Xin Li 3, Zhi-Ying Wu 1,2,✉
PMCID: PMC4795263  PMID: 26608987

Abstract

Background:

Neuromyelitis optica (NMO) and multiple sclerosis (MS) are autoimmune demyelinating diseases of the central nerve system. Interleukin-7 (IL-7) and interleukin-7 receptor alpha (IL-7Rα) were proved to be important in the pathogenesis of both diseases because of the roles they played in the differentiations of autoimmune lymphocytes. The variants of both genes had been identified to be associated with MS susceptibility in Caucasian, Japanese and Korean populations. However, the association of these variants with NMO and MS has not been well studied in Chinese Southeastern Han population. Here, we aimed to evaluate the association of six IL-7 variants (rs1520333, rs1545298, rs4739140, rs6993386, rs7816065, and rs2887502) and one variant of IL-7RA (rs6897932) with NMO and MS among Chinese Han population in southeastern China.

Methods:

Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MassARRAY system) and Sanger sequencing were used to determine the variants of IL-7 and IL-7RA in 167 NMO patients, 159 MS patients and 479 healthy controls among Chinese Han population in southeastern China. Samples were excluded if the genotyping success rate <90%.

Results:

Statistical differences were observed in the genotypes of IL-7 rs1520333 in MS patients and IL-7RA rs6897932 in NMO patients, compared with healthy controls (P = 0.035 and 0.034, respectively). There was a statistically significant difference in the genotypes of IL-7 rs2887502 between MS and NMO patients (P = 0.014). And there were statistically significant differences in the rs6897932 genotypes (P = 0.004) and alleles (P = 0.042) between NMO-IgG positive patients and healthy controls.

Conclusions:

The study suggested that among Chinese Han population in southeastern China, the variant of IL-7RA (rs6897932) was associated with NMO especially NMO-IgG positive patients while the variant of IL-7 (rs1520333) with MS patients. And the genotypic differences of IL-7 rs2887502 between MS and NMO indicated the different genetic backgrounds of these two diseases.

Keywords: Association, Interleukin-7/Interleukin-7 Receptor Alpha, Multiple Sclerosis, Neuromyelitis Optica, Chinese Han Population

INTRODUCTION

Neuromyelitis optica (NMO) and multiple sclerosis (MS) are autoimmune inflammatory demyelinating disorders of the central nervous system with unknown etiology, causing nontraumatic neurological disability in young adults.[1,2,3] NMO is thought to be a subtype of MS but not an independent disease until the discovery of the anti-aquaporin 4 (AQP4) antibody or NMO-IgG.[4,5,6] Although the exact etiologies of both diseases are still unclear, it is sure that the T-helper cells (Th), directly or indirectly, participate in the pathogenesis and progress of MS and NMO by secreting various cytokines.[2,7,8,9]

Over recent years, interleukin-7 (IL-7) had been widely considered to be a key cytokine controlling the differentiations and immune responses of several T-cells subsets.[10,11,12,13,14] It is suggested that the function of IL-7 was not only stimulating IL-7 receptor alpha (IL-7Rα) to promote the differentiation of Th1, but also involving in the survival and proliferation of pathogenic Th17 cells in experimental autoimmune encephalomyelitis (EAE) and MS patients.[15,16,17,18] The serum IL-7 can be seen as a potential marker monitoring the response to interferon-β in MS patients.[17]

The genetic variants of IL-7 and IL-7RA had been identified to be associated with the susceptibility of MS and NMO in Caucasian, Japanese and some other populations in several studies.[19,20,21,22,23,24] However, the results had not been replicated in Chinese Han population except our previous study on rs1520333 in IL-7 and rs6897932 in IL-7RA, in which no positive associations were observed.[25]

As the IL-7/IL-7R pathway might be a very attractive therapeutic target for inflammatory disorders, the genetic variants in this pathway were proposed to implicate in the pathogenesis of various autoimmune diseases.[14,18,26,27,28] Here, we enlarged the sample size to replicate the association of these 2 single nucleotide polymorphisms (SNPs) (rs1520333 in IL-7 and rs6897932 in IL-7RA) with MS and NMO. Meanwhile, we assayed 5 more SNPs of IL-7 (rs1545298, rs4739140, rs6993386, rs7816065, and 2887502) in the enlarged samples of MS, NMO, and healthy controls.

METHODS

Subjects

As described in our previous study,[25] 110 unrelated NMO patients and 304 healthy controls were included. In this study, we recruited 57 more NMO patients and 178 more healthy controls. In total, 167 NMO patients (26 males and 141 females) and 479 healthy controls (255 males and 224 females) among Chinese Han population in Southeastern China were included in this study. All the NMO patients were diagnosed according to the revised 2006 Wingerchuk criteria.[29] In addition, we recruited 159 MS patients (66 males and 93 females), and the diagnosis of which met the 2005 McDonald criteria for MS.[30] All participants signed an informed consent form. The study was approved by the Ethics Committee of Huashan Hospital.

Neuromyelitis optica-IgG antibody detection

NMO-IgG antibodies were detected with an indirect immunofluorescence assay using human embryonic kidney 293 cells transfected with recombinant human AQP4 gene (Euroimmun, Lubeck, Germany).[6] Each sample was measured at least twice, with the examiners unknowing the origin of the specimens. Samples with twice positive results were reported to be NMO-IgG positive.

Genotyping

Genomic DNA was extracted from peripheral blood samples using a QIAamp DNA Blood Minikit (QIAGEN, Hilden, Germany). Six variants in IL-7 (rs1520333, rs1545298, rs4739140, rs6993386, rs7816065, and 2887502) and one variant in IL-7RA (rs6897932) were genotyped using Sequenom MassARRAY system (Sequenom, San Diego, CA, USA) in previous 106 NMO patients and 304 healthy controls, according to the manufacturer's instructions at Fudan-Van Andel Research Institute Center, as we previously described.[31] For quality control, sample duplicates whose genotypes had been identified by sequencing were included in each 96-well plate. Genotyping was performed by technicians blinded to sample status. The average concordance rate between duplicate samples was >99%. Then, the additional samples including 57 NMO patients, 159 MS patients, and 178 healthy controls were genotyped by Sanger sequencing using an ABI 3730 Automated DNA Sequencer (Applied Biosystems, USA). Primers for all these variants are shown in Table 1.

Table 1.

Primer sequences for analysis of IL7 and IL7RA variants

Variants PCR primers MassEXTEND primers PCR primers for sanger sequencing
rs6993386 Forward: ACGTTGGATGTCAAAAGATGGCCATCTAAG GATGGCCATCTAAGTTTCTTT Forward: 5’-TGCCTAGCTGTGATTTGTTTC3’
Reverse: ACGTTGGATGCCCTATCAGAAGAATGGCTC Reverse: 5’-CAGTTATTAATTCATCGACCT3’
rs4739140 Forward: ACGTTGGATGCAGTTCTCTTCCTCAGTACC TCCTCAGTACCTCTTTAGT Forward: 5’-GAAGCAGGGACCTTTGTGGAA3’
Reverse: ACGTTGGATGACCACAGAAAAGTCTGAATG Reverse: 5’-ATTCTTCTCGATTTTCAGT3’
rs2887502 Forward: ACGTTGGATGTCTGACCATTGTTGCTCAGG AGGGTAGTTCAGTACTTC Forward: 5’-GTGTTGAGCATGAGGAGGGA3’
Reverse: ACGTTGGATGAGGAGAGAGACTAAGAGCAG Reverse: 5’-AGAGACAGAGGTTCTGGCTGA3’
rs1545298 Forward: ACGTTGGATGGGTAAAACTAGGCCATGAGG TTCCTGTGTGGCTTAA Forward: 5’-TCAAGTGGGAGGAAAGGGAAA3’
Reverse: ACGTTGGATGGATCAGGAATACTCACCTGC Reverse: 5’-GTTGAGAAATCCAAGATCAAG3’
rs7816065 Forward: ACGTTGGATGAGGCATAAAGGCACACTGAC GTTAGCTGTGTTTTAGCAAA Forward: 5’-GGTAGCTGAAACGTAGGCCTG3’
Reverse: ACGTTGGATGAAGTGTAGAGCAAGTCTGCC Reverse: 5’-CTAATGAAATCTGTCCAAAGG3’
rs1520333 Forward: ACGTTGGATGAGAGGTGGTATGGGTGTATC CAGCCCACTGGAACCAAAG Forward: 5’-TCAAAAAAGAAGTGCGTG3’
Reverse: ACGTTGGATGTGGGCAAGCAGGTAAGAAAG Reverse: 5’-GTGGTTGCTAAAAATGAAGTC3’
rs6897932 Forward: ACGTTGGATGCAGAGCGACAGAGAAAAAAC CAAAAAACTCAAAATGCTGATG Forward: 5’-CAAAGCACCCTGAGACCCTACC3’
Reverse: ACGTTGGATGACTGAATGCTCACCACAATC Reverse: 5’-CAGCGTTTGCCTAATGTCCAGT3’

PCR: Polymerase chain reaction.

Statistical analysis

Hardy–Weinberg equilibrium (HWE) was tested using the Chi-square test. The genotypes and allele frequencies were compared between cases and controls using the Chi-square test or Fisher's exact test. Continuous variables were shown as mean ± standard deviation (SD). A P < 0.05 was considered as statistically significant. All data were analyzed using SPSS 16.0 Software for Windows (SPSS Inc., Chicago, IL, USA).

RESULTS

After genotyping by Sequenom MassARRAY system, 4 NMO patients and 14 healthy controls were excluded for genotyping success rate <90%. Hence, there were 163 NMO patients, 159 MS patients, and 468 healthy controls analyzed. NMO-IgG antibody was tested in the 57 newly recruited NMO patients, and 13 (29.5%) were positive, added with previous 44 antibody positive NMO patients,[25] there were 57 NMO-IgG antibody positive patients in total. No antibody positive MS patient was found in this study.

The general data of participants are shown in Table 2. The sequencing chromatograms of the additional samples are shown in Figure 1. HWE test was performed as Table 3. Most of the SNPs in each group were under the HWE except IL-7 rs2887502 in MS (P = 0.033) and IL-7RA rs6897932 in healthy controls (P = 0.031). For the C/C genotype of IL-7 rs2887502 did not exist in MS patients and the frequency of C/C genotype was much higher in healthy control than that in the NMO-IgG positive NMO patients (70.30% vs. 61.40%), the departure from DHW of both polymorphisms in MS and healthy controls were possibly due to the protective role of C/C genotype according to a previous study.[32]

Table 2.

Characteristics of all Chinese Han participants in this study

Characteristics MS (n = 159) NMO (n = 163) Healthy controls (n = 468)
Male/female, n 66/93 24/139 248/220
Age (years), mean ± SD (range) 39.30 ± 13.69 (9–73) 43.42 ± 13.30 (13–77) 32.90 ± 13.64 (16–85)
Onset age (years), mean ± SD 31.82 ± 13.02 36.26 ± 13.72 NA
Duration of disease (years), mean ± SD 6.96 ± 5.90 6.89 ± 7.29 NA
AQP4-Ab positive, n (%) 0 (0) 57 (34.97) NA

MS: Multiple sclerosis; NMO: Neuromyelitis optica; AQP4-Ab: Antiaquaporin-4 antibodies; NA: Not applicable; SD: Standard deviation.

Figure 1.

Figure 1

The DNA sequence chromatograms of these seven variants. The upper and the bottom panels indicate the homozygous genotypes, whereas the heterozygous genotype is shown in the middle one.

Table 3.

Hardy–Weinberg equilibrium tests for all Chinese Han participants in this study

Variants MS (n = 159) NMO (n = 163) Healthy controls (n = 468)



n (expected numbers) χ2 P n (expected numbers) χ2 P n (expected numbers) χ2 P
IL7
 rs1520333 2.547 0.110 0.071 0.790 1.892 0.169
  GG 46 (50.94) 44 (44.85) 130 (122.56)
  GA 88 (78.11) 83 (81.30) 219 (233.87)
  AA 25 (29.94) 36 (36.85) 119 (111.56)
 rs1545298 0.006 0.937 0.122 0.727 0.784 0.376
  CC 10 (9.81) 11 (11.88) 32 (35.83)
  CT 59 (59.37) 66 (64.25) 195 (187.33)
  TT 90 (89.81) 86 (86.88) 241 (244.83)
 rs4739140 2.929 0.087 2.367 0.124 0.066 0.797
  AA 0 (2.27) 6 (3.53) 6 (6.58)
  AG 38 (33.46) 36 (40.93) 99 (97.84)
  GG 121 (123.27) 121 (118.53) 363 (363.58)
 rs6993386 3.089 0.079 0.077 0.782 0.143 0.705
  CC 15 (20.08) 22 (22.83) 70 (71.95)
  CT 83 (72.85) 78 (76.34) 227 (223.10)
  TT 61 (66.08) 63 (66.83) 171 (172.95)
 rs7816065 0.005 0.943 0.298 0.585 0.041 0.840
  CC 14 (14.19) 17 (18.56) 55 (54.02)
  CT 67 (66.62) 76 (72,88) 208 (209.96)
  TT 78 (78.19) 70 (71.56) 205 (204.02)
 rs2887502 4.548 0.033 3.522 0.061 0.174 0.677
  CC 0 (3.33) 8 (4.46) 11 (9.88)
  CT 46 (39.35) 39 (45.72) 114 (116.24)
  TT 113 (116.33) 116 (112.64) 343 (341.88)
IL7RA
 rs6897932 0.412 0.521 0.770 0.380 4.656 0.031
  CC 111 (112.09) 111 (109.34) 329 (335.08)
  CT 45 (42.82) 45 (48.32) 134 (121.85)
  TT 3 (4.09) 7 (5.34) 5 (11.08)

A P < 0.05 was considered statistically significant. MS: Multiple sclerosis; NMO: Neuromyelitis optica; IL7: Interleukin-7; IL7RA: Interleukin-7 receptor alpha.

As listed in Table 4, after enlarging the sample size for both previously studied SNPs, the frequency of the A/A genotype of rs1520333 in IL-7 gene of MS patients was observed dramatically lower than healthy controls, which reached the statistical difference (P = 0.035). However, the allelic comparisons did not show the statistical significance. Meanwhile, although statistical difference of the genotype was existed between total NMO and healthy controls in IL-7RA rs6897932 (P = 0.034), we also found no statistical difference in the allele frequencies (P > 0.05). When comparisons were made between NMO-IgG positive patients and MS patients or healthy control, we found that statistical significant differences of genotype and allele distributions were observed in IL-7RA rs6897932 (P = 0.004 and P = 0.042) between the NMO-IgG positive patients and healthy controls.

Table 4.

Allele and genotype distributions of IL7 and IL7R variants among MS, NMO and healthy controls, n (%)

Variants Genotype/allele Controls (n = 468) MS (n = 159) NMOT (n = 163) NMOP (n = 57) Chi-square or Fisher’s exact values

MS versus controls Total NMO NMO-IgG positive


NMOT versus controls MS versus NMOT NMOP versus controls MS versus NMOP
IL7
 rs1520333 GG 130 (27.78) 46 (28.93) 44 (27.00) 18 (31.58) χ2 = 6.695, P = 0.035 χ2 = 1.006, P = 0.605 χ2 = 2.125, P = 0.346 χ2 = 0.370, P = 0.831 χ2 = 2.973, P = 0.226
GA 219 (46.79) 88 (55.35) 83 (50.92) 25 (43.86)
AA 119 (25.43) 25 (15.72) 36 (22.09) 14 (24.56)
G 479 (51.18) 180 (56.60) 171 (52.45) 61 (53.51) χ2 = 2.805, P = 0.094 χ2 = 0.158, P = 0.691 χ2 = 1.118, P = 0.290 χ2 = 0.222, P = 0.638 χ2 = 0.222, P = 0.638
A 457 (48.82) 138 (43.40) 155 (47.55) 53 (46.49)
IL7RA
 rs6897932 CC 329 (70.30) 111 (69.81) 111 (68.10) 35 (61.40) χ2 = 0.632*, P = 0.729 χ2 = 6.745, P = 0.034 χ2 = 1.551*, P = 0.461 χ2 = 11.223*, P = 0.004 χ2 = 4.002*, P = 0.135
CT 134 (28.63) 45 (28.30) 45 (27.61) 18 (31.58)
TT 5 (1.07) 3 (1.89) 7 (4.29) 4 (7.02)
C 792 (84.62) 267 (83.96) 267 (81.90) 88 (77.19) χ2 = 0.077, P = 0.781 χ2 = 1.319, P = 0.251 χ2 = 0.483, P = 0.487 χ2 = 4.126, P = 0.042 χ2 = 2.625, P = 0.105
T 144 (15.38) 51 (16.04) 59 (18.10) 26 (22.81)

*The results of Fisher's exact test. P < 0.05 was considered statistically significant. MS: Multiple sclerosis; NMO: Neuromyelitis optica; NMOT: Total neuromyelitis optica patients; NMOP: Neuromyelitis optica-IgG positive patients; IL7: Interleukin-7; IL7RA: Interleukin-7 receptor alpha.

The results of five newly assayed IL-7 SNPs are listed in Table 5, along with the results of corresponding Chi-square test. The genotypes of IL-7 rs2887502 were significantly different between NMO and MS patients (P = 0.014). And no statistical difference was found among the other SNPs.

Table 5.

Allele and genotype distributions of 5 newly studied IL7 variants among MS, NMO and healthy controls, n (%)

Variants Genotype/allele Controls (n = 468) MS (n = 159) NMOT (n = 163) NMOP (n = 57) Chi-square or Fisher’s exact values

MS versus controls Total NMO NMO-IgG (+) NMO


NMOT versus controls MS versus NMOT NMOP versus controls MS versus NMOP
rs1545298 CC 32 (6.84) 10 (6.29) 11 (7.51) 2 (3.51) χ2 = 1.249, P = 0.536 χ2 = 0.079, P = 0.961 χ2 = 0.481, P = 0.786 χ2 = 1.061*, P = 0.588 χ2 = 1.605*, P = 0.448
CT 195 (41.67) 59 (37.11) 66 (39.31) 26 (45.61)
TT 241 (51.50) 90 (56.60) 86 (53.18) 29 (50.88)
C 259 (27.67) 79 (24.84) 88 (26.99) 30 (26.32) χ2 = 0.964, P = 0.326 χ2 = 0.056, P = 0.814 χ2 = 0.388, P = 0.533 χ2 = 0.095, P = 0.757 χ2 = 0.081, P = 0.775
T 677 (72.33) 239 (75.16) 238 (73.00) 84 (73.68)
rs4739140 CC 6 (1.28) 0 (0) 6 (3.68) 2 (3.51) χ2 = 2.481*, P = 0.289 χ2 = 3.882, P = 0.144 χ2 = 6.005*, P = 0.050 χ2 = 2.137*, P = 0.344 χ2 = 5.684*, P = 0.058
CT 99 (21.15) 38 (23.90) 36 (22.09) 14 (24.56)
TT 363 (77.56) 121 (76.10) 121 (74.23) 41 (71.93)
C 111 (11.86) 38 (11.95) 48 (14.72) 18 (15.79) χ2 = 0.002, P = 0.966 χ2 = 1.802, P = 0.179 χ2 = 1.071, P = 0.301 χ2 = 1.457, P = 0.227 χ2 = 1.097, P = 0.295
T 825 (88.14) 280 (88.05) 278 (85.28) 96 (84.21)
rs6993386 CC 70 (14.96) 15 (9.43) 22 (13.50) 5 (8.77) χ2 = 3.106, P = 0.212 χ2 = 0.333, P = 0.847 χ2 = 1.462, P = 0.481 χ2 = 3.169, P = 0.205 χ2 = 1.439, P = 0.487
CT 227 (48.50) 83 (52.21) 78 (47.85) 25 (43.86)
TT 171 (36.54) 61 (38.36) 63 (38.65) 27 (47.37)
C 367 (39.21) 113 (35.53) 122 (37.42) 35 (30.70) χ2 = 1.332, P = 0.249 χ2 = 0.111, P = 0.739 χ2 = 0.248, P = 0.619 χ2 = 3.113, P = 0.078 χ2 = 0.870, P = 0.351
T 569 (60.79) 205 (64.47) 204 (62.58) 79 (69.30)
rs7816065 CC 55 (11.75) 14 (8.81) 17 (10.43) 2 (3.51) χ2 = 1.806, P = 0.405 χ2 = 0.334, P = 0.846 χ2 = 1.240, P = 0.538 χ2 = 4.840*, P = 0.089 χ2 = 4.064*, P = 0.131
CT 208 (44.44) 67 (42.14) 76 (46.63) 32 (56.14)
TT 205 (43.80) 78 (49.06) 70 (42.94) 23 (40.35)
C 318 (33.97) 95 (29.87) 110 (33.74) 36 (31.58) χ2 = 1.807, P = 0.179 χ2 = 0.006, P = 0.939 χ2 = 1.110, P = 0.292 χ2 = 0.261, P = 0.609 χ2 = 0.115, P = 0.734
T 618 (66.03) 223 (70.13) 216 (66.26) 78 (68.42)
rs2887502 CC 11 (2.35) 0 (0) 8 (4.91) 2 (3.51) χ2 = 4.790*, P = 0.091 χ2 = 2.711, P = 0.258 χ2 = 8.567*, P = 0.014 χ2 = 0.422*, P = 0.810 χ2 = 5.685*, P = 0.058
CT 114 (24.36) 46 (28.93) 39 (23.93) 15 (26.32)
TT 343 (73.29) 113 (71.07) 116 (71.17) 40 (70.18)
C 136 (14.53) 46 (14.47) 55 (16.87) 19 (16.67) χ2 = 0.001, P = 0.977 χ2 = 1.032, P = 0.310 χ2 = 0.705, P = 0.401 χ2 = 0.369, P = 0.544 χ2 = 0.318, P = 0.573
T 800 (85.47) 272 (95.53) 271 (83.13) 95 (83.33)

*The results of Fisher's exact test. P < 0.05 was considered statistically significant. MS: Multiple sclerosis; NMO: Neuromyelitis optica; NMOT: Total neuromyelitis optica patients. NMOP: Neuromyelitis optica-IgG positive patients; IL7: Interleukin-7.

DISCUSSION

Autoimmune diseases are complex trait that develop from intricate and poorly understood interactions between an individual's genetics and the environmental exposures.[1] The genetics of NMO susceptibility largely remain unknown. In this study, we totally investigated the association of 6 variants in IL-7 and one variant in IL-7RA with Chinese NMO and MS patients, especially with the NMO-IgG positive patients. We observed that the genotype of rs6897932 in IL-7RA was statistically different between NMO patients and the healthy controls after including more NMO patients and healthy controls. While further comparing the NMO-IgG positive patients with healthy controls, we found that the C/C genotype and C allele significantly decreased in NMO-IgG positive NMO patients. In IL-7 gene, rs1520333 genotype reached the statistical significant difference between MS patients and healthy controls. The genotypes of IL-7 rs2887502 were observed statistically different between NMO and MS patients in our present study.

IL-7 belongs to a superfamily of gamma-chain cytokine receptor, and its gene, IL-7, is located on chromosome 8q12-13.[33,34] Functionally, IL-7 binds to IL-7Rα (also termed as CD127), which is encoded by the gene IL-7RA, plays an essential role in the T cell survival and proliferation in human and animal model.[11,14,35] A recent study revealed that the serum IL-7 reflected the MS patients’ responsiveness to interferon-β in Th1-dirven MS, because of the important role of IL-7 played in enhancing the Th1 proliferation. In turn, treatment of IL-7/IL-7Rα blockade seemed benefit to EAE, a murine model of MS.[17]

Numbers of previous studies pointed out the IL-7/IL-7RA variants were associated with the morbidity of NMO and MS in different populations and regions of the world.[19,20,21,22,23,24] The rs6997932 was proved to be a causative variant that affected the expression of IL-7RA.[19] Studies on different populations reached a consensus that this SNP was strongly associated with MS, moreover, it was also associated with NMO in the studies performed in Japanese and Korean populations.[22,23,24,36] Some studies revealed that rs6993386, rs1520333, and rs7816065 of IL-7 were associated with MS in Caucasian populations, while rs1545298, rs4739140, and rs2887502 did not relate to this disease.[20,22,36]

Previously, we performed a partial replication of the referred studies by assayed rs1520333 of IL-7 and rs6897932 of IL-7RA, however, we did not find any positive association of both SNPs with NMO.[25] In consideration of the different genetic background among populations, we enlarged the sample size and investigated the associations of more SNPs with not only NMO patients, but also MS patients in the current study. Interestingly, statistical significant differences were observed in the genotypes of IL-7RA rs6897932 between the cohorts of total NMO patients and healthy controls. While further comparing the NMO-IgG positive patients with healthy controls, significant differences existed in both distributions of genotypes and alleles in IL-7RA rs6897932. This result was coherent with the results of studies in Japanese and Korean populations,[23,24] confirming that IL-7RA rs6897932 might be a risky factor of NMO in Asians. However, we did not observe the association of IL-7RA rs6897932 with the pathogenesis of MS, which indicated the different genetic background among the East Asians. In the comparisons between the MS patients and healthy controls, the genotypes of IL-7 rs1520333 reached the statistical significant difference, which was first reported in Asian. The significant difference of IL-7 rs2887502 genotypes between NMO and MS patients was also firstly reported, which indicated the different genetic backgrounds of both diseases.

Although our study reported a potential association between IL-7/IL-7RA polymorphisms and MS/NMO, some limitations were present and should be addressed in the future. First, the sample size should be further enlarged in further study. Second, there was a disparity in the gender ratio, since the incidences of both diseases are higher in female than male. Lastly, functional studies of the IL-7 would be required to understand the actual effect of the IL-7/IL-7R complex in MS and NMO pathogenesis.

In conclusion, the current study replicated some positive-associated SNPs, which were observed in other populations, in Chinese NMO and MS patients. Meanwhile, we investigated the associations of 5 more SNPs of IL-7 with NMO and MS that were not investigated in Asian previously. To our best knowledge, this study may provide a deeper understanding of the role of IL-7/IL-7R pathway playing in the pathogenesis of NMO and MS within different populations, which hints a new insight to the personal therapy for both diseases in the future. And this study suggested that it might be necessary to monitor the serum IL-7 of NMO-IgG positive patients during the treatment.

Financial support and sponsorship

This work was supported by grants from National Key Clinical Specialty Discipline Construction Program and Key Clinical Specialty Discipline Construction Program of Fujian and the National Natural Science Foundation of China (No. 81125009 and No. 3091110488).

Conflicts of interest

There are no conflicts of interest.

Acknowledgments

The authors sincerely thank the patients and their parents for the help and willingness to take part in this study.

Footnotes

Edited by: Xin Chen

REFERENCES

  • 1.Cooper GS, Stroehla BC. The epidemiology of autoimmune diseases. Autoimmun Rev. 2003;2:119–25. doi: 10.1016/s1568-9972(03)00006-5. [DOI] [PubMed] [Google Scholar]
  • 2.Compston A, Coles A. Multiple sclerosis. Lancet. 2008;372:1502–17. doi: 10.1016/S0140-6736(08)61620-7. [DOI] [PubMed] [Google Scholar]
  • 3.Morrow MJ, Wingerchuk D. Neuromyelitis optica. J Neuroophthalmol. 2012;32:154–66. doi: 10.1097/WNO.0b013e31825662f1. [DOI] [PubMed] [Google Scholar]
  • 4.Lennon VA, Wingerchuk DM, Kryzer TJ, Pittock SJ, Lucchinetti CF, Fujihara K, et al. A serum autoantibody marker of neuromyelitis optica: Distinction from multiple sclerosis. Lancet. 2004;364:2106–12. doi: 10.1016/S0140-6736(04)17551-X. [DOI] [PubMed] [Google Scholar]
  • 5.Jarius S, Paul F, Franciotta D, Aktas O, Hohlfeld R, Zipp F, et al. Revised diagnostic criteria for neuromyelitis optica – Incorporation of NMO-IgG status. Nat Clin Pract Neurol. 2007;3:E1. doi: 10.1038/ncpneuro0501. [DOI] [PubMed] [Google Scholar]
  • 6.Matsuoka T, Matsushita T, Kawano Y, Osoegawa M, Ochi H, Ishizu T, et al. Heterogeneity of aquaporin-4 autoimmunity and spinal cord lesions in multiple sclerosis in Japanese. Brain. 2007;130(Pt 5):1206–23. doi: 10.1093/brain/awm027. [DOI] [PubMed] [Google Scholar]
  • 7.Kalluri SR, Rothhammer V, Staszewski O, Srivastava R, Petermann F, Prinz M, et al. Functional characterization of aquaporin-4 specific T cells: Towards a model for neuromyelitis optica. PLoS One. 2011;6:e16083. doi: 10.1371/journal.pone.0016083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Lovett-Racke AE, Yang Y, Racke MK. Th1 versus Th17: Are T cell cytokines relevant in multiple sclerosis? Biochim Biophys Acta. 2011;1812:246–51. doi: 10.1016/j.bbadis.2010.05.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Uzawa A, Mori M, Kuwabara S. Cytokines and chemokines in neuromyelitis optica: Pathogenetic and therapeutic implications. Brain Pathol. 2014;24:67–73. doi: 10.1111/bpa.12097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chou YK, Bourdette DN, Barnes D, Finn TP, Murray S, Unsicker L, et al. IL-7 enhances Ag-specific human T cell response by increasing expression of IL-2R alpha and gamma chains. J Neuroimmunol. 1999;96:101–11. doi: 10.1016/s0165-5728(99)00002-8. [DOI] [PubMed] [Google Scholar]
  • 11.Schluns KS, Kieper WC, Jameson SC, Lefrançois L. Interleukin-7 mediates the homeostasis of naïve and memory CD8 T cells in vivo. Nat Immunol. 2000;1:426–32. doi: 10.1038/80868. [DOI] [PubMed] [Google Scholar]
  • 12.Ma A, Koka R, Burkett P. Diverse functions of IL-2, IL-15, and IL-7 in lymphoid homeostasis. Annu Rev Immunol. 2006;24:657–79. doi: 10.1146/annurev.immunol.24.021605.090727. [DOI] [PubMed] [Google Scholar]
  • 13.Sawa Y, Arima Y, Ogura H, Kitabayashi C, Jiang JJ, Fukushima T, et al. Hepatic interleukin-7 expression regulates T cell responses. Immunity. 2009;30:447–57. doi: 10.1016/j.immuni.2009.01.007. [DOI] [PubMed] [Google Scholar]
  • 14.Liu X, Leung S, Wang C, Tan Z, Wang J, Guo TB, et al. Crucial role of interleukin-7 in T helper type 17 survival and expansion in autoimmune disease. Nat Med. 2010;16:191–7. doi: 10.1038/nm.2077. [DOI] [PubMed] [Google Scholar]
  • 15.Bebo BF, Jr, Schuster JC, Adlard K, Vandenbark AA, Offner H. Interleukin 7 is a potent co-stimulator of myelin specific T cells that enhances the adoptive transfer of experimental autoimmune encephalomyelitis. Cytokine. 2000;12:324–31. doi: 10.1006/cyto.1999.0564. [DOI] [PubMed] [Google Scholar]
  • 16.Traggiai E, Biagioli T, Rosati E, Ballerini C, Mazzanti B, Ben Nun A, et al. IL-7-enhanced T-cell response to myelin proteins in multiple sclerosis. J Neuroimmunol. 2001;121:111–9. doi: 10.1016/s0165-5728(01)00433-7. [DOI] [PubMed] [Google Scholar]
  • 17.Lee LF, Axtell R, Tu GH, Logronio K, Dilley J, Yu J, et al. IL-7 promotes T (H) 1 development and serum IL-7 predicts clinical response to interferon-ß in multiple sclerosis. Sci Transl Med. 2011;3:93ra68. doi: 10.1126/scitranslmed.3002400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kreft KL, Verbraak E, Wierenga-Wolf AF, van Meurs M, Oostra BA, Laman JD, et al. The IL-7Ra pathway is quantitatively and functionally altered in CD8 T cells in multiple sclerosis. J Immunol. 2012;188:1874–83. doi: 10.4049/jimmunol.1102559. [DOI] [PubMed] [Google Scholar]
  • 19.Gregory SG, Schmidt S, Seth P, Oksenberg JR, Hart J, Prokop A, et al. Interleukin 7 receptor alpha chain (IL7R) shows allelic and functional association with multiple sclerosis. Nat Genet. 2007;39:1083–91. doi: 10.1038/ng2103. [DOI] [PubMed] [Google Scholar]
  • 20.Sawcer S, Hellenthal G, Pirinen M, Spencer CC, et al. International Multiple Sclerosis Genetics Consortium, Wellcome Trust Case Control Consortium. Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. Nature. 2011;476:214–9. doi: 10.1038/nature10251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lundmark F, Duvefelt K, Iacobaeus E, Kockum I, Wallström E, Khademi M, et al. Variation in interleukin 7 receptor alpha chain (IL7R) influences risk of multiple sclerosis. Nat Genet. 2007;39:1108–13. doi: 10.1038/ng2106. [DOI] [PubMed] [Google Scholar]
  • 22.Zuvich RL, McCauley JL, Oksenberg JR, Sawcer SJ, De Jager PL. International Multiple Sclerosis Genetics Consortium. Genetic variation in the IL7RA/IL7 pathway increases multiple sclerosis susceptibility. Hum Genet. 2010;127:525–35. doi: 10.1007/s00439-010-0789-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fang L, Isobe N, Yoshimura S, Yonekawa T, Matsushita T, Masaki K, et al. Interleukin-7 receptor alpha gene polymorphism influences multiple sclerosis risk in Asians. Neurology. 2011;76:2125–7. doi: 10.1212/WNL.0b013e31821f466c. [DOI] [PubMed] [Google Scholar]
  • 24.Kim JY, Cheong HS, Kim HJ, Kim LH, Namgoong S, Shin HD. Association analysis of IL7R polymorphisms with inflammatory demyelinating diseases. Mol Med Rep. 2014;9:737–43. doi: 10.3892/mmr.2013.1863. [DOI] [PubMed] [Google Scholar]
  • 25.Liu QB, Li ZX, Zhao GX, Yu H, Wu ZY. No association between identified multiple sclerosis non-MHC risk loci and neuromyelitis optica. Neurosci Bull. 2014;30:1036–44. doi: 10.1007/s12264-013-1457-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.van Roon JA, Glaudemans KA, Bijlsma JW, Lafeber FP. Interleukin 7 stimulates tumour necrosis factor alpha and Th1 cytokine production in joints of patients with rheumatoid arthritis. Ann Rheum Dis. 2003;62:113–9. doi: 10.1136/ard.62.2.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sawa S, Kamimura D, Jin GH, Morikawa H, Kamon H, Nishihara M, et al. Autoimmune arthritis associated with mutated interleukin (IL)-6 receptor gp130 is driven by STAT3/IL-7-dependent homeostatic proliferation of CD4+ T cells. J Exp Med. 2006;203:1459–70. doi: 10.1084/jem.20052187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Sun LY, Zhang HY, Feng XB, Hou YY, Lu LW, Fan LM. Abnormality of bone marrow-derived mesenchymal stem cells in patients with systemic lupus erythematosus. Lupus. 2007;16:121–8. doi: 10.1177/0961203306075793. [DOI] [PubMed] [Google Scholar]
  • 29.Wingerchuk DM, Lennon VA, Pittock SJ, Lucchinetti CF, Weinshenker BG. Revised diagnostic criteria for neuromyelitis optica. Neurology. 2006;66:1485–9. doi: 10.1212/01.wnl.0000216139.44259.74. [DOI] [PubMed] [Google Scholar]
  • 30.Polman CH, Reingold SC, Edan G, Filippi M, Hartung HP, Kappos L, et al. Diagnostic criteria for multiple sclerosis: 2005 revisions to the “McDonald Criteria”. Ann Neurol. 2005;58:840–6. doi: 10.1002/ana.20703. [DOI] [PubMed] [Google Scholar]
  • 31.Zhuang JC, Huang ZY, Zhao GX, Yu H, Li ZX, Wu ZY. Variants of CYP27B1 are associated with both multiple sclerosis and neuromyelitis optica patients in Han Chinese population. Gene. 2015;557:236–9. doi: 10.1016/j.gene.2014.12.045. [DOI] [PubMed] [Google Scholar]
  • 32.Wittke-Thompson JK, Pluzhnikov A, Cox NJ. Rational inferences about departures from Hardy-Weinberg equilibrium. Am J Hum Genet. 2005;76:967–86. doi: 10.1086/430507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Leonard WJ, Shores EW, Love PE. Role of the common cytokine receptor gamma chain in cytokine signaling and lymphoid development. Immunol Rev. 1995;148:97–114. doi: 10.1111/j.1600-065x.1995.tb00095.x. [DOI] [PubMed] [Google Scholar]
  • 34.Fry TJ, Mackall CL. Interleukin-7: From bench to clinic. Blood. 2002;99:3892–904. doi: 10.1182/blood.v99.11.3892. [DOI] [PubMed] [Google Scholar]
  • 35.Palmer MJ, Mahajan VS, Trajman LC, Irvine DJ, Lauffenburger DA, Chen J. Interleukin-7 receptor signaling network: An integrated systems perspective. Cell Mol Immunol. 2008;5:79–89. doi: 10.1038/cmi.2008.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Goldstein BA, Hubbard AE, Cutler A, Barcellos LF. An application of Random Forests to a genome-wide association dataset: Methodological considerations and new findings. BMC Genet. 2010;11:49. doi: 10.1186/1471-2156-11-49. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Chinese Medical Journal are provided here courtesy of Wolters Kluwer Health

RESOURCES