Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Mar 21.
Published in final edited form as: Brain Res. 2016 Jan 25;1635:169–179. doi: 10.1016/j.brainres.2016.01.028

Effects of an amyloid-beta 1-42 oligomers antibody screened from a phage display library in APP/PS1 transgenic mice

Jianping Wang a,*,1, Nan Li a,b,1, Jun Ma c, Zhiqiang Gu d, Lie Yu a, Xiaojie Fu a, Xi Liu e, Jian Wang f,**
PMCID: PMC4801032  NIHMSID: NIHMS768261  PMID: 26820640

Abstract

We screened anti-Aβ1-42 antibodies from a human Alzheimer’s disease (AD) specific single chain variable fragment (scFv) phage display library and assessed their effects in APP/PS1 transgenic mice. Reverse transcription-PCR was used to construct the scFv phage display library, and screening identified 11A5 as an anti-Aβ1-42 antibody. We mixed 11A5 and the monoclonal antibody 6E10 with Aβ1-42 and administered the mixture to Sprague-Dawley rats via intracerebroventricular injection. After 30 days, rats injected with the antibody/ Aβ1-42 mixture and those injected with Aβ1-42 alone were tested on the Morris water maze. We also injected 11A5 and 6E10 into APP/PS1 transgenic mice and assessed the concentrations of Aβ in brain and peripheral blood by ELISA at 1-month intervals for 3 months. Finally we evaluated behavior changes in the Morris water maze. Rats injected with Aβ1-42 and mixed antibodies showed better performance in the Morris water maze than did rats injected with Aβ1-42 alone. In APP/PS1 transgenic mice, Aβ concentration was lower in the brains of the antibody-treated group than in the control group, but higher in the peripheral blood. The antibody-treated mice also exhibited improved behavioral performance in the Morris water maze. In conclusion, anti-Aβ1-42 antibodies (11A5) screened from the human scFv antibody phage display library promoted the efflux or clearance of Aβ1-42 and effectively decreased the cerebral Aβ burden in an AD mouse model.

Keywords: Alzheimer's disease, Phage display library, Anti-Aβ antibodies, APP/PS1, transgenic mice

1. Introduction

Alzheimer's disease (AD), a neurodegenerative disease, is characterized by memory and cognition impairment. Amyloid-β peptide (Aβ) deposition triggers a series of extracellular events and processing changes that eventually lead to dementia, a key component in the pathogenesis of AD (Hardy and Selkoe, 2002). Therefore, inhibiting the production of Aβ is considered a potential therapeutic strategy in treating AD. As an extracellular protein, Aβ deposits aggregate in the associative cortices and limbic system. Aβ is derived from the β-amyloid precursor protein (β-APP), which is a larger transmembrane protein (Buss et al., 2012). Aβ is generated when APP interacts with the APP cleavage enzyme β-secretase (BACE1) in the endoplasmic reticulum, Golgi, cell surface and/or endocytic compartments, where BACE1 cleaves the N-terminal domain of APP (Birmingham and Frantz, 2002; Haass and Selkoe, 2007; Hock et al., 2003; Schenk, 2002; Selkoe, 2006). The abridged protein fragment (C99) contains the transmembrane domain, which interacts with γ-secretase (including presenilin-1, PS1) to release Aβ from the membrane (Selkoe, 2006).

Recent AD studies have focused on soluble Aβ (Haass and Selkoe, 2007). Schenk first used synthetic Aβ 42 to immunize the platelet-derived growth factor B promoter driving human amyloid precursor protein V717F (PDAPP) transgenic mice, determining that Aβ 42 reduced the extent and progression of AD pathology (Schenk, 2002). Since then, significant progress has been made in designing an appropriate human vaccine using active Aβ immunotherapy. However, in a phase II clinical trial, approximately 6% of patients suffered from meningoencephalitis, which led to a discontinuation of the application of Aβ (Birmingham and Frantz, 2002; Hock et al., 2003; Marks et al., 1992). Thus, a human-origin antibody against Aβ would be more promising for AD research and clinical therapy.

Phage display library technology (Petrenko and Vodyanoy, 2003; Szardenings, 2003; Willats, 2002) is a relatively simple and quick method of constructing effectively designed synthetic antibody libraries and obtaining considerable amounts of humanized antibodies(Keller et al., 2015).

Our study utilized a human single chain variable fragment (scFv) phage antibody library to isolate a single-chain antibody that specifically recognized Aβ1-42 oligomers. Such antibodies may prevent or reverse the deposition of Aβ in central nervous system; subsequently reducing associated behavioral deficits in AD mouse models.

2. Results

2.1. Screening of single-chain fragment variable antibodies

The total RNA was isolated from the lymphocytes and cDNA was prepared. The VH and VL bands amplified by RT-PCR were approximately 360 bp and 340 bp, respectively (Fig. 1A and B). The VH and VL DNA sequences were made continuously into an scFv using a pair of linker DNA sequences and special primers (all of the primer sequences were designed from Gene Bank). The scFv band was approximately 750 bp (Fig. 1C). The scFv fragment was inserted into the pCAN-TAB5E vector and amplified. The product was electroporated into E. coli TG1 and rescued by the M13K07 helper phage. Random colonies were selected from an SOBAG agar plate and plasmid DNA was separated (Fig. 1D).

Fig. 1.

Fig. 1

Open in a new tab

Agarose gel electrophoresis showing PCR amplification of human antibody heavy chains (A, 360 bp), light chains (B, 340 bp) and scFv fragments (C, 750 bp). Recombinant clones of scFv fragments were amplified from the library and identified by PCR (D, 750 bp).

Recombinant phages specific for Aβ1-42 oligomers were enriched after 4 rounds of bio-panning and the antigen-positive clones were selected from the enriched clones by phage ELISA. The phage ELISA showed an increased trend in the every round of panning (Fig. 2). In the first round, the total output phage was 1.24 × 104. The phage-containing supernatant was then amplified by infecting competent bacteria, titering, and pooling for the next round of screening. Subsequently, an enrichment of approximately 6.23 × 107 fold was reached.

Fig. 2.

Fig. 2

Open in a new tab

Bio-panning of the antigen-positive clones by ELISA. After the fourth round of bio-panning, antibodies were assessed by ELISA against Aβ1-42 oligomers. Clones were considered positive according to the following criteria: absorbance A450 nm >0.5, and an A450 nm (positive control) to A450 (negative control) ratio >3.

2.2. Positive clones are enriched after four rounds of panning

After the final round of bio-panning, we choose the highest activity antibody of the positive clones-11A5 to display specific binding to Aβ1-42 oligomers. The CDR regions in VH and VL amino acids were determined by using KABAT and Chothia numbering (Fig. 3 A–C). Western blotting was used to demonstrate the specific binding of antibodies to Aβ1-42 oligomers. 11A5 could specifically bind to Aβ1-42 oligomers and displayed a molecular weight of approximately 34 kD (Aβ1-42 tetramer) (Fig. 4).

Fig. 3.

Fig. 3

Open in a new tab

DNA sequences analysis. A and B: VH and VL chains' sequencing. C and D: DNA sequences (C: heavy chains D: light chains;) analysis for anti-Aβ1-42 antibodies (11A5). The CDRs for both the chains were obtained using KABAT numbering and the CDR sequences were shown in yellow highlight and the others were FR sequences that were shown in blue highlight.

Fig. 4.

Fig. 4

Open in a new tab

Western blot analysis of single-chain antibody 11A5 binding to Aβ1-42 oligomers. M: marker; A: 11A5 specific blinding to Aβ1-42 oligomers. B: BSA (a bland control).

2.3. Anti-Aβ1-42 antibodies could neutralize Aβ1-42 peptide in vivo

We used the Morris water maze to assess behavioral changes of SD rats after 30 days. The escape latency (the time needed to reach the hidden platform) was compared among the groups. The results demonstrated that the time required was much shorter for the Aβ1-42 antibody treatment groups than for the Aβ1-42 group (Fig. 5A, P<0.01). The results of the spatial probe test revealed that the Aβ1-42 antibody treatment groups spent much more time in the target quadrant than the Aβ1-42 group (Fig. 5B, P<0.01). Aβ1-42 antibody treatment led to a significant increase of the number of times in platform location compared to Aβ1-42 group (Fig. 5C, P<0.01). However, no significant differences were observed between the groups receiving Aβ1-42 mixed with 11A5 or Aβ1-42 mixed with 6E10 and the sham group (P>0.05). It was seemed the rats of Aβ1-42 mixed with antibodies groups showed mild reduction in learning and memory at day 30 after treatments compared with sham group. This suggests that anti-Aβ1-42 antibodies (11A5, 6E10) could combine with and deactivate the Aβ1-42 peptide, thereby decreasing its neurotoxic effects on SD rats.

Fig. 5.

Fig. 5

Open in a new tab

Changes of behavior after Aβ1-42, Aβ1-42 mixed with antibodies injections on SD rats were evaluated by Morris water maze. Aβ1-42: injection with only Aβ1-42; Aβ1-42+11A5: injection with Aβ1-42 and 11A5; Aβ1-42+6E10: injection with Aβ1-42 and 6E10; Sham: injection with normal saline. A: escape latency (Latency to find the platform in the Morris Water Maze test): rats receiving Aβ1-42 exhibited the worst performance than the other three groups. Rats receiving Aβ1-42 mixed with antibodies showed decreased the latency to find the platform (improved learning) compared with the Aβ1-42 group. * P<0.01 vs. the Aβ1-42 group. B: spatial probe test (Quantification of time spent in the target zone during the probe test): rats receiving Aβ1-42 spent less time in the correct quadrant than the other three groups. Rats receiving Aβ1-42 mixed with antibodies spent much longer time in the target zone than did the Aβ1-42 group. * P<0.01 vs. the Aβ1-42 group C: the number of times the platform: Aβ1-42 groups had the lest crossings of the annulus than the other three groups. * P<0.01 vs. the Aβ1-42 group. Aβ1-42 mixed with antibodies groups showed slight difference with sham group. n = 5/group.

2.4. Behavioral tests of APP/PS1 transgenic mice

The PCR results identifying double transgenic mice are shown in Fig. 6A and B. Double positive gene expression mice were chosen for this study. In the Morris water maze test, the escape latency and spatial probe test were compared among the groups at 1-month intervals for 3 months. The escape latency results demonstrated that the time spent by the antibody treatment groups was much shorter than the time spent by the control group (Fig. 7A–C, P<0.01). The spatial probe test data revealed that the antibody treatment groups spent much longer times in the target sector than the control group (Fig. 7D, P<0.01. Fig. 7E and F, P<0.05). The antibody treatment groups also located the platform significantly more often than the control group (Fig. 7G–I, P<0.05). However, the data showed no significant differences between the 11A5 and 6E10 treatment groups (P>0.05). Therefore, the results indicated a significant improvement in abilities of learning and memory after 11A5 and 6E10 injections.

Fig. 6.

Fig. 6

Open in a new tab

PCR-genotyping to identify APP/PS1 transgenic mice from DNA acquired via tail biopsies. M: Marker; +: Positive control;-: Negative control; APP: 344 bp, PS1: 600 bp.

Fig. 7.

Fig. 7

Open in a new tab

Results of the Morris water maze test of APP/PS1 transgenic mice. A, B, and C: escape latencies (Latency to find the platform in the Morris Water Maze tests) at 1, 2, and 3 months, respectively; 11A5 and 6E10 treatment groups showed decreased the latencies to find the platform (improved learning) compared with control group. * P<0.01 vs. control group. D, E, and F: spatial probe tests (Quantification of time spent in the target zone during the probe tests) at 1, 2, and 3 months, respectively. 11A5 and 6E10 treatment groups spent much longer time in the target quadrant than the control group. * P<0.01 vs. control group at 1-month. #: P<0.05 vs. control group at 2, 3-month. G, H, and I: the number of times the platform was located at 1, 2, and 3 months, respectively. 11A5 and 6E10 treatment groups had much more crossings of the annulus than control groups. #: P<0.05 vs. control group.11A5 group showed little difference with 6E10 group. n = 5/group/time point.

2.5. Detection the Aβ concentrations in brain and peripheral blood

The concentrations of Aβ were tested by ELISA (Fig. 8A and B). The concentrations of Aβ in brains were lower while the level in peripheral blood were higher in the treatment groups than control group and Aβ concentrations were lowest in brains but highest in peripheral blood at the first month in the treatment groups (P<0.01), which indicated that 11A5 could combine with Aβ and might initiate Aβ efflux or clearance from the brain to the peripheral blood and the effects was strongest at the first month.

Fig. 8.

Fig. 8

Open in a new tab

ELISA results showing concentrations of Aβ in brains and peripheral blood. A: Aβ concentrations were lower in brains in the treatment groups compared with the control group. *: P<0.01 vs. control group. B: The concentrations of Aβ were higher in peripheral blood in the treatment groups compared with the control group. *: P<0.01 vs. control group at 1-month; #: P<0.05 vs. control group at the others two months. There was no significant difference between 11A5 and 6E10 group. n = 5/ group/time point.

3. Discussion

In our study, we successfully screened anti-Aβ1-42 oligomers antibodies (11A5) from a human scFv antibodies phage display library that we designed and confirmed the ability of 11A5 to combine with Aβ and make it deactivate in vitro through the tests of Aβ1-42+antibodies mixtures intracereb-roventricular injections on SD rats. We also confirmed 11A5 might initiate Aβ efflux or clearance from the brain through the tests of antibodies treatments on APP/PS1 transgenic mice. Furthermore, anti-Aβ1-42 antibodies (11A5) therapy was effective in improving behavioral abilities of APP/PS1 transgenic mice. Following treatment, anti-Aβ1-42 antibody (11A5) was proved to combine with Aβ and enhance the efflux or clearance of Aβ from the brain. To the best of our knowledge, this study is more clearly and deeply to explore the therapeutic effects of humanized anti-Aβ1-42 oligomers antibodies in AD mouse models.

Over the past twenty years, monoclonal antibodies have become an important class of pharmaceutical biotechnology products and research tools in chemistry and the life sciences (Sliwkowski and Mellman, 2013). The advent and development of phage display library technologies enabled efficient isolation of fully human antibodies from large combinatorial repertoires (Smith, 1985; Winter et al., 1994).

In our study, we constructed a human scFv antibody phage display library and obtained a single-chain antibody that specifically recognized Aβ1-42 oligomers. The scFv library was constructed using the peripheral blood of 20 AD patients, which improved the variety, library productivity, and screening rate of positive clones. 11A5 is a conformation-dependent human monoclonal antibody that it can be obtained under more simple and economic condition. We have demonstrated it has strong biological activities similar as the commercial antibody 6E10. The monoclonal antibody 6E10 is the mouse parent antibody, and many disadvantages of these antibodies have been highlighted: on the one hand, they cannot effectively activate system of complements and Fc receptors in the human body. On the other hand, they can be identified by the body's immune system to develop the human antigen mouse antibodies. Furthermore, they will be removed in the human body. 11A5 is a human monoclonal antibody that can be obtained under more simple and economic condition (in our lab). We have demonstrated that it has strong biological activities similar with the commercial antibody 6E10. As a humanized antibody, 11A5 may reduce the severity of immune responses in human, which is presenting superior to 6E10. Thereby presenting a possible application as a therapy in clinical research.

Aβ has an important role in AD pathology, as its extracellular deposits constitute senile plaques that induce the most common pathologic changes (Allsop et al., 1983; Glenner and Wong, 2012). The Aβ1-42 oligomers might have higher antigenicity than other Aβ1-42 forms, as been previously reported (Yuan et al., 2013). Many studies are committed to developing synthetic antibodies against Aβ oligomers to prevent neuron degradation or apoptosis; the efforts are ultimately aimed at improving central nervous system regeneration and prevent lasting memory loss (Klyubin et al., 2005; Zameer et al., 2008). The first anti- Aβ immunotherapy approach for AD, which was introduced by Schenk in 1999. Despite some disappointments, the researches of anti-Aβ immunotherapy are never stopped. Several more effective active or passive Aβ-based vaccines have been developed. Including the usage of IVIg that contain naturally occurring anti-Aβ antibodies. (Relkin et al., 2009; Weksler et al., 2009) Recent studies focus on using conformation-specific antibodies 49 which can recognize soluble oligomers from different amyloids, including islet amyloid polypeptide (IAPP), lysozyme, synuclein, polyglutamine, prion protein, and insulin. These anti oligomer antibodies that bind to amyloid oligomers (Kayed et al., 2003) specifically when injected intrathecally into the TgCRND8 AD mouse model (Chauhan, 2007).

Because specific antibodies against Aβ constructs are present higher levels in the plasma and serum from AD patients than healthy elderly people (Silacci et al., 2005), we developed a phage library from the lymphocytes of AD patients to screen for human anti-Aβ antibodies. We made preparation for Aβ1-42 oligomers for antibody selection and obtained specific antibodies.

In our study, we made intracerebroventricular injection on SD rats Aβ1-42 or Aβ1-42 mixed with antibodies, the changes of behavior of Aβ1-42 mixed with antibodies groups were no statistical differences compared with sham group (only injection of normal saline), but the changes were significant differences compared with Aβ1-42 group, which demonstrated anti-Aβ antibodies (11A5) could combine with and deactivate Aβ1-42. In APP/PS1 transgenic mice tests, we intraperitoneal injected either anti-Aβ antibodies (11A5) or commercialized antibodies (6E10) into APP/PS1 mice at 4 months of age. The injections were repeated every two weeks. We had observed a series of decrements of Aβ levels in brain and increments of Aβ levels peripheral in blood during 3 months, which demonstrated that the anti-Aβ antibodies could reduce Aβ levels by efflux or clearance from brain.

The neurodegenerative process of AD begins with axonal and synaptic damage and is accompanied by the gradual aggregation of toxic Aβ in the intracellular and extracellular space. Aβ aggregation is the consequence of an altered balance between protein synthesis, accumulation rate, and clearance. Two major mechanisms for the antibody-mediated clearance of Aβ have been suggested, including the sequestration of Aβ from the central nervous system into the periphery (“peripheral sink”) (Bard et al., 2000) and the entry of anti-Aβ antibodies into the central nervous system and clearance of antigen-antibody complexes. That is to say, once the anti-Aβ antibodies are supplied via intraperitoneal injection into the APP/PS1 mice, a rapid increase in the plasma Aβ levels will be observed (DeMattos et al., 2001). The circulating anti-Aβ antibodies bind to plasma Aβ, reducing the circulating Aβ levels. This reduction initiates the migration of Aβ from the brain by mass action transfer across the blood brain barrier to the vasculature, which is consequently termed the peripheral sink. In addition, with the equilibrium of Aβ between the brain and blood has been broken, the entry of anti-Aβ antibodies into the central nervous system has been speeded (Lafaye et al., 2009). In our study, we observed decreases concentrations of Aβ in brain and corresponding increases concentrations of Aβ in peripheral blood after treatment with the anti-Aβ antibodies. It indicated that 11A5 could reduce the Aβ load by promoting the efflux or clearance of Aβ from the brain to peripheral blood. The effects of anti-Aβ antibody combined with Aβ might initiate it. The deposition of Aβ fragments in senile plaques leads to neurodegeneration and neuronal death, and though the present study focused on anti-Aβ therapy as a means to reduce Aβ deposition in the brain, it is unlikely that only Aβ alone brought about the total decline in cognitive abilities in the AD model mice. Indeed, the Morris water maze test revealed that cognitive improvement was not as significant in the context of the escape trial. Therefore, if more mechanisms of neurodegeneration are identified and regulated simultaneously, cognitive recovery might be more substantial.

4. Conclusions

We successfully screened an anti-Aβ1-42 oligomers antibody (11A5) from a human scFv antibodies phage display library that we developed in-house. We also demonstrated the ability of 11A5 to combine with and deactivate Aβ1-42. Moreover, therapy with 11A5 effectively improved the behavioral abilities of APP/PS1 transgenic mice. Anti-Aβ1-42 antibody (11A5) could not only combine with and deactivate the Aβ1-42 peptide directly but also initiate Aβ efflux or clearance from the brain. These results suggest that humanized anti-Aβ antibodies therapy may have a positive effect in treating AD.

5. Experimental procedures

5.1. Ethics Statement

All patients provided written informed consent to participate in this study. Animals were treated according to the standards of Animal Care and Use Committee of Zhengzhou University. All procedures in our study were approved by the Ethics Committee of Zhengzhou University.

5.2. Construction and cloning of phage antibody library

We collected peripheral venous blood from 20 AD patients in heparin-containing tubes. The blood was used within a few hours of collection. We diluted 10 mL of blood with an equal volume of PBS and carefully overlay 10 mL of the diluted blood with 10 mL of Lymphocyte Separation Medium (Human) (Solarbio, Beijing, China) and centrifuged the tubes at 1500g for 25 min at room temperature (RT). Removed most of the upper layer and collected the buffy coat between the two layers carefully, just the layer of cells, into 2 mL Ep tubes. Suspended the cells in PBS and centrifuged the tubes at 13,000g for 3 min, removed the supernatant and repeated the process for three times. The sediments in the tube were lymphocytes.

Total RNA was extracted from lymphocytes with TrizolTM kit (CWBIO, Beijing, China) according to the manufacturer's instructions and was reverse transcribed to first-strand cDNA in DEPC-treated water using 1 μL random hexamer primer (ThermoScriptTM RT-PCR System, Invitrogen, Grand Island, NY, USA), 2 μL of 10 mM dNTP-Mix (Invitrogen), 1 μL 0.1 M DTT (Invitrogen), 1 μL RNAOUTTM (Invitrogen) and 1 μL ThermoScriptTM RT (Invitrogen) in a final volume of 20 μL. Samples were denatured by incubating at 65 °C for 5 min, followed by 50 min at 50 °C. The cDNA obtained was stored at − 20 °C.

cDNAs coding for immunoglobulin heavy chains (VH) and light chains (VL) were amplified with different primers (synthesized by Sangon Biotech, Shanghai, China) and were used to amplify a majority of the known human antibody sequences via reverse transcription- polymerase chain reaction (RT-PCR) (Brezinschek et al., 1995, 1998; Huang and Stollar, 1991). The 20 μL reaction volumes contained 2 μL of cDNA, 1 μL of each primer, 1 μL 10 mM dNTP-Mix, 5 μL 10 × PCR buffer and 0.2 μL Taq DNA polymerase (Invitrogen). The cycling parameters were 94 °C for 30 s (denaturation), 55 °C for 30 s (annealing) and 72 °C for 1 min (extension) for 31 cycles. The purified VH and VL DNA were made into an scFv fragment through a pair of linker DNA fragments (Sangon Biotech) using T4DNA Ligase (CWBIO) at 22 °C for 1 h. The fragments were then amplified with special primers by Taq DNA polymerase (Invitrogen) at 94 °C for 35 s (denaturation), 57 °C for 30 s (annealing) and 72 °C for 1 min (extension) for 35 cycles. All products were confirmed by 0.8% agarose gel electrophoresis. The amplified VH and VL fragments were approximately 340 bp and 360 bp in size respectively, and the size of scFv fragments was approximately 750 bp.

The scFv fragments and the pCANTAB-5E vector (Bio-viewshine, Beijing, China) were digested with Sfi I and Not I restriction enzymes (New England Biolabs, NEB, Beverly, MA, USA) overnight at 37 °C. Then, they were ligated at a 3:1 (insert: vector) ratio for 5 min at 25 °C with Quick T4 DNA ligase (NEB) and electroporated into competent E. coli TG1 cells (NEB). The products were rescued by the M13K07 helper phage (Bio-viewshine). E. coli TG1 cells were electroporated using a MicroPulser Electroporation Apparatus (Bio-Rad, Richmond, CA, USA) and 0.1 cm electroporation cuvettes. Following recovery, the cells were plated in ampicillin-containing media and grown overnight at 37 °C. The cells were resuspended in 2 × YT-AK medium. The cultures were incubated overnight on a rocking platform at 250 rpm at 37 °C. And then were centrifuged at 13,000g for 10 min. The supernatant containing the recombinant phage was stored at 4 °C for the next step of bio-panning.

5.3. Antibodies from the scFv phage antibody library were selected based on their specificity for Aβ1-42 oligomers

Preparation of Aβ1-42 oligomers: 1 mg Aβ1-42 peptide (Sangon Biotech) in lyophilized form was dissolved in 500 mL1, 1, 1, 3, 3, 3-hexafluoro-2- isopropanol (HFIP) and incubated for 1 h at 25 °C and then was aliquoted into small aliquot and dried using a speed-vac. The dry peptide was stored at −20 °C for the next step. The dry peptide was dissolved in borate buffered saline (50 mM BBS/PBS) and reacted with 5 mM glutaraldehyde at 37 °C overnight to generate stable oligomers by controlled polymerization. The solution was neutralized with Tris buffer then dialysed against deionized distilled water overnight and lyophilized. It could be re-solubilized in deionized distilled water and diluted in PBS until required (Goni et al., 2010, 2013).

50 Colony units of scFv phage antibody library were placed in 96-well plates coated with prepared Aβ1-42 oligomers, which was pre-incubated with a bovine serum albumin-blocked polyvinylidene difluoride membrane to prevent non-specific binding. After 60 min at 37 °C, the membrane was washed by shaking 5, 10, 10 and 10 times with PBS, PBST for rounds 1, 2, 3 and 4 in several. After incubating at 37 °C overnight, phages were collected by centrifugation and resuspended in 3 mL of PBS containing 1% bovine serum albumin. The input and output phages were titrated onto SOB-ampicillin-tetracycline agar plates to calculate the enrichment ratios. The eluted phages (100 μL) were selected and enlarged by infecting E. coli HB2151 cells (NEB) with M13K07 helper phage after each round to coat a SOBAG tablet, which was then incubated at 30 °C for more than 20 h. The samples were placed in plates coated with Aβ1-42 samples, with M13K07 as a negative control and 2 × YT as a bland control. The samples were blocked with 3% bovine serum albumin and washed 3 times with PBST. Next, 100 μL horseradish peroxidase-conjugated anti-M13 antibody (HRP/anti-M13, Amersham Biosciences, Bath, UK) was added (1:5000 in PBS containing 2% (v/v) bovine serum albumin), and the samples were incubated for 1 h at 37 °C. Following 6 washes with PBST, the clones were treated with tetramethylbenzidine substrate (TMB) and the reaction was terminated with 50 μL of 2 mol/L H2SO4. Analysis of the specificity of scFv antibodies to Aβ1-42 oligomers by Western blot according to Western blot assay (Cloutier et al., 2000). We used 11A5 (1:100) as the primary antibody and the secondary antibody with HRP/anti E-tag (1:10000; Abcam, Cambridge, UK).

Enzyme-linked immunosorbent assay (ELISA) was performed to screen for positive clones (11A5). Clones were considered positive when the A450 nm was more than 3 times the signal observed in wells with M13K07 alone. The phage-mid derived from clone 11A5 was used for DNA sequencing.

5.4. Animals

20 male Sprague–Dawley (SD) rats weighing 200–300 g were purchased from the Model Animal Research Center of Zhengzhou University in China (Zhengzhou, China).

60 APP/PS1 (APPswe × PS1dE9) double-transgenic mice in the C57BL/6J genetic background and weighing 20–25 g were purchased from the Model Animal Research Center of Nanjing University in China (Nanjing, China). These mice display immature and progressive plaques along with neuritic pathology accompanied by high levels of Aβ1-42 beginning at 4 months of age (Wang et al., 2009).

Animals were housed five to a cage and maintained on a 12-h light/dark cycle (lights on at 8 a.m.). Food and water were freely available. Every precaution was taken to limit the numbers of animals used and to minimize their suffering.

5.5. Combined injection of anti-Aβ1-42 antibodies and Aβ peptide into SD rats

Synthetic Aβ1-42 (Sangon Biotech) (1 mg) was dissolved in sterile distilled water at a concentration of 2.5 nmol/μL and incubated at 37 °C for 24 h. Anti-Aβ1-42 antibodies 11A5 or commercialized antibodies 6E10 were added to the Aβ1-42 solution (at a ratio of 4:1) in a 200 μL reaction volume (Aβ1-42 alone as control). The samples were incubated at 37 °C for 3 h and centrifuged for 5 min at 13,000g, the supernatants were removed, and the samples were incubated for an additional 1 h at 37 °C. SD rats were divided into 4 groups (n = 5/group) and received intracerebroventricular injection (i.c.v.) of 25 nmol/rat of Aβ1-42 alone, or Aβ1-42 mixed with 11A5 (25 nmol/rat, the content of 11A5 was 20 nmol/rat), or Aβ1-42 mixed with 6E10 (25 nmol/rat, the content of 6E10 was 20 nmol/rat). An equivalent volume of normal saline was administered to the sham group (Bergin and Liu, 2010). After 30 days, behavioral changes in the 4 groups were assessed using the Morris water maze (Klapdor and van der staay, 1996; Vorhees and Williams, 2006).

5.6. Using anti-Aβ1-42 antibodies to treat APP/PS1 transgenic mice

We used PCR analysis of tail DNA to confirm the genotypes of APP/PS1 transgenic mice. Tail biopsies were acquired and genomic DNA was prepared using a TIANcombi DNA Lyse&Det PCR Kit (TIANGEN BIOTECH, Beijing, China). The oligonucleotides were designed to amplify a 344 bp fragment of the APP gene and a 600 bp fragment of the PS1 gene, including the mutation site (Borchelt et al., 1997; Zhang et al., 2011). The primers for APP, PS1 and GADPH (Sangon Biotech) were as follows: APP, 5′GACTGACCACTCGACCAGGTTC TG 3′ (sense) and 5′CTTGTAACTTGGATTCTCATATCCG 3′ (anti-sense); PS1, 5′AA TAGAGAACGGAGGAGCA 3′ (sense) and 5′GCCATGAGGGCACTAATCAT 3′ (antisense); control GADPH, 5′GCUGAUCCAUGACAACUGGTT 3′ (sense) and 5′ AAAGCC-GUCAUCCAUGACCTT 3′ (antisense). The tail tissues were homogenized with a grinding pestle and were prepared according to the manufacturer's instructions. The reaction cocktail included 10 μL of 2 × Det PCR MasterMix, 0.5 μL of each primer, 1.0 μL of sample DNA, and DEPC water to a final volume of 20 μL. The cycling conditions were 94 °C for 3 min, 94 °C for 30 s (denaturation), 55–63 °C for 30 s (annealing) and 72 °C for 1 min (extension) for 35 cycles, followed by 72 °C for 5 min. The products were confirmed by 0.8% agarose gel electrophoresis. Numbers of the mice with double-positive gene expression was 45.

The mice with double-positive gene expression were chosen and randomly divided into 3 groups: control, 11A5 (0.1 nmol/μL), and commercialized antibodies 6E10 (0.1 nmol/ μL) (Santa Cruz Biotech) (n = 5 for each group and time point). There were no significant intergroup differences in the animals' body weights. The treatment groups received a total of six 200 μL intraperitonial (i.p.) of either 11A5 or 6E10 every 2 weeks (Bard et al., 2012). Control group mice were given an equivalent volume of PBS. At 1, 2, 3 month, the Morris water maze was used to evaluate changes in behavior. Mice were anesthetized with 10% chloral hydrate (400 mg/kg) and sacrificed. The brains and peripheral blood were carefully collected to assess the secretions of Aβ by ELISA.

The Morris water maze was used to detect behavioral changes in animals (Francis et al., 1995; Klapdor and van der staay, 1996). Cylindrical pools (150 cm in diameter, 50 cm high for rats; 120 cm in diameter, 50 cm high for mice) were filled with 24 °C water (white-dyed water for APP/PS1 transgenic mice). An escape platform (12 cm in diameter) was placed 1–2 cm (2 cm for rats; 1 cm for mice) below the water surface and was fixed in the middle of the southeast quadrant of the pool. On each of 4 continuous days, animals were given 4 swimming attempts. For each attempt, the animals were released from a starting point chosen from the other quadrants, and the time spent to reach the platform (escape latency) was recorded. If animals could not find the platform within 90 s, they were placed on the platform for 30 s. The average time for the 4 swimming attempts was as the latency score for each animal. The averages were calculated for every group each day. After the last attempt on the final day, an additional attempt was performed with the platform removed (probe test) to examine spatial reference memory. When the platform was removed from the pool, the animals were allowed to swim freely for 120 s. The time that the animals spent swimming in the southeast quadrant (where the platform had been located) and the number of crossings over a point where the platform had been were recorded. After each trial, animals were dried and returned to their home cages.

The concentrations of Aβ in brains and peripheral blood were measured using a Beta-Amyloid Total Aβ ELISA Kit (Covance, Princeton, NJ, USA) according to the manufacturer's instructions. Each sample was assayed in duplicate at appropriate dilutions so that the relative luminescent units fell within the range of standard curves. Titers were recorded at an optical density of 450 nm. Anti-APP, anti-BACE1 and anti-PS1 antibodies were purchased from Sigma-Aldrich Co. LLC (St. Louis, Missouri, USA) for the Western blot. The hippocampi in each group were kept on ice for immediate homogenization in lysis buffer added with protease inhibitor. Samples were separated in SDS-PAGE gel and transferred to PVDF membrane. After blocked with 5% TBST, membranes were incubated with the above primary antibodies over-night in 4 °C and followed to the incubation with secondary antibody of a horseradish peroxidase-conjugated goat-anti-mouse IgG (1:5000, Sigma) for 1 h at room temperature. Membrane were washed for 5 min × 3 times in TBST between the incubations. Protein was detected by conducting reaction with Chemiluminescent Substrate (Invitrogen), exposing and developing the film.

5.7. Statistical analysis

All experimental data were statistically analyzed using the SPSS version 13.0 software. The results were presented as the means±SD. One-way ANOVA was used to analyze the performance in the probe trial protocol; the differences in Aβ concentrations among 11A5, 6E10 treatment groups and control group. Bonferroni correction was used for the two-group comparisons. Repeated measures ANOVA followed by the least significant difference (LSD) test was applied to compare the escape latencies among groups. P<0.05 was considered statistically significant.

Acknowledgments

This project was supported by the National Natural Science Foundation of China (81271284) and the National Institutes of Health (R01NS078026 and R01AT007317). The funders had no role in the study design, data collection and analysis, decision to publish, or the preparation of the manuscript. We wish to thank Dr. Xiaobing Cui (Department of Neurology, The Fifth Affiliated Hospital of Zhengzhou University) for assistance with the manuscript and the technical support staff at the Institute of Neurology, Zhengzhou University.

Footnotes

Competing interests

The authors declare no competing interests.

Author contributions

Conceived and designed the experiments: Jianping Wang and Nan Li

Performed the experiments: Nan Li, Lie Yu, Xiaojie Fu and Xi Liu

Analyzed the data: Jun Ma and Zhiqiang Gu

Contributed reagents/materials/analysis tools: Jianping Wang and Jian Wang

Wrote and revised the manuscript: Nan Li

Jian Wang

Data Availability Statement:

All relevant data are within the paper.

Contributor Information

Jianping Wang, Email: wjpwfy666@126.com.

Jian Wang, Email: jwang79@jhmi.edu.

References

  1. Allsop D, Landon M, Kidd M. The isolation and amino acid composition of senile plaque core protein. Brain Res. 1983;259:348–352. doi: 10.1016/0006-8993(83)91273-8. [DOI] [PubMed] [Google Scholar]
  2. Bard F, Cannon C, Barbour R, Burke RL, Games D, Grajeda H, Guido T, Hu K, Huang J, Johnson-Wood K, Khan K, Kholodenko D, Lee M, Lieberburg I, Motter R, Nguyen M, Soriano F, Vasquez N, Weiss K, Welch B, Seubert P, Schenk D, Yednock T. Peripherally administered antibodies against amyloid beta-peptide enter the central nervous system and reduce pathology in a mouse model of Alzheimer disease. Nat Med. 2000;6:916–919. doi: 10.1038/78682. [DOI] [PubMed] [Google Scholar]
  3. Bard F, Fox M, Friedrich S, Seubert P, Schenk D, Kinney GG, Yednock T. Sustained levels of antibodies against Abeta in amyloid-rich regions of the CNS following intravenous dosing in human APP transgenic mice. Exp Neurol. 2012;238:38–43. doi: 10.1016/j.expneurol.2012.07.022. [DOI] [PubMed] [Google Scholar]
  4. Bergin DH, Liu P. Agmatine protects against beta-amyloid25-35-induced memory impairments in the rat. Neuroscience. 2010;169:794–811. doi: 10.1016/j.neuroscience.2010.05.004. [DOI] [PubMed] [Google Scholar]
  5. Birmingham K, Frantz S. Set back to Alzheimer vaccine studies. Nat Med. 2002;8:199–200. doi: 10.1038/nm0302-199b. [DOI] [PubMed] [Google Scholar]
  6. Borchelt DR, Ratovitski T, van Lare J, Lee MK, Gonzales V, Jenkins NA, Copeland NG, Price DL, Sisodia SS. Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins. Neuron. 1997;19:939–945. doi: 10.1016/s0896-6273(00)80974-5. [DOI] [PubMed] [Google Scholar]
  7. Brezinschek HP, Brezinschek RI, Lipsky PE. Analysis of the heavy chain repertoire of human peripheral B cells using single-cell polymerase chain reaction. J Immunol. 1995;155:190–202. [PubMed] [Google Scholar]
  8. Brezinschek HP, Foster SJ, Dorner T, Brezinschek RI, Lipsky PE. Pairing of variable heavy and variable kappa chains in individual naive and memory B cells. J Immunol. 1998;160:4762–4767. [PubMed] [Google Scholar]
  9. Buss NA, Henderson SJ, McFarlane M, Shenton JM, de Haan L. Monoclonal antibody therapeutics: history and future. Curr Opin Pharmacol. 2012;12:615–622. doi: 10.1016/j.coph.2012.08.001. [DOI] [PubMed] [Google Scholar]
  10. Chauhan NB. Intracerebroventricular passive immunization with anti-oligoAbeta antibody in TgCRND8. J Neurosci Res. 2007;85:451–463. doi: 10.1002/jnr.21110. [DOI] [PubMed] [Google Scholar]
  11. Cloutier SM, Couty S, Terskikh A, Marguerat L, Crivelli V, Pugnieres M, Mani JC, Leisinger HJ, Mach JP, Deperthes D. Streptabody, a high avidity molecule made by tetramerization of in vivo biotinylated, phage display-selected scFv fragments on streptavidin. Mol Immunol. 2000;37:1067–1077. doi: 10.1016/s0161-5890(01)00023-2. [DOI] [PubMed] [Google Scholar]
  12. DeMattos RB, Bales KR, Cummins DJ, Dodart JC, Paul SM, Holtzman DM. Peripheral anti-A beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer’s disease. Proc Natl Acad Sci USA. 2001;98:8850–8855. doi: 10.1073/pnas.151261398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Francis DD, Zaharia MD, Shanks N, Anisman H. Stress-induced disturbances in Morris water-maze performance: interstrain variability. Physiol Behav. 1995;58:57–65. doi: 10.1016/0031-9384(95)00009-8. [DOI] [PubMed] [Google Scholar]
  14. Glenner GG, Wong CW. Alzheimer’s disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein 1984. Biochem Biophys Res Commun. 2012;425:534–539. doi: 10.1016/j.bbrc.2012.08.020. [DOI] [PubMed] [Google Scholar]
  15. Goni F, Prelli F, Ji Y, Scholtzova H, Yang J, Sun Y, Liang FX, Kascsak R, Kascsak R, Mehta P, Wisniewski T. Immunomodulation targeting abnormal protein conformation reduces pathology in a mouse model of Alzheimer’s disease. PLoS One. 2010;5:e13391. doi: 10.1371/journal.pone.0013391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Goni F, Herline K, Peyser D, Wong K, Ji Y, Sun Y, Mehta P, Wisniewski T. Immunomodulation targeting of both Abeta and tau pathological conformers ameliorates Alzheimer’s disease pathology in TgSwDI and 3xTg mouse models. J Neuroinflamm. 2013;10:150. doi: 10.1186/1742-2094-10-150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Haass C, Selkoe DJ. Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer’s amyloid beta-peptide. Nat Rev Mol Cell Biol. 2007;8:101–112. doi: 10.1038/nrm2101. [DOI] [PubMed] [Google Scholar]
  18. Hardy J, Selkoe DJ. The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Science. 2002;297:353–356. doi: 10.1126/science.1072994. [DOI] [PubMed] [Google Scholar]
  19. Hock C, Konietzko U, Streffer JR, Tracy J, Signorell A, Muller-Tillmanns B, Lemke U, Henke K, Moritz E, Garcia E, Wollmer MA, Umbricht D, de Quervain DJ, Hofmann M, Maddalena A, Papassotiropoulos A, Nitsch RM. Antibodies against beta-amyloid slow cognitive decline in Alzheimer’s disease. Neuron. 2003;38:547–554. doi: 10.1016/s0896-6273(03)00294-0. [DOI] [PubMed] [Google Scholar]
  20. Huang C, Stollar BD. Construction of representative immunoglobulin variable region cDNA libraries from human peripheral blood lymphocytes without in vitro stimulation. J Immunol Methods. 1991;141:227–236. doi: 10.1016/0022-1759(91)90149-a. [DOI] [PubMed] [Google Scholar]
  21. Kayed R, Head E, Thompson JL, McIntire TM, Milton SC, Cotman CW, Glabe CG. Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis. Science. 2003;300:486–489. doi: 10.1126/science.1079469. [DOI] [PubMed] [Google Scholar]
  22. Keller T, Kalt R, Raab I, Schachner H, Mayrhofer C, Kerjaschki D, Hantusch B. Selection of scFv antibody fragments binding to human blood versus lymphatic endothelial surface antigens by direct cell phage display. PLoS One. 2015;10:e0127169. doi: 10.1371/journal.pone.0127169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Klapdor K, van der staay FJ. The Morris water-escape task in mice: strain differences and effects of intra-maze contrast and brightness. Physiol Behav. 1996;60:1247–1254. doi: 10.1016/s0031-9384(96)00224-7. [DOI] [PubMed] [Google Scholar]
  24. Klyubin I, Walsh DM, Lemere CA, Cullen WK, Shankar GM, Betts V, Spooner ET, Jiang L, Anwyl R, Selkoe DJ, Rowan MJ. Amyloid beta protein immunotherapy neutralizes Abeta oligomers that disrupt synaptic plasticity in vivo. Nat Med. 2005;11:556–561. doi: 10.1038/nm1234. [DOI] [PubMed] [Google Scholar]
  25. Lafaye P, Achour I, England P, Duyckaerts C, Rougeon F. Single-domain antibodies recognize selectively small oligomeric forms of amyloid beta, prevent Abeta-induced neurotoxicity and inhibit fibril formation. Mol Immunol. 2009;46:695–704. doi: 10.1016/j.molimm.2008.09.008. [DOI] [PubMed] [Google Scholar]
  26. Marks JD, Griffiths AD, Malmqvist M, Clackson TP, Bye JM, Winter G. By-passing immunization: building high affinity human antibodies by chain shuffling. Biotechnology. 1992;10:779–783. doi: 10.1038/nbt0792-779. [DOI] [PubMed] [Google Scholar]
  27. Petrenko VA, Vodyanoy VJ. Phage display for detection of biological threat agents. J Microbiol Methods. 2003;53:253–262. doi: 10.1016/s0167-7012(03)00029-0. [DOI] [PubMed] [Google Scholar]
  28. Relkin NR, Szabo P, Adamiak B, Burgut T, Monthe C, Lent RW, Younkin S, Younkin L, Schiff R, Weksler ME. 18-Month study of intravenous immunoglobulin for treatment of mild Alzheimer disease. Neurobiol Aging. 2009;30:1728–1736. doi: 10.1016/j.neurobiolaging.2007.12.021. [DOI] [PubMed] [Google Scholar]
  29. Schenk D. Amyloid-beta immunotherapy for Alzheimer’s disease: the end of the beginning. Nat Rev Neurosci. 2002;3:824–828. doi: 10.1038/nrn938. [DOI] [PubMed] [Google Scholar]
  30. Selkoe DJ. Amyloid beta-peptide is produced by cultured cells during normal metabolism: a reprise. J Alzheimers Dis. 2006;9:163–168. doi: 10.3233/jad-2006-9s319. [DOI] [PubMed] [Google Scholar]
  31. Silacci M, Brack S, Schirru G, Marlind J, Ettorre A, Merlo A, Viti F, Neri D. Design, construction, and characterization of a large synthetic human antibody phage display library. Proteomics. 2005;5:2340–2350. doi: 10.1002/pmic.200401273. [DOI] [PubMed] [Google Scholar]
  32. Sliwkowski MX, Mellman I. Antibody therapeutics in cancer. Science. 2013;341:1192–1198. doi: 10.1126/science.1241145. [DOI] [PubMed] [Google Scholar]
  33. Smith GP. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 1985;228:1315–1317. doi: 10.1126/science.4001944. [DOI] [PubMed] [Google Scholar]
  34. Szardenings M. Phage display of random peptide libraries: applications, limits, and potential. J Recept Signal Transduct Res. 2003;23:307–349. doi: 10.1081/rrs-120026973. [DOI] [PubMed] [Google Scholar]
  35. Vorhees CV, Williams MT. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat Protoc. 2006;1:848–858. doi: 10.1038/nprot.2006.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wang X, Liu P, Zhu H, Xu Y, Ma C, Dai X, Huang L, Liu Y, Zhang L, Qin C. miR-34a, a microRNA up-regulated in a double transgenic mouse model of Alzheimer’s disease, inhibits bcl2 translation. Brain Res Bull. 2009;80:268–273. doi: 10.1016/j.brainresbull.2009.08.006. [DOI] [PubMed] [Google Scholar]
  37. Weksler ME, Pawelec G, Franceschi C. Immune therapy for age-related diseases. Trends Immunol. 2009;30:344–350. doi: 10.1016/j.it.2009.03.011. [DOI] [PubMed] [Google Scholar]
  38. Willats WG. Phage display: practicalities and prospects. Plant Mol Biol. 2002;50:837–854. doi: 10.1023/a:1021215516430. [DOI] [PubMed] [Google Scholar]
  39. Winter G, Griffiths AD, Hawkins RE, Hoogenboom HR. Making antibodies by phage display technology. Annu Rev Immunol. 1994;12:433–455. doi: 10.1146/annurev.iy.12.040194.002245. [DOI] [PubMed] [Google Scholar]
  40. Yuan Z, Du M, Chen Y, Dou F. Construction of human Fab library and screening of a single-domain antibody of amyloid-beta 42 oligomers. Neural Regen Res. 2013;8:3107–3115. doi: 10.3969/j.issn.1673-5374.2013.33.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zameer A, Kasturirangan S, Emadi S, Nimmagadda SV, Sierks MR. Anti-oligomeric Abeta single-chain variable domain antibody blocks Abeta-induced toxicity against human neuroblastoma cells. J Mol Biol. 2008;384:917–928. doi: 10.1016/j.jmb.2008.09.068. [DOI] [PubMed] [Google Scholar]
  42. Zhang H, Gao Y, Dai Z, Meng T, Tu S, Yan Y. IGF-1 reduces BACE-1 expression in PC12 cells via activation of PI3-K/Akt and MAPK/ERK1/2 signaling pathways. Neurochem Res. 2011;36:49–57. doi: 10.1007/s11064-010-0260-x. [DOI] [PubMed] [Google Scholar]

RESOURCES