Skip to main content
PLOS One logoLink to PLOS One
. 2016 Mar 21;11(3):e0150842. doi: 10.1371/journal.pone.0150842

MicroRNA Mediated Chemokine Responses in Human Airway Smooth Muscle Cells

Mythili Dileepan 1, Anne E Sarver 2, Savita P Rao 1, Reynold A Panettieri Jr 3, Subbaya Subramanian 2, Mathur S Kannan 1,*
Editor: Neeraj Vij4
PMCID: PMC4801396  PMID: 26998837

Abstract

Airway smooth muscle (ASM) cells play a critical role in the pathophysiology of asthma due to their hypercontractility and their ability to proliferate and secrete inflammatory mediators. microRNAs (miRNAs) are gene regulators that control many signaling pathways and thus serve as potential therapeutic alternatives for many diseases. We have previously shown that miR-708 and miR-140-3p regulate the MAPK and PI3K signaling pathways in human ASM (HASM) cells following TNF-α exposure. In this study, we investigated the regulatory effect of these miRNAs on other asthma-related genes. Microarray analysis using the Illumina platform was performed with total RNA extracted from miR-708 (or control miR)-transfected HASM cells. Inhibition of candidate inflammation-associated gene expression was further validated by qPCR and ELISA. The most significant biologic functions for the differentially expressed gene set included decreased inflammatory response, cytokine expression and signaling. qPCR revealed inhibition of expression of CCL11, CXCL10, CCL2 and CXCL8, while the release of CCL11 was inhibited in miR-708-transfected cells. Transfection of cells with miR-140-3p resulted in inhibition of expression of CCL11, CXCL12, CXCL10, CCL5 and CXCL8 and of TNF-α-induced CXCL12 release. In addition, expression of RARRES2, CD44 and ADAM33, genes known to contribute to the pathophysiology of asthma, were found to be inhibited in miR-708-transfected cells. These results demonstrate that miR-708 and miR-140-3p exert distinct effects on inflammation-associated gene expression and biological function of ASM cells. Targeting these miRNA networks may provide a novel therapeutic mechanism to down-regulate airway inflammation and ASM proliferation in asthma.

Introduction

Several recent reports have provided evidence that airway smooth muscle (ASM) has strong pro-inflammatory and immunomodulatory functions [1–4]. These properties of ASM are mediated through its synthetic function as well as through expression of a variety of cell-surface molecules, integrins [5–7], and Toll-like receptors [8, 9]. During acute airway inflammation, mediators and cytokines released from structural and inflammatory cells alter ASM contractile function [10–13]. However, during persistent airway inflammation, cytokines and chemokines produced by inflammatory cells and ASM can cause ASM proliferation, leading to structural changes in the airways, often referred to as airway remodeling [14, 15]. During chronic airway inflammation, the immunomodulatory role of ASM may be more significant in establishing structural changes within the airways than its contractile function. In this context, recent reports show that ASM is capable of releasing cytokines such as IL-5 [16, 17], IL-6 [18, 19], IL-33 [20], TSLP [21], GM-CSF [22] and VEGF [23]; chemokines such as RANTES[16], Fractalkine [24], CCL11 [25], CXCL10[26–28], CXCL8[29]; adhesion molecules such as ICAM-1[30, 31], VCAM-1 [30, 32], CD44 [33] and LFA-1[34]; and growth factors such as IGF-1 [35, 36] and stem cell factor [37]. Cytokines released by immune cells recruited into the lungs during allergic inflammation may also stimulate ASM cells to alter the expression of proinflammatory genes in an autocrine or paracrine manner. There is also evidence for hypersecretion of chemokines both constitutively and in response to cytokines in ASM cells obtained from asthmatics than in cells from non-asthmatics [14, 38]. There is also increased chemotaxis of mast cells toward ASM cells from asthmatics both in vivo and in vitro [28, 39–41]. Other studies have examined the transcriptional regulation of expression of chemokine genes in human ASM cells (HASM) [29, 42]. While such transcriptional regulation of expression of chemokines is better understood, the post-transcriptional regulation is an emerging area of investigation. In this context, recent studies provide evidence for specific microRNAs in the regulation of ASM proliferation [43, 44], ASM phenotype [45] and airway inflammation [46, 47].

microRNAs (miRNAs) are small non-coding ~22nt RNAs that regulate gene expression by binding to the 3’-Untranslated Region (3’UTR) of target mRNAs to cause mRNA degradation and/or translational repression [48]. Since binding of miRNAs to target sequences is dependent on its ‘seed’ sequence, a single miRNA can potentially regulate a large number of genes. Specific miRNAs have already been discovered that regulate cellular functions such as differentiation, proliferation, and apoptosis. [48–50] Dysregulation of miRNA expression has been implicated in airway inflammation [48–50], but the specific miRNAs (miR-140-3p and miR-708) controlling inflammation have not previously been reported. In a recent report we identified miR-708 in the post-transcriptional regulation of expression of a cell-surface protein CD38 through two major signaling pathways [51]. Transfection of HASM cells with miR-708 causes the induction of phosphatase and tensin homolog (PTEN), which regulates PI3K/AKT signaling by decreasing Akt phosphorylation and interacts with members of the NF-κB signaling network. miR-708 also induces DUSP-1, a dual specificity phosphatase, leading to JNK MAPK dephosphorylation [51].

Our recent investigations also provided evidence for down-regulation of p38 MAP kinase and NF-κB activation in HASM cells following transfection with miR-140-3p [52]. The net effect of PTEN and DUSP-1 induction as well as inhibition of MAP kinase and NF-κB activation in ASM cells by miRNAs should lead to modulation of key signaling pathways involved in inflammation and cell proliferation. There is evidence that the expression of several chemokine genes, the release of chemokines and cell proliferation in HASM cells are also regulated by these same signaling pathways [53–59].

In this study, we evaluated differentially expressed genes using microarrays and qPCR in HASM cells following miR-708 transfection and stimulation with the inflammatory cytokine TNF-α, with particular emphasis on the expression of cytokine/chemokine genes, other pro-inflammatory genes, and those reported to be involved in the asthmatic phenotype. Since many of these chemokines are involved in the recruitment of inflammatory cells such as eosinophils, basophils, mast cells and T lymphocytes into the airways during allergic airway disease, we measured their release from cells stimulated with the inflammatory cytokine TNF-α and following transfection with miR-708 or miR-140-3p.

Materials and Methods

Ethics statement: Airway smooth muscle cells from human lungs were prepared in Dr. Panettieri’s laboratory at the University of Pennsylvania. Lung tissues were obtained from the National Disease Resource Interchange (NDRI) and its use was approved by the Institutional Review Board at the University of Pennsylvania and University of Minnesota. All donor tissue is harvested anonymously and de-identified and therefore the use of the cells does not constitute human subjects research. Primary ASM cells were isolated from deceased donors.

Reagents

Reagents used in the current study: DMEM from GIBCO-BRL (Grand Island, NY); rh-TNF-α from R&D Systems (Minneapolis, MN); TRIzol, SuperScript III reverse transcriptase, Opti-MEM® reduced serum medium and Lipofectamine® RNAiMax transfection reagent from Invitrogen Life Technologies (Carlsbad, CA); Brilliant lll Ultra-Fast SYBR Green qPCR Master Mix from Agilent Technologies Inc (Santa Clara CA); control oligo (scrambled sequence mimic) and miR-708 mimic (mature miR-708 sequence: 5’-AAGGAGCUUACAAUCUAGCUGGG-3’; mature miR-140-3p sequence: 5′-UACCACAGGGUAGAACCACGG-3′) from Dharmacon (Lafayette, CO); Tris-base, glucose, HEPES and other chemicals from Sigma Chemical Co. (St. Louis, MO).

Microarray sample preparation

ASM cells, derived from three de-identified healthy donors, used between 2-5th passages, were seeded at 1.5 X 105 cells/well and transfected with mimic or scrambled sequence mimic of miR-708 at 50 nM concentration [51]. We used the same concentration which was previously determined to be optimal to inhibit the expression of CD38 [51]. Cells that were growth arrested (24 h) after transfection, were induced with pro-inflammatory cytokines TNF-α at 10 ng/ml (24 h). Total RNA was harvested using PureLink RNA isolation kit according to the manufacturer’s instructions. Purity of the RNA was determined with a Nanometer 2000C for the ratios 260/280 and 260/230. For each condition (mimic or scrambled oligo treatment), 1000 ng of total RNA was subjected to microarray analysis. Genome-wide changes in gene expression in transfected cells were generated using Illumina human (HT-12) arrays and analyzed using BeadStudio version 3.1.1.

Data Analysis

For statistical analysis and clustering, we used the Partek Genomics Suite software package (Partek Inc., St. Louis, MO, USA). We performed a paired t-test with donor ID and mimic/control as the nominal variables. Before comparison analysis and clustering, we filtered extremely low and non-variant genes out of the datasets. Significance cutoff filters were set at P < 0.05 and an expression change of at least 2-fold. For functional and pathway analyses we used Ingenuity Pathway Analysis (IPA) software (Qiagen, Redwood City, CA, USA). IPA employs a right-tailed Fisher exact test to calculate a P value corresponding to the probability that a biologic function not relevant to the input dataset is falsely identified as relevant. A Benjamini–Hochberg false discovery rate of 0.05 was used to correct such P values.

Validation of genes by qPCR

As described in the “Microarray sample preparation”, total RNA was isolated and cDNA was prepared using reverse transcription kit from Invitrogen Life Technologies (Carlsbad, CA). cDNAs were subjected to qPCR analysis using Brilliant SYBR Green Master Mix and Stratagene Mx3000p qPCR system (Foster City, California, 94404). Primer sequences and conditions for the genes tested are provided in Table 1. The β-actin gene was used as a housekeeping gene to normalize the expressions of other genes.

Table 1. Primer Sequences.

Gene primer sequences
CXCL10 F: 5'—3' GAACTGTACGCTGTACCTGCA
R: 5'—3' TTGATGGCCTTCGATTCTGGA
CXCL8 F: 5'—3' ACTGAGAGTGATTGAGAGTGGAC
R: 5'—3' AACCCTCTGCACCCAGTTTTC
CCL5 F: 5'—3' CAGTCGTCTTTGTCACCCGAA
R: 5'—3' TCCCAAGCTAGGACAAGAGCA
CCL2 F: 5'—3' AGGTGACTGGGGCATTGAT
R: 5'—3' GCCTCCAGCATGAAAGTCTC
CXCL12 F: 5'—3' TGCCAGAGCCAACGTCAAG
R: 5'—3' CAGCCGGGCTACAATCTGAA
CCL11 F: 5'—3' CCCCAGAAAGCTGTGATCTTCA
R: 5'—3' GGAGTTGGAGATTTTTGGTCCAGAT
RARRES2 F: 5'—3' GAGGGACTGGAAGAAACCCG
R: 5'—3' CATGGCTGGGGATAGAACGG
ADAM33 F: 5'—3' GACCTAGAATGGTGTGCCAGA
R: 5'—3' AGCCTGGC TTGTCACAGAAG
CD44 F: 5'—3' AGCATCGGATTTGAGACCTG
R: 5'—3' GTCCACATTCTGCAGGTTCC
β-Actin F: 5'—3' ACACTGTGCCCATCTACGAGG
R: 5'—3' AGGGGCCGGACTCGTCATACT

Chemokine Release assay

HASM cells were transfected with mimic or scrambled sequence mimic of miR-708 or miR-140-3p or were untransfected (control) as described in earlier publications [51, 52]. Cells were then growth arrested and treated with 10ng/ml TNF-α. Cell culture supernatants were collected at different time points ranging from 6–48 h. Collected supernatants were aliquoted and immediately stored at -80°C until assayed. Chemokines in the culture supernatants were quantified using ELISA kits from R&D system (Minneapolis, MN) according to the manufacturer’s instructions.

Results

Microarray results

We performed a detailed analysis of the pattern of gene expression in HASM cells stimulated with TNF-α following transfection with miR-708. Gene expression results are shown as a heatmap (Fig 1). Visual inspection easily identifies differential patterns of expression between samples treated with a miR-708-5p mimic (purple bar) versus a scrambled control (orange bar). Principal Component Analysis (PCA) confirmed the mimic as the primary differential component (Fig 2). Our analysis found that 821 genes were differentially expressed (348 upregulated and 473 downregulated) in HASM cells transfected with a miR-708 mimic versus a scrambled control sequence (paired t-test, P < 0.05). Table 2 summarizes the differentially expressed chemokines/cytokines, transcription factors, extracellular matrix components, calcium signaling molecules, growth factors and other genes related to airway hyperresponsiveness. The complete list of genes is available as S1 Data.

Fig 1. Heat map of mRNA microarray expression data.

Fig 1

Purple bar indicates samples treated with the miR-708 mimic; orange bar indicates samples treated with a scrambled control. Sample rows are arranged in the same donor-order (i.e. donor 1 samples are rows 1 and 4).

Fig 2. Principal Component Analysis.

Fig 2

There is a clear primary separation of samples based on miR-708 mimic versus scrambled control. Secondary separation was by donor ID.

Table 2. Differentially expressed genes in TNF-α-stimulated HASM cells following miR-708 mimic transfection.

Gene ID Fold change Function
Inflammatory mediators
Chemokines CXCL10 -2.695 Chemoattracts mast cell
CCL8 -5.38 Chemoattracts monocytes
CCL11 -8.968 Chemoattracts Eosinophils
CXCL12 -5.254 Chemoattractant T-lymphocytes & monocytes
CCL5 -3.52 Chemoattracts Eosinophil
CCL2 -3.21 Chemoattracts monocytes, fibrocytes and basophils
CXCL8 -2.03 Chemoattracts neutrophils, basophils and T-cells
CXCL16 -2.688 Scavenger receptor on macrophages
CXCL5 -2.389 Activates neutrophils
CXCL9 -2.375 Chemoattracts activated T-cells
CXCL11 -2.151 Chemoattracts interleukin-activated T-cells
CXCL6 -2.039 Chemoattracts neutrophil, granulocytes
Cytokines
IL18BP -4.028 Inhibits the early TH1 cytokine response
IL6 -1.832 Stimulates the differentiation of B-cells and acts as a myokine.
TNFSF13B -4.216 Stimulates B- and T-cell function
Genes associated with Extracellular Matrix
VCAM1 -20.59 Enhances leukocyte-endothelial cell adhesion and T cell inflammatory functions
COL3A1 -9.808 Activates RhoA pathway
COL6A1 -3.185 A major structural component of microfibrils
CD44 -4.25 Increases airway hyperresponsiveness [80]; leads to inflammation [61, 81] by interacting with T-cell [33] and mast cell [67]; increases ASM cell proliferation [82]
THBS1 -4.797 Increases IL-8 production [83]
MXRA5 -4.581 Associates with matrix-remodeling protein
ADAMTS-1 6.158 Increases FEV1 [84]
TAPBP -4.38 Increases antigen processing andassembly of MHC class I [85]
Transcription factors
NFKB1 -1.876 Regulates immune response
RELA -1.728 Regulates immune response
Calcium signaling
CD38 -2.286 Increases cell adhesion, signal transduction, AHR and calcium signaling.
BDKRB1 -1.994 Increases chronic and acute inflammatory responses
FKBP10 -2.198 Regulates [Ca2+]i dynamics
Growth factors and related genes
IGFBP5 -4.009 Prolongs the half-life of the IGFs
PDGFRL -4.258 Increases proliferation
EGFL6 -3.886 Regulates cell cycle & induces proliferation
Airway hyper-responsiveness
ACTG2 -17.181 Increases muscle contraction
TAGLN -4.691 Increases calcium interactions and contractility
MYLK -2.12 Increases Smooth muscle contraction
PDE5A -2.50 Inactivates cGMP [86]
Genes associated with proliferation F2F7 6.8 Anti-proliferative [87]
IL24 11.6 Anti-proliferative [88]
COL1A1 -7.474 Increases ASM cell proliferation [89]
DUSP6 10.915 Decreases ASM cell proliferation
UBE2C 18.96 Increases cell proliferation
CDC20 16.459 Increases cell proliferation
ID1 16.089 Increases cell proliferation
ANGPTL4 12.633 Increases ASM cell proliferation [90]
CDK1 5.387 Increases cell proliferation

Functional and Pathway Analysis

The most significant biologic functions for this differential gene set included decreased inflammatory response, cytokine expression and signaling. In particular, many components of the IL-17 pro-inflammatory pathway were down-regulated. Multiple pathways and biologic functions related to cell cycle progression were predicted to be upregulated.

miR-708 inhibits chemokine mRNA expression and other asthma related genes

Results of gene expression analysis revealed significant down-regulation of expression of several chemokine genes as well as some genes associated with the asthmatic phenotype (Fig 3). Therefore, we used qPCR analysis to validate the microarray results of expression of these genes. HASM cells were transfected with miR-708-5p mimic oligonucleotides or the scrambled control and then treated with TNF-α. 24 hours following the addition of TNF-α, total RNA was collected from the cells and subjected to qPCR analysis. There was significant inhibition in the expression of chemokine genes CCL11 (P <0.0001), CXCL10 (P = 0.0308), CCL2 (P = 0.0422) and CXCL8 (p = 0.0156) (Fig 4) as well as other ‘asthma related’ genes such as CD44 (P = 0.0328), ADAM33 (P = 0.0016) and RARRESS2 (P = 0.0006) (Fig 5). On the other hand, the mRNA expression levels for chemokine genes CCL5 (P = 0.0549) and CXCL12 following transfection with the miR-708 mimic were not significantly different from expression in scrambled oligonucleotide-transfected cells (Fig 4).

Fig 3. Network diagram.

Fig 3

Potential regulatory pathways connecting miR-708 and down-regulated molecules of interest in HASM cells. Several chemokine genes were observed to be significantly down-regulated, particularly CD44 and CD38 (-3.23 and -2.287, respectively). Nodes are colored either by observed expression changes in the paired t-test (Green) or by predicted activation status (Blue = predicted inhibition) based on the assumption of increased miR-708-5p (Red). Potential relationships are indicated by solid (direct interaction) or dotted (indirect interaction) lines. Interaction lines are colored based on whether the predicted relationship leads to inhibition (Blue), leads to predicted activation (Yellow; but inconsistent with observed results), or effect was not able to be predicted (Gray).

Fig 4. Downregulation of chemokine mRNA expression following miR-708 transfection.

Fig 4

HASM cells derived from 3–5 donors were transfected with mimic or scrambled (Scr) sequence mimic of miR-708 followed by exposure to TNF-α (10ng/ml) to measure chemokine mRNA expression. Note the significant inhibition in the expression of CCL11, CXCL10, CXCL8 and CCL2 following miR-708 mimic transfection compared to expression in cells transfected with scrambled sequence. Data represents mean±SEM.

Fig 5. Down regulation of other ‘asthma related’ genes by miR-708.

Fig 5

HASM cells obtained from 3–5 donors were transfected with mimic or scrambled sequence mimic (Scr) of miR-708 followed by treatment with TNF-α (10ng/ml/). Note significant inhibition of expression of CD44, ADAM33 and RARRES2 transcripts in miR-708 mimic-transfected cells compared to expression in scrambled sequence transfected cells. Data represents mean±SEM.

miR-708 transfection and release of chemokines

To determine whether changes in the mRNA expression of chemokines were reflected in their protein expression, we measured their release in HASM cell culture supernatant following miR-708 mimic or scrambled sequence mimic transfection and TNF-α induction. As a control, we collected the culture supernatant from untransfected but TNF-α treated HASM cells. Of the chemokines that were assayed, only CCL11 release exhibited significant downregulation of release in mimic miR-708-transfected cells compared to release from cells transfected with the scrambled oligonucleotide or from control cells at all time points examined (Fig 6).

Fig 6. Chemokine release from HASM cells following miR-708 transfection.

Fig 6

HASM cells from 3–6 donors were transfected with mimic or scrambled sequence mimic of miR-708 and treated with TNF-α (10ng/ml) following growth arrest of cells. Untransfected cells treated with TNF-α served as an additional control. Twenty hours later cell culture supernatants were collected for the measurement of chemokines. Note the release of CCL11 was significantly inhibited at every time point following miR-708 transfection when compared to scrambled sequence mimic transfection. Data represents mean±SEM.

miR-140-3p transfection and chemokine mRNA expression and release

The expression of many of the chemokine genes in HASM cells is regulated by signaling pathways that are downregulated by miR-140-3p. Therefore, we measured the expression and release of chemokines in response to TNF-α following miR-140-3p transfection. HASM cells were transfected with miR-140-3p mimic oligonucleotides or the scrambled control and then treated with TNF-α. Twenty four hours following the addition of TNF-α, total RNA was collected from the cells and subjected to qPCR analysis. There was significant inhibition in the expression of chemokine genes CCL11 (p = <0.005), CXCL12 (p<0001), CCL5 (p<0.0009), CXCL10 (p = 0.0033), CCL2 (p = 0.0422) and CXCL8 (p = 0.0033) (Fig 7). We measured the release of chemokines in HASM cell culture supernatant following miR-140-30 mimic or scrambled sequence mimic transfection and TNF-α induction. As a control, we collected the culture supernatant from untransfected but TNF-α-treated HASM cells. Of the chemokines that were assayed, only CXCL12 release exhibited significant down-regulation of release in mimic miR-140-3p-transfected cells compared to release from cells transfected with the scrambled miR-140-3p oligonucleotides or from control cells at all time points examined (Fig 7).

Fig 7. Chemokine mRNA expression and release from HASM cells following miR-140-3p transfection.

Fig 7

HASM cells derived from 3–5 donors were transfected with mimic or scrambled (Scr) sequence mimic of miR-140-3p followed by exposure to TNF-α (10ng/ml) to measure chemokine mRNA expression and chemokine release. Note the significant inhibition in the expression of CCL11, CXCL10, CXCL8, CXCL12 and CCL5 following mimic transfection compared to expression in cells transfected with scrambled sequence. Note the release of CXCL12 was significantly inhibited following mimic transfection. Data represents mean±SEM.

Discussion

Using a transcriptomics-based approach, we investigated differentially expressed genes in HASM cells treated with TNF-α following miR-708 transfection compared to expression in cells transfected with the scrambled mimic oligonucleotides. This analysis revealed changes in the expression of several genes, including those for chemokines/cytokines, extracellular matrix proteins, transcription factors, calcium signaling molecules, growth factors, and genes associated with airway hyperresponsiveness. Several genes involved in cell cycle regulation were up-regulated, although the genes that block cell proliferation such as E2F7, DUSP6 and IL-24, were also significantly upregulated. There was downregulation of expression of JNK MAP kinase which is involved in serum-induced ASM cell proliferation [60]. The changes in the expression of chemokine genes revealed in this approach were confirmed by qPCR. In addition, miR-708 also caused downregulation of expression of several ‘asthma-related’ genes such as CD44 [33, 61], ADAM33 [62, 63] and RARRES2 [64–66]. Prior reports have shown that CD44 is involved in mast cell-ASM cell adherence through Type I collagen and this adherence is greater during airway inflammation as well as in ASM cells derived from asthmatics [67]. miR-140-3p transfection of HASM cells also resulted in inhibition of expression of chemokines that were sensitive to inhibition by miR-708, with the exception of CXCL12. However, chemokine release measurements revealed inhibition of release of CXCL12, but not the other chemokines.

In the present study, we examined the post-transcriptional regulation of expression of several inflammatory genes in HASM cells by miR-708. HASM cells express miR-708 and miR-140-3p constitutively and TNF-α causes a significant reduction in their expression [51, 52]. Furthermore, the constitutive expression of DUSP-1 and PTEN are also significantly downregulated following exposure to TNF-α [51]. Transfection with miR-708 in cells stimulated with TNF-α resulted in a significant augmentation of PTEN and DUSP-1 expression, with concomitant decreased activation of Akt and JNK MAP kinase, respectively [51]. The PI3 kinase/Akt and MAP kinase signaling mechanisms are involved in airway inflammation by activating transcription factors such as NF-κB and AP-1 [68–71]. Recent reports have shown that this signaling is involved in the hyperproliferative phenotype of ASM cells from asthmatics [54]. Our earlier study showed that miR-140-3p decreases the activation of p38 MAP kinase and NF-κB in HASM cells. The promoter regions of several chemokine genes contain binding sites for NF-κB and AP-1 as well as for other transcription factors [72–74]. Furthermore, TNF-α has been shown to induce the expression and release of cytokines/chemokines from HASM cells [25, 41, 42, 75, 76] including the chemokines that we have examined in this study. Although the mechanisms by which miR-708 decreased the expression of the chemokine genes that we examined are not addressed in this study, the 3’UTRs of CXCL12 and CCL5 have predicted target sites for miR-708 indicating that this miRNA may directly target these transcripts. As well, miR-140-3p also has predicted binding sites at 3’UTR of CXCL12 and CXCL8. It is very likely that the inhibition of expression of chemokine genes following miR-708 or miR-140-3p transfection resulted from indirect mechanisms of decreased activation of transcription factors and MAP kinases as well as binding of miRNAs to cause translational repression and/or mRNA breakdown.

The miRNAs examined in this study had profound inhibitory effects on the chemokines involved in the recruitment of eosinophils, mast cells, T lymphocytes and fibrocytes. Chemokine release studies additionally revealed inhibition of release of CCL11 and CXCL12. It is interesting to note that our microarray results showed a high level of downregulation of CXCL12 expression by miR-708, while the qPCR results did not show any change in CXCL12 transcript levels following miRNA transfection. It is very likely that miR-708 may regulate transcription and release of some chemokines while it may have a dominant effect on release for others. It is also known that production of specific chemokines in ASM cells may involve unique signaling pathways and stimuli, as has been shown for CXCL10 release [41]. In this study, it was reported that in HASM cells exposed to TNF-α or IL-1β, CXCL10 production required JNK MAP kinase activation, while its release was induced by p38 MAP kinase activation. The results of the microarray analysis of differentially expressed genes and qPCR results confirmed selective downregulation of JNK MAP kinase expression by miR-708, with decreased JNK MAP kinase phosphorylation. This decreased JNK MAP kinase activation may be a mechanism involved in the inhibition of CCL11 release and expression in miR-708 transfected cells following exposure to TNF-α. It should be noted that among the chemokine transcripts examined, miR-708 transfection resulted in a profound inhibition of CCL11 expression while the inhibition of expression of other chemokine transcripts was modest and not of sufficient magnitude to be reflected in inhibition of release. Transfection of cells with miR-140-3p caused significant attenuation of expression of all the five chemokine genes examined, while exerting a selective inhibitory effect on the release of CXCL12 but not the other chemokines. The decreased p38 MAP kinase activation following miR-140-3p transfection noted in our previous studies [59] may be involved in the attenuation of CXCL12 release in response to TNF-α. Furthermore, these miRNAs may selectively inhibit the release of some chemokines but not others. Recent investigations have shown that stimulation of ASM cells with a mixture of cytokines causes significantly higher amounts of chemokine release than following exposure to individual cytokines [56, 59]. It should be emphasized that in our study chemokine release was measured from cells following miRNA transfection and growth-arrest, before stimulation with TNF-α. It will be interesting to examine release of chemokines in response to a mixture of cytokines following miRNA transfection.

In conclusion, this study demonstrates a profound anti-inflammatory effect of miR-708 and miR-140-3p in HASM cells stimulated with the inflammatory cytokine TNF-α. Specifically, targeting these miRNAs resulted in the down-regulation of expression of multiple different chemokines and the release of specific chemokines involved in the recruitment of inflammatory cells into the airways during allergic airway inflammation. Previous results have shown that CD38, involved in generating calcium mobilizing molecules, contributes to airway hyperresponsiveness. [77–79]. Therapeutic strategies that target both CD38 and these miRNA networks may prove effective in reversal of allergen-induced changes in airway hyperresponsiveness and airway inflammation, particularly in the asthmatic patient.

Supporting Information

S1 Data. Complete list of differentially expressed genes in HASM cells transfected with a miR-708 mimic.

Table shows fold-change in expression relative to expression in cells transfected with a scrambled control sequence and the p value.

(XLS)

Data Availability

All relevant data are within the paper.

Funding Statement

RAP received funding from the National Institutes of Health (Grant Numbers: P01-HL114471 and P30-ES013508 to RAP).

References

  • 1.Damera G, Panettieri RA Jr. Does airway smooth muscle express an inflammatory phenotype in asthma? British journal of pharmacology. 2011;163(1):68–80. Epub 2010/12/24. 10.1111/j.1476-5381.2010.01165.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hershenson MB, Brown M, Camoretti-Mercado B, Solway J. Airway smooth muscle in asthma. Annu Rev Pathol. 2008;3:523–55. [DOI] [PubMed] [Google Scholar]
  • 3.Dekkers BG, Maarsingh H, Meurs H, Gosens R. Airway structural components drive airway smooth muscle remodeling in asthma. Proc Am Thorac Soc. 2009;6(8):683–92. Epub 2009/12/17. 10.1513/pats.200907-056DP . [DOI] [PubMed] [Google Scholar]
  • 4.Tliba O, Panettieri RA Jr. Noncontractile functions of airway smooth muscle cells in asthma. Annu Rev Physiol. 2009;71:509–35. Epub 2008/10/15. 10.1146/annurev.physiol.010908.163227 . [DOI] [PubMed] [Google Scholar]
  • 5.Gunst SJ, Tang DD. The contractile apparatus and mechanical properties of airway smooth muscle. Eur Respir J. 2000;15(3):600–16. Epub 2000/04/12. . [DOI] [PubMed] [Google Scholar]
  • 6.Tatler AL, John AE, Jolly L, Habgood A, Porte J, Brightling C, et al. Integrin alphavbeta5-mediated TGF-beta activation by airway smooth muscle cells in asthma. Journal of immunology. 2011;187(11):6094–107. Epub 2011/10/26. 10.4049/jimmunol.1003507 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gong H, Shen B, Flevaris P, Chow C, Lam SC, Voyno-Yasenetskaya TA, et al. G protein subunit Galpha13 binds to integrin alphaIIbbeta3 and mediates integrin "outside-in" signaling. Science. 2010;327(5963):340–3. Epub 2010/01/16. 10.1126/science.1174779 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ekman AK, Adner M, Cardell LO. Toll-like receptor 7 activation reduces the contractile response of airway smooth muscle. Eur J Pharmacol. 2011;652(1–3):145–51. Epub 2010/12/02. 10.1016/j.ejphar.2010.11.009 . [DOI] [PubMed] [Google Scholar]
  • 9.Manetsch M, Seidel P, Heintz U, Che W, Hughes JM, Ge Q, et al. TLR2 ligand engagement upregulates airway smooth muscle TNFalpha-induced cytokine production. American journal of physiology Lung cellular and molecular physiology. 2012;302(9):L838–45. Epub 2012/01/17. 10.1152/ajplung.00317.2011 . [DOI] [PubMed] [Google Scholar]
  • 10.Perez-Zoghbi JF, Sanderson MJ. Endothelin-induced contraction of bronchiole and pulmonary arteriole smooth muscle cells is regulated by intracellular Ca2+ oscillations and Ca2+ sensitization. American journal of physiology Lung cellular and molecular physiology. 2007;293(4):L1000–11. Epub 2007/07/10. 10.1152/ajplung.00184.2007 . [DOI] [PubMed] [Google Scholar]
  • 11.Xu J, Zhong NS. Mechanisms of bronchial hyperresponsiveness: the interaction of endothelin-1 and other cytokines. Respirology. 1999;4(4):413–7. Epub 1999/12/28. . [DOI] [PubMed] [Google Scholar]
  • 12.Cockcroft DW, Davis BE. Mechanisms of airway hyperresponsiveness. The Journal of allergy and clinical immunology. 2006;118(3):551–9; quiz 60–1. Epub 2006/09/05. 10.1016/j.jaci.2006.07.012 . [DOI] [PubMed] [Google Scholar]
  • 13.Burd PR, Thompson WC, Max EE, Mills FC. Activated mast cells produce interleukin 13. The Journal of experimental medicine. 1995;181(4):1373–80. Epub 1995/04/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Halwani R, Al-Abri J, Beland M, Al-Jahdali H, Halayko AJ, Lee TH, et al. CC and CXC chemokines induce airway smooth muscle proliferation and survival. Journal of immunology. 2011;186(7):4156–63. Epub 2011/03/04. 10.4049/jimmunol.1001210 . [DOI] [PubMed] [Google Scholar]
  • 15.Khan MA. Inflammation signals airway smooth muscle cell proliferation in asthma pathogenesis. Multidiscip Respir Med. 2013;8(1):11 Epub 2013/02/08. 10.1186/2049-6958-8-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.John M, Hirst SJ, Jose PJ, Robichaud A, Berkman N, Witt C, et al. Human airway smooth muscle cells express and release RANTES in response to T helper 1 cytokines: regulation by T helper 2 cytokines and corticosteroids. Journal of immunology. 1997;158(4):1841–7. Epub 1997/02/15. . [PubMed] [Google Scholar]
  • 17.Lazzeri N, Belvisi MG, Patel HJ, Chung KF, Yacoub MH, Mitchell JA. RANTES release by human airway smooth muscle: effects of prostaglandin E(2) and fenoterol. Eur J Pharmacol. 2001;433(2–3):231–5. Epub 2002/01/05. . [DOI] [PubMed] [Google Scholar]
  • 18.McKay S, Hirst SJ, Haas MB, de Jongste JC, Hoogsteden HC, Saxena PR, et al. Tumor necrosis factor-alpha enhances mRNA expression and secretion of interleukin-6 in cultured human airway smooth muscle cells. American journal of respiratory cell and molecular biology. 2000;23(1):103–11. Epub 2000/06/29. 10.1165/ajrcmb.23.1.3765 . [DOI] [PubMed] [Google Scholar]
  • 19.Ammit AJ, Hoffman RK, Amrani Y, Lazaar AL, Hay DW, Torphy TJ, et al. Tumor necrosis factor-alpha-induced secretion of RANTES and interleukin-6 from human airway smooth-muscle cells. Modulation by cyclic adenosine monophosphate. American journal of respiratory cell and molecular biology. 2000;23(6):794–802. Epub 2000/12/06. 10.1165/ajrcmb.23.6.4184 . [DOI] [PubMed] [Google Scholar]
  • 20.Prefontaine D, Lajoie-Kadoch S, Foley S, Audusseau S, Olivenstein R, Halayko AJ, et al. Increased expression of IL-33 in severe asthma: evidence of expression by airway smooth muscle cells. Journal of immunology. 2009;183(8):5094–103. [DOI] [PubMed] [Google Scholar]
  • 21.Zhang K, Shan L, Rahman MS, Unruh H, Halayko AJ, Gounni AS. Constitutive and inducible thymic stromal lymphopoietin expression in human airway smooth muscle cells: role in chronic obstructive pulmonary disease. American journal of physiology Lung cellular and molecular physiology. 2007;293(2):L375–82. Epub 2007/05/22. 10.1152/ajplung.00045.2007 . [DOI] [PubMed] [Google Scholar]
  • 22.Saunders MA, Mitchell JA, Seldon PM, Yacoub MH, Barnes PJ, Giembycz MA, et al. Release of granulocyte-macrophage colony stimulating factor by human cultured airway smooth muscle cells: suppression by dexamethasone. British journal of pharmacology. 1997;120(4):545–6. Epub 1997/02/01. 10.1038/sj.bjp.0700998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Knox AJ, Corbett L, Stocks J, Holland E, Zhu YM, Pang L. Human airway smooth muscle cells secrete vascular endothelial growth factor: up-regulation by bradykinin via a protein kinase C and prostanoid-dependent mechanism. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 2001;15(13):2480–8. Epub 2001/11/02. 10.1096/fj.01-0256com . [DOI] [PubMed] [Google Scholar]
  • 24.El-Shazly A, Berger P, Girodet PO, Ousova O, Fayon M, Vernejoux JM, et al. Fraktalkine produced by airway smooth muscle cells contributes to mast cell recruitment in asthma. Journal of immunology. 2006;176(3):1860–8. Epub 2006/01/21. . [DOI] [PubMed] [Google Scholar]
  • 25.Ghaffar O, Hamid Q, Renzi PM, Allakhverdi Z, Molet S, Hogg JC, et al. Constitutive and cytokine-stimulated expression of eotaxin by human airway smooth muscle cells. American journal of respiratory and critical care medicine. 1999;159(6):1933–42. [DOI] [PubMed] [Google Scholar]
  • 26.Gao YD, Cao J, Li P, Huang G, Yang J. Th2 cytokine-primed airway smooth muscle cells induce mast cell chemotaxis via secretion of ATP. J Asthma. 2014;51(10):997–1003. Epub 2014/10/02. 10.3109/02770903.2014.939283 . [DOI] [PubMed] [Google Scholar]
  • 27.Alkhouri H, Cha V, Tong K, Moir LM, Armour CL, Hughes JM. Human Lung Mast Cell Products Regulate Airway Smooth Muscle CXCL10 Levels. J Allergy (Cairo). 2014;2014:875105 Epub 2014/03/22. 10.1155/2014/875105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Brightling CE, Ammit AJ, Kaur D, Black JL, Wardlaw AJ, Hughes JM, et al. The CXCL10/CXCR3 axis mediates human lung mast cell migration to asthmatic airway smooth muscle. American journal of respiratory and critical care medicine. 2005;171(10):1103–8. Epub 2005/05/10. 10.1164/rccm.200409-1220OC . [DOI] [PubMed] [Google Scholar]
  • 29.John AE, Zhu YM, Brightling CE, Pang L, Knox AJ. Human airway smooth muscle cells from asthmatic individuals have CXCL8 hypersecretion due to increased NF-kappa B p65, C/EBP beta, and RNA polymerase II binding to the CXCL8 promoter. Journal of immunology. 2009;183(7):4682–92. Epub 2009/09/08. 10.4049/jimmunol.0803832 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Panettieri RA Jr, Lazaar AL, Pure E, Albelda SM. Activation of cAMP-dependent pathways in human airway smooth muscle cells inhibits TNF-alpha-induced ICAM-1 and VCAM-1 expression and T lymphocyte adhesion. Journal of immunology. 1995;154(5):2358–65. Epub 1995/03/01. . [PubMed] [Google Scholar]
  • 31.Amrani Y, Lazaar AL, Panettieri RA Jr. Up-regulation of ICAM-1 by cytokines in human tracheal smooth muscle cells involves an NF-kappa B-dependent signaling pathway that is only partially sensitive to dexamethasone. Journal of immunology. 1999;163(4):2128–34. Epub 1999/08/10. . [PubMed] [Google Scholar]
  • 32.Lazaar AL, Krymskaya VP, Das SK. VCAM-1 activates phosphatidylinositol 3-kinase and induces p120Cbl phosphorylation in human airway smooth muscle cells. Journal of immunology. 2001;166(1):155–61. Epub 2000/12/21. . [DOI] [PubMed] [Google Scholar]
  • 33.Lazaar AL, Albelda SM, Pilewski JM, Brennan B, Pure E, Panettieri RA Jr. T lymphocytes adhere to airway smooth muscle cells via integrins and CD44 and induce smooth muscle cell DNA synthesis. The Journal of experimental medicine. 1994;180(3):807–16. Epub 1994/09/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Grunstein MM, Hakonarson H, Maskeri N, Kim C, Chuang S. Intrinsic ICAM-1/LFA-1 activation mediates altered responsiveness of atopic asthmatic airway smooth muscle. American journal of physiology Lung cellular and molecular physiology. 2000;278(6):L1154–63. Epub 2000/06/03. . [DOI] [PubMed] [Google Scholar]
  • 35.Rajah R, Nachajon RV, Collins MH, Hakonarson H, Grunstein MM, Cohen P. Elevated levels of the IGF-binding protein protease MMP-1 in asthmatic airway smooth muscle. American journal of respiratory cell and molecular biology. 1999;20(2):199–208. Epub 1999/01/28. 10.1165/ajrcmb.20.2.3148 . [DOI] [PubMed] [Google Scholar]
  • 36.Noveral JP, Bhala A, Hintz RL, Grunstein MM, Cohen P. Insulin-like growth factor axis in airway smooth muscle cells. The American journal of physiology. 1994;267(6 Pt 1):L761–5. Epub 1994/12/01. . [DOI] [PubMed] [Google Scholar]
  • 37.Hollins F, Kaur D, Yang W, Cruse G, Saunders R, Sutcliffe A, et al. Human airway smooth muscle promotes human lung mast cell survival, proliferation, and constitutive activation: cooperative roles for CADM1, stem cell factor, and IL-6. Journal of immunology. 2008;181(4):2772–80. Epub 2008/08/08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Singh SR, Sutcliffe A, Kaur D, Gupta S, Desai D, Saunders R, et al. CCL2 release by airway smooth muscle is increased in asthma and promotes fibrocyte migration. Allergy. 2014;69(9):1189–97. Epub 2014/06/17. 10.1111/all.12444 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ozier A, Allard B, Bara I, Girodet PO, Trian T, Marthan R, et al. The pivotal role of airway smooth muscle in asthma pathophysiology. J Allergy (Cairo). 2011;2011:742710 Epub 2012/01/06. 10.1155/2011/742710 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sutcliffe A, Kaur D, Page S, Woodman L, Armour CL, Baraket M, et al. Mast cell migration to Th2 stimulated airway smooth muscle from asthmatics. Thorax. 2006;61(8):657–62. Epub 2006/04/08. 10.1136/thx.2005.056770 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Alrashdan YA, Alkhouri H, Chen E, Lalor DJ, Poniris M, Henness S, et al. Asthmatic airway smooth muscle CXCL10 production: mitogen-activated protein kinase JNK involvement. American journal of physiology Lung cellular and molecular physiology. 2012;302(10):L1118–27. Epub 2012/03/06. 10.1152/ajplung.00232.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Ammit AJ, Lazaar AL, Irani C, O'Neill GM, Gordon ND, Amrani Y, et al. Tumor necrosis factor-alpha-induced secretion of RANTES and interleukin-6 from human airway smooth muscle cells: modulation by glucocorticoids and beta-agonists. American journal of respiratory cell and molecular biology. 2002;26(4):465–74. Epub 2002/03/29. 10.1165/ajrcmb.26.4.4681 . [DOI] [PubMed] [Google Scholar]
  • 43.Hu R, Pan W, Fedulov AV, Jester W, Jones MR, Weiss ST, et al. MicroRNA-10a controls airway smooth muscle cell proliferation via direct targeting of the PI3 kinase pathway. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 2014;28(5):2347–57. Epub 2014/02/14. 10.1096/fj.13-247247 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Perry MM, Baker JE, Gibeon DS, Adcock IM, Chung KF. Airway smooth muscle hyperproliferation is regulated by microRNA-221 in severe asthma. American journal of respiratory cell and molecular biology. 2014;50(1):7–17. Epub 2013/08/16. 10.1165/rcmb.2013-0067OC [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kuhn AR, Schlauch K, Lao R, Halayko AJ, Gerthoffer WT, Singer CA. MicroRNA expression in human airway smooth muscle cells: role of miR-25 in regulation of airway smooth muscle phenotype. American journal of respiratory cell and molecular biology. 2010;42(4):506–13. 10.1165/rcmb.2009-0123OC [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Martinez-Nunez RT, Louafi F, Sanchez-Elsner T. The interleukin 13 (IL-13) pathway in human macrophages is modulated by microRNA-155 via direct targeting of interleukin 13 receptor alpha1 (IL13Ralpha1). The Journal of biological chemistry. 2011;286(3):1786–94. 10.1074/jbc.M110.169367 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Tsitsiou E, Williams AE, Moschos SA, Patel K, Rossios C, Jiang X, et al. Transcriptome analysis shows activation of circulating CD8(+) T cells in patients with severe asthma. The Journal of allergy and clinical immunology. 2012;129(1):95–103. 10.1016/j.jaci.2011.08.011 [DOI] [PubMed] [Google Scholar]
  • 48.Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–97. [DOI] [PubMed] [Google Scholar]
  • 49.Ha TY. MicroRNAs in Human Diseases: From Cancer to Cardiovascular Disease. Immune Netw. 2011;11(3):135–54. Epub 2011/08/24. 10.4110/in.2011.11.3.135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Ha TY. The Role of MicroRNAs in Regulatory T Cells and in the Immune Response. Immune Netw. 2011;11(1):11–41. Epub 2011/04/16. 10.4110/in.2011.11.1.11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Dileepan M, Jude JA, Rao SP, Walseth TF, Panettieri RA, Subramanian S, et al. MicroRNA-708 regulates CD38 expression through signaling pathways JNK MAP kinase and PTEN/AKT in human airway smooth muscle cells. Respiratory research. 2014;15:107 Epub 2014/09/02. 10.1186/s12931-014-0107-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Jude JA, Dileepan M, Subramanian S, Solway J, Panettieri RA Jr, Walseth TF, et al. miR-140-3p regulation of TNF-alpha-induced CD38 expression in human airway smooth muscle cells. American journal of physiology Lung cellular and molecular physiology. 2012;303(5):L460–8. Epub 2012/07/10. 10.1152/ajplung.00041.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Clarke DL, Clifford RL, Jindarat S, Proud D, Pang L, Belvisi M, et al. TNFalpha and IFNgamma synergistically enhance transcriptional activation of CXCL10 in human airway smooth muscle cells via STAT-1, NF-kappaB, and the transcriptional coactivator CREB-binding protein. The Journal of biological chemistry. 2010;285(38):29101–10. Epub 2010/09/14. 10.1074/jbc.M109.0999952 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Burgess JK, Lee JH, Ge Q, Ramsay EE, Poniris MH, Parmentier J, et al. Dual ERK and phosphatidylinositol 3-kinase pathways control airway smooth muscle proliferation: differences in asthma. Journal of cellular physiology. 2008;216(3):673–9. 10.1002/jcp.21450 [DOI] [PubMed] [Google Scholar]
  • 55.Dragon S, Rahman MS, Yang J, Unruh H, Halayko AJ, Gounni AS. IL-17 enhances IL-1beta-mediated CXCL-8 release from human airway smooth muscle cells. American journal of physiology Lung cellular and molecular physiology. 2007;292(4):L1023–9. Epub 2006/12/26. 10.1152/ajplung.00306.2006 . [DOI] [PubMed] [Google Scholar]
  • 56.John M, Au BT, Jose PJ, Lim S, Saunders M, Barnes PJ, et al. Expression and release of interleukin-8 by human airway smooth muscle cells: inhibition by Th-2 cytokines and corticosteroids. American journal of respiratory cell and molecular biology. 1998;18(1):84–90. Epub 1998/02/03. 10.1165/ajrcmb.18.1.2813 . [DOI] [PubMed] [Google Scholar]
  • 57.Lin TY, Venkatesan N, Nishioka M, Kyoh S, Al-Alwan L, Baglole CJ, et al. Monocyte-derived fibrocytes induce an inflammatory phenotype in airway smooth muscle cells. Clin Exp Allergy. 2014;44(11):1347–60. Epub 2014/09/27. 10.1111/cea.12421 . [DOI] [PubMed] [Google Scholar]
  • 58.Rahman MS, Yamasaki A, Yang J, Shan L, Halayko AJ, Gounni AS. IL-17A induces eotaxin-1/CC chemokine ligand 11 expression in human airway smooth muscle cells: role of MAPK (Erk1/2, JNK, and p38) pathways. Journal of immunology. 2006;177(6):4064–71. Epub 2006/09/05. . [DOI] [PubMed] [Google Scholar]
  • 59.Tan X, Khalil N, Tesarik C, Vanapalli K, Yaputra V, Alkhouri H, et al. Th1 cytokine-induced syndecan-4 shedding by airway smooth muscle cells is dependent on mitogen-activated protein kinases. American journal of physiology Lung cellular and molecular physiology. 2012;302(7):L700–10. Epub 2012/01/24. 10.1152/ajplung.00167.2011 . [DOI] [PubMed] [Google Scholar]
  • 60.Chiba S, Sumi Y, Okayasu K, Okamoto T, Tateishi T, Furusawa H, et al. The c-jun N-terminal kinase signaling pathway regulates airway smooth muscle cell proliferation. European Respiratory Journal. 2014;44(Suppl 58). [Google Scholar]
  • 61.Katoh S, Ishii N, Nobumoto A, Takeshita K, Dai SY, Shinonaga R, et al. Galectin-9 inhibits CD44-hyaluronan interaction and suppresses a murine model of allergic asthma. American journal of respiratory and critical care medicine. 2007;176(1):27–35. Epub 2007/04/21. 10.1164/rccm.200608-1243OC . [DOI] [PubMed] [Google Scholar]
  • 62.Holgate ST, Yang Y, Haitchi HM, Powell RM, Holloway JW, Yoshisue H, et al. The genetics of asthma: ADAM33 as an example of a susceptibility gene. Proc Am Thorac Soc. 2006;3(5):440–3. [DOI] [PubMed] [Google Scholar]
  • 63.Van Eerdewegh P, Little RD, Dupuis J, Del Mastro RG, Falls K, Simon J, et al. Association of the ADAM33 gene with asthma and bronchial hyperresponsiveness. Nature. 2002;418(6896):426–30. Epub 2002/07/12. 10.1038/nature00878 . [DOI] [PubMed] [Google Scholar]
  • 64.Mariani F, Roncucci L. Chemerin/chemR23 axis in inflammation onset and resolution. Inflamm Res. 2015;64(2):85–95. Epub 2014/12/31. 10.1007/s00011-014-0792-7 . [DOI] [PubMed] [Google Scholar]
  • 65.Bondue B, Wittamer V, Parmentier M. Chemerin and its receptors in leukocyte trafficking, inflammation and metabolism. Cytokine Growth Factor Rev. 2011;22(5–6):331–8. Epub 2011/11/29. 10.1016/j.cytogfr.2011.11.004 . [DOI] [PubMed] [Google Scholar]
  • 66.Hart R, Greaves DR. Chemerin contributes to inflammation by promoting macrophage adhesion to VCAM-1 and fibronectin through clustering of VLA-4 and VLA-5. Journal of immunology. 2010;185(6):3728–39. Epub 2010/08/20. 10.4049/jimmunol.0902154 . [DOI] [PubMed] [Google Scholar]
  • 67.Girodet PO, Ozier A, Trian T, Begueret H, Ousova O, Vernejoux JM, et al. Mast cell adhesion to bronchial smooth muscle in asthma specifically depends on CD51 and CD44 variant 6. Allergy. 2010;65(8):1004–12. Epub 2010/02/04. 10.1111/j.1398-9995.2009.02308.x . [DOI] [PubMed] [Google Scholar]
  • 68.Lee IT, Yang CM. Inflammatory signalings involved in airway and pulmonary diseases. Mediators Inflamm. 2013;2013:791231 Epub 2013/05/22. 10.1155/2013/791231 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Redhu NS, Saleh A, Halayko AJ, Ali AS, Gounni AS. Essential role of NF-kappaB and AP-1 transcription factors in TNF-alpha-induced TSLP expression in human airway smooth muscle cells. American journal of physiology Lung cellular and molecular physiology. 2011;300(3):L479–85. Epub 2010/12/15. 10.1152/ajplung.00301.2009 . [DOI] [PubMed] [Google Scholar]
  • 70.Eynott PR, Nath P, Leung SY, Adcock IM, Bennett BL, Chung KF. Allergen-induced inflammation and airway epithelial and smooth muscle cell proliferation: role of Jun N-terminal kinase. British journal of pharmacology. 2003;140(8):1373–80. Epub 2003/11/19. 10.1038/sj.bjp.0705569 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Wuyts WA, Vanaudenaerde BM, Dupont LJ, Demedts MG, Verleden GM. Involvement of p38 MAPK, JNK, p42/p44 ERK and NF-kappaB in IL-1beta-induced chemokine release in human airway smooth muscle cells. Respir Med. 2003;97(7):811–7. Epub 2003/07/12. . [DOI] [PubMed] [Google Scholar]
  • 72.Amiri KI, Richmond A. Fine tuning the transcriptional regulation of the CXCL1 chemokine. Prog Nucleic Acid Res Mol Biol. 2003;74:1–36. Epub 2003/09/27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Genin P, Algarte M, Roof P, Lin R, Hiscott J. Regulation of RANTES chemokine gene expression requires cooperativity between NF-kappa B and IFN-regulatory factor transcription factors. Journal of immunology. 2000;164(10):5352–61. Epub 2000/05/09. . [DOI] [PubMed] [Google Scholar]
  • 74.Roger T, Out T, Mukaida N, Matsushima K, Jansen H, Lutter R. Enhanced AP-1 and NF-kappaB activities and stability of interleukin 8 (IL-8) transcripts are implicated in IL-8 mRNA superinduction in lung epithelial H292 cells. The Biochemical journal. 1998;330 (Pt 1):429–35. Epub 1998/04/16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Amrani Y, Ammit AJ, Panettieri RAJ. Tumor necrosis factor receptor (TNFR) 1, but not TNFR2, mediates tumor necrosis factor-alpha-induced interleukin-6 and RANTES in human airway smooth muscle cells: role of p38 and p42/44 mitogen-activated protein kinases. Mol Pharmacol. 2001;60(4):646–55. [PubMed] [Google Scholar]
  • 76.Berkman N, Krishnan VL, Gilbey T, Newton R, O'Connor B, Barnes PJ, et al. Expression of RANTES mRNA and protein in airways of patients with mild asthma. American journal of respiratory and critical care medicine. 1996;154(6 Pt 1):1804–11. [DOI] [PubMed] [Google Scholar]
  • 77.Deshpande DA, White TA, Guedes AG, Milla C, Walseth TF, Lund FE, et al. Altered airway responsiveness in CD38-deficient mice. American journal of respiratory cell and molecular biology. 2005;32(2):149–56. Epub 2004/11/24. 10.1165/rcmb.2004-0243OC . [DOI] [PubMed] [Google Scholar]
  • 78.Guedes AG, Deshpande DA, Dileepan M, Walseth TF, Panettieri RA Jr, Subramanian S, et al. CD38 and airway hyper-responsiveness: studies on human airway smooth muscle cells and mouse models. Canadian journal of physiology and pharmacology. 2015;93(2):145–53. Epub 2015/01/17. 10.1139/cjpp-2014-0410 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Guedes AG, Paulin J, Rivero-Nava L, Kita H, Lund FE, Kannan MS. CD38-deficient mice have reduced airway hyperresponsiveness following IL-13 challenge. American journal of physiology Lung cellular and molecular physiology. 2006;291(6):L1286–93. [DOI] [PubMed] [Google Scholar]
  • 80.Garantziotis S, Li Z, Potts EN, Kimata K, Zhuo L, Morgan DL, et al. Hyaluronan mediates ozone-induced airway hyperresponsiveness in mice. The Journal of biological chemistry. 2009;284(17):11309–17. Epub 2009/01/24. 10.1074/jbc.M802400200 [DOI] [PMC free article] [PubMed] [Google Scholar] [Research Misconduct Found]
  • 81.Katoh S, Matsumoto N, Kawakita K, Tominaga A, Kincade PW, Matsukura S. A role for CD44 in an antigen-induced murine model of pulmonary eosinophilia. J Clin Invest. 2003;111(10):1563–70. Epub 2003/05/17. 10.1172/JCI16583 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Al Heialy S, Risse PA, Zeroual MA, Roman HN, Tsuchiya K, Siddiqui S, et al. T cell-induced airway smooth muscle cell proliferation via the epidermal growth factor receptor. American journal of respiratory cell and molecular biology. 2013;49(4):563–70. Epub 2013/05/10. 10.1165/rcmb.2012-0356OC . [DOI] [PubMed] [Google Scholar]
  • 83.Ishikawa T, Nakayama K, Mikami J, Ito S, Takasaka N, Yumino Y, et al. The involvement of thrombospondin-1 in COPD pathogenesis through IL-8 production. European Respiratory Journal. 2013;42(Suppl 57). [Google Scholar]
  • 84.Paulissen G, Rocks N, Quesada-Calvo F, Gosset P, Foidart JM, Noel A, et al. Expression of ADAMs and their inhibitors in sputum from patients with asthma. Mol Med. 2006;12(7–8):171–9. Epub 2006/11/08. 10.2119/2006-00028.Paulissen [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Androlewicz MJ. The role of tapasin in MHC class I antigen assembly. Immunol Res. 1999;20(2):79–88. Epub 1999/12/02. . [DOI] [PubMed] [Google Scholar]
  • 86.Fan Chung K. Phosphodiesterase inhibitors in airways disease. Eur J Pharmacol. 2006;533(1–3):110–7. Epub 2006/02/07. 10.1016/j.ejphar.2005.12.059 . [DOI] [PubMed] [Google Scholar]
  • 87.de Bruin A, Maiti B, Jakoi L, Timmers C, Buerki R, Leone G. Identification and characterization of E2F7, a novel mammalian E2F family member capable of blocking cellular proliferation. The Journal of biological chemistry. 2003;278(43):42041–9. Epub 2003/08/02. 10.1074/jbc.M308105200 . [DOI] [PubMed] [Google Scholar]
  • 88.Phelan PD, Robertson CF, Olinsky A. The Melbourne Asthma Study: 1964–1999. J Allergy Clin Immunol. 2002;109:89–94. [DOI] [PubMed] [Google Scholar]
  • 89.Hirst SJ, Martin JG, Bonacci JV, Chan V, Fixman ED, Hamid QA, et al. Proliferative aspects of airway smooth muscle. The Journal of allergy and clinical immunology. 2004;114(2 Suppl):S2–17. Epub 2004/08/17. 10.1016/j.jaci.2004.04.039 . [DOI] [PubMed] [Google Scholar]
  • 90.Wenzel S. Severe asthma: from characteristics to phenotypes to endotypes. Clin Exp Allergy. 2012;42:650–8. 10.1111/j.1365-2222.2011.03929.x [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Data. Complete list of differentially expressed genes in HASM cells transfected with a miR-708 mimic.

Table shows fold-change in expression relative to expression in cells transfected with a scrambled control sequence and the p value.

(XLS)

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES