This protocol describes how to perform the tissue culture and high-throughput sequencing library preparation for a CRISPR-based screen. First, pantropic lentivirus is prepared from a sgRNA plasmid pool and applied to the target cells. Following antibiotic selection and a harvest of the initial population, cells are then cultured under the desired screening condition(s) for 14 population doublings. sgRNA barcode sequences integrated in the genomic DNA of each cell population are amplified and subject to high-throughput sequencing. Guidelines for downstream analysis of the sequencing data are also provided.
Materials
Reagents
0.22 μm 150 mL bottle top filter (Corning 430626)
0.45 μm Acrodisc Syringe Filter (VWR 28144-007)
6-well tissue culture-treated plates
15 cm tissue culture-treated plates
Agarose gel, 2.0%
DMEM, high glucose, GlutaMAX Supplement (Gibco 10566-016)
Ethidium bromide
Gel Extraction Kit (Qiagen 28704)
Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216)
Inactivated Fetal Serum (Sigma Aldrich F4135-500ML)
LB (Luria-Bertani) liquid medium
LB-ampicillin agar plates
Lentiviral sgRNA library (from Protocol 1 or Addgene)
Luer-Lok Tip Syringes (Becton Dickinson, various sizes)
Media and various plastics for screen cell culture
Opti-MEM I Reduced-Serum Medium
pCMV-dR8.2 packaging plasmid (Addgene 8455)
pCMV-VSV-G pantropic viral envelope plasmid (Addgene 8454)
Penicillin-Streptomycin (Sigma-Aldrich P4333-20ML)
Phosphate-buffered saline (PBS)
Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB M0531S)
Plasmid Plus Maxi Kit (Qiagen 12963)
Polybrene (EMD Millipore TR-1003-G)
Puromycin
QIAamp DNA Blood Maxi Kit (Qiagen 51194)
-
sgRNA barcode PCR primers
Forward: AATGATACGGCGACCACCGAGATCTACACCGACTCGGTGCCACTTTT
Reverse: CAAGCAGAAGACGGCATACGAGATCnnnnnTTTCTTGGGTAGTTTGCAGTTTT nnnnnn denotes a user-specified sample barcode sequence
-
Sequencing primers for Illumina HiSeq
Read 1 primer: CGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
Indexing primer: TTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAA
x-tracta gel extractor (USA Scientific 5454-0100)
X-tremeGENE 9 DNA Transfection Reagent (Roche 06365787001)
Equipment
Centrifuge with rotors for 6-well plate spin infection
Erlenmeyer flask, 500 mL
Gel imager
Heat block
NanoDrop spectrophotometer (NanoDrop)
Thermocycler
Tissue culture hood for BL2+ work
Tissue culture incubator
Method
NOTE: You must contact your institution’s Bio-Safety office to receive institution-specific instructions. You must follow safety procedures and work in an environment (e.g. BL2+) suitable for handling lentiviruses. A general overview of viral packaging can be found here: https://www.addgene.org/lentiviral/packaging/.
Viral Packaging Vector Preparation
-
1
Streak out bacterial stab cultures of pCMV-dR8.2 and pCMV-VSV-G obtained from Addgene on LB-amp plates and incubate at 37°C overnight.
-
2
Pick a single colony and seed into a 500 mL Erlenmeyer flask containing 100 mL LB liquid media with 100 μg/mL ampicillin.
-
3
Incubate culture at 37°C overnight.
-
4
Prepare plasmid DNA from the bacterial culture using the Qiagen Plasmid Plus Maxi Kit according to the manufacturer’s instructions.
Viral Packaging and Titer Test
Day 1
-
5
Add the following components to make Virus Production Media (VPM).
400 mL DMEM, high glucose, GlutaMAX Supplement
100 mL Inactivated Fetal Serum
5 mL Penicillin (10,000 U/mL)-Streptomycin (10 mg/mL)
Filter media through 0.22 μm bottle-cap filter in a tissue culture hood.
Seed 750,000 HEK-293T cells in a single well of a 6-well plate in 2 mL of VPM. Incubate cells at 37°C overnight in a tissue culture incubator.
Day 2
-
Assemble the following transfection mixture.
50 μL Opti-MEM
1 μg Lentiviral sgRNA library
900 ng pCMV-dR8.2
100 ng pCMV-VSV-G
5 μL XtremeGene 9
-
10
Incubate mixture for 15 minutes at room temperature and add dropwise to cells to transfect.
Incubate cells at 37°C overnight in a tissue culture incubator.
Day 3
-
11
Change media with 2 mL of VPM. Incubate cells at 37°C overnight in a tissue culture incubator.
Day 4
-
12
Harvest viral supernatant from cells and filter through 0.45 μm Acrodisc Syringe Filter.
-
13
Set up the following 5 infections in a 6-well tissue culture-treated plate.
5,000,000 target cells
2 μL polybrene (10 mg/mL)
0, 125, 250, 500, and 1,000 μL filtered virus
Up to 2 mL cell culture media
Note: Some lines may not tolerate spin-infection and overnight incubation this density. Please adjust cell numbers accordingly for cell lines of interest.
-
14
Spin plate at 1,200 g for 45 minutes in a pre-warmed centrifuge. After spinning, incubate cells at 37°C overnight in a tissue culture incubator.
Day 5
-
15
For adherent cells: aspirate virus-containing media, wash cells with PBS, trypsinize cells, and expand each well into a 15 cm tissue culture-treated plate. Incubate cells at 37°C overnight in a tissue culture incubator. For suspension lines: pellet cells and aspirate virus-containing media. Re-suspend cells into a 15 cm tissue culture-treated plate. Incubate cells at 37°C overnight in a tissue culture incubator.
Day 6
-
16
Add an appropriate selection dose of puromycin to cells.
Note: The optimal dose should be determined by performing a puromycin kill curve.
Day 9
-
17
Observe plates. Identify viral dose required for approximately 40% cell survival (multiplicity of infection 0.5) and discard all plates.
Screen Viral Packaging and Infection
Day 1
-
18
Based on the viral titer test, calculate the volume of virus required to represent the entire library in the cell line of interest 1000-fold (e.g. for a 40,000 sgRNA library = 40,000,000 infected cells = 100,000,000 total cells = 20X test infection volume for 5,000,000 cells)
-
19
Scale up virus production in 10 cm plates (~10 mL virus produced per plate), seeding 3,750,000 HEK-293T cells per plate in 10 mL VPM. Incubate cells at 37°C overnight in a tissue culture incubator.
-
20
Day 2
-
21
For each plate, assemble the following transfection mixture:
250 μL Opti-MEM
5 μg Lentiviral sgRNA library
4.5 μg pCMV-dR8.2
500 ng pCMV-VSV-G
25 μL XtremeGene 9
-
22
Incubate mixture for 15 minutes at room temperature and add dropwise to cells to transfect.
Incubate cells at 37°C overnight in a tissue culture incubator.
Day 3
-
23
Change media in plates with 10 mL fresh VPM. Incubate cells at 37°C overnight in a tissue culture incubator.
Day 4
-
24
Harvest viral supernatant from cells and filter through 0.45 μm Acrodisc Syringe Filter.
Note: Viral supernatants can be stored at −80°C for long term storage but freezing/thawing will cause a reduction in viral titers (typically ~30–50% reduction)
-
25
Calculate the number of wells in a 6-well tissue culture-treated plate required for infection (e.g. for a 40,000 sgRNA library = 40,000,000 infected cells = 100,000,000 total cells = 20 wells of 5,000,000 cells each).
-
26
Assemble a large-scale cell-virus infection mixture according to the following amounts per well: 5,000,000 target cells
2 μL polybrene (10 mg/mL)
Viral dose required for approximately 40% cell survival
Up to 2 mL cell culture media
Note: Some lines may not tolerate spin-infection and overnight incubation this density. Please adjust accordingly for your lines of interest.
-
27
Dispense 2 mL aliquots of the mixture into 6-well plates.
-
28
Spin plates at 1,200 g for 45 minutes in a pre-warmed centrifuge. After spinning, incubate cells at 37°C overnight in a tissue culture incubator.
Day 5
-
29
For adherent cells: aspirate virus-containing media, wash with PBS, trypsinize cells, and expand each infection into 15 cm tissue culture-treated plates. Incubate cells at 37°C overnight in a tissue culture incubator. For suspension lines: pellet cells and aspirate virus-containing media. Re-suspend cells into 15 cm tissue culture-treated plates. Incubate cells at 37°C overnight in a tissue culture incubator.
-
30
As a control, seed uninfected cells at an identical confluence into a 15 cm tissue culture-treated plate. Incubate cells at 37°C overnight in a tissue culture incubator.
Day 6
-
31
Add an appropriate selection dose of puromycin to library-infected and uninfected control cells.
Note: The optimal dose should be determined by performing a puromycin kill curve. Day 9
-
32
Observe plates after 3 days. If cell survival is 40% (multiplicity of infection 0.5) in the infected population and <5% in the uninfected population, passage the infected cells into fresh media. Be sure to maintain a 1000-fold coverage of the library. With the remaining cells, freeze 2 pellets for DNA extraction. These cells will serve as the initial reference population.
Screen Cell Culture and Library Preparation
Note: After infection and selection of the cell population, all subsequent tissue culture work can be performed in a BL2 environment.
-
33
Continue to passage cells, maintaining a 1000-fold coverage of the library at each seeding.
NOTE: For positive selection-based screens, the selection agent should be added approximately 1 week after infection to allow sufficient time for knockouts to be generated.
-
34
After 14 population doublings, collect final cell pellets.
-
35
Extract genomic DNA from the initial and final cell pellets using the QIAamp DNA Blood Maxi Kit according to the manufacturer’s instructions.
-
36
Calculate the total number of PCR reactions required. A 250-fold coverage of the library should be used as input for sgRNA amplification with 3 μg genomic DNA per 50 μL reaction. (e.g. for a 40,000 sgRNA library = 10,000,000 genome equivalents 66 μg for diploid human cells = 22 reactions with 3 μg genomic DNA each.)
-
37
Use the following per-sample recipe to assemble the total reaction mixture and dispense into PCR strip tubes in 50-μL aliquots on ice.
3 μg Genomic DNA
2 μL forward sgRNA PCR primer (10μM)
2 μL sample-specific barcoded reverse sgRNA PCR primer (10μM)
25 μL Phusion PCR Master Mix
Up to 50 μL H2O
-
38
Amplify reactions in a thermocycler using the following program.
1 cycle 98°C 2 minutes 30 cycles 98°C 10 seconds 60°C 15 seconds 72°C 45 seconds 1 cycle 72°C 5 minutes 1 cycle 4°C HOLD -
39
Pool reactions and run them on an ethidium bromide-stained 1% agarose gel. Visualize the PCR bands using a standard gel imager.
-
40
Cut the amplified PCR product using an x-tracta gel extractor tool.
Note: The expected product should be 274 base pairs.
-
41
Extract DNA using the Qiagen Gel Extraction Kit according to the manufacturer’s instructions, eluting in 30 μL H2O.
-
42
Submit extracted PCR products for high-throughput sequencing on an Illumina HiSeq using the custom sequencing primers list in the Materials section. A single end run with a 6 base pair indexing read should be performed.
Data Analysis
Note: The procedure below describes a simple method for calculating gene scores. A suite of tools (originally designed for analyzing shRNA-based screens) exist for more sophisticated gene score tabulation, hit identification, and pathway analysis (Subramanian et al. 2005; Luo et al. 2008; Shao et al. 2012).
-
43
For each individual sample:
Enumerate sgRNA library barcodes using Bowtie.
Add 1 to each sgRNA count.
Calculate the log2 fractional abundance of each sgRNA.
-
44
For each sgRNA of each final sample, subtract the fractional abundance of the sgRNA in the intial sample to determine the log2 fold-change in abundance.
-
45
To calculate gene scores for each final sample, find the average log2 fold-change of all sgRNAs targeting each gene.
-
46
To compare between samples, subtract the genes scores between the samples to identify the differentially scoring genes.
Troubleshooting
Problem: Viral titers are too low.
Solution: Low viral production is typically the result of unhealthy HEK-239T packaging cells. Be sure to check the health of the HEK-239T cells before and after transfection. Ethanol precipitation of the packaging and transfer vectors can also help eliminate bacterial endotoxin, which strongly inhibits viral production.
References
- Luo B, Cheung HW, Subramanian A, Sharifnia T, Okamoto M, Yang X, Hinkle G, Boehm JS, Beroukhim R, Weir BA, et al. Highly parallel identification of essential genes in cancer cells. Proceedings of the National Academy of Sciences. 2008;105:20380–20385. doi: 10.1073/pnas.0810485105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shao DD, Tsherniak A, Gopal S, Weir BA, Tamayo P, Stransky N, Schumacher SE, Zack TI, Beroukhim R, Garraway LA, et al. ATARiS: Computational quantification of gene suppression phenotypes from multisample RNAi screens. Genome Research. 2012 doi: 10.1101/gr.143586.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of America. 2005;102:15545–15550. doi: 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
