Abstract
ID1 (inhibitor of differentiation/DNA binding 1) acts an important role in metastasis, tumorigenesis, and maintenance of cell viability. It has been shown that the up-regulation of ID1 is correlated with poor prognosis and the resistance to chemotherapy of human cancers. However, the underlying molecular mechanism remains elusive. Here, we determined for the first time that up-regulating ID1 upon etoposide activation was mediated through AP-1 binding sites within the ID1 promoter and confirmed that ID1 enhanced cell resistance to DNA damage-induced apoptosis in esophageal squamous cell carcinoma cells. Ablation of c-Jun/c-Fos or ID1 expression enhanced etoposide-mediated apoptosis through increasing activity of caspase 3 and PARP cleavage. Moreover, c-Jun/c-Fos and ID1 were positively correlated in human cancers. More importantly, simultaneous high expression of ID1 and c-Jun or c-Fos was correlated with poor survival in cancer patients. Collectively, we demonstrate the importance of c-Jun/c-Fos-ID1 signaling pathway in chemoresistance of esophageal cancer cells and provide considerable insight into understanding the underlying molecular mechanisms in esophageal squamous cell carcinoma cell biology.
Keywords: AP-1 transcription factor (AP-1), apoptosis, c-Fos, chemoresistance, promoter, ID1, c-Jun, etoposide
Introduction
Esophageal cancer remains one of the most virulent malignancies with ranking eighth in incidence and sixth in cancer-related mortality worldwide (1). These malignancies are particularly prevalent in China and other countries in Asia, where esophageal squamous cell carcinoma (ESCC)3 is most common (1). A 5-year overall survival rate has not been improved evidently despite the progressed surgical techniques and incorporation of new therapeutic approaches in the past decades (2). Adjuvant chemotherapy for ESCC could reduce postoperative recurrence and improve survival (3, 4). Nevertheless, accumulating evidence shows that cancer often acquires resistance to chemotherapy after nonlethal exposure (2, 5). Thus, an integrated view of chemoresistance will provide a more useful approach for designing novel therapies for this devastating disease.
ID1 (inhibitor of differentiation/DNA binding 1) is a member of the helix-loop-helix protein family and contributes to tumorigenesis by inhibiting cell differentiation, stimulating proliferation, and facilitating tumor neoangiogenesis (6–9). ID1 was found to be overexpressed in diverse human tumor types including prostate, breast, colon, and esophagus. The overexpression of ID1 is frequent (93%) in human primary ESCC (10). ID1 expression correlates directly with tumor invasion, metastasis, and poor prognosis in ESCC (6, 11, 12). Notably, ID1 was involved in chemotherapy and radiotherapy resistance in human cancers including pancreatic adenocarcinoma, breast cancer, lung cancer, colorectal cancer, and esophageal cancer and becomes a new potential therapeutic target (13–17). ID1 is transactivated in the context of 5-fluorouracil therapy, which provides a resource for future study addressing the molecular mechanisms of chemotherapy in breast cancer (18). In the study of p53 protecting cells from arsenic caused cell cycle arrest, ID1 is more extensive induced by arsenite in p53+/+ cells rather than p53-deficient cells, which display greater resistance to arsenite-induced mitotic arrest and apoptosis (19). A recent study reported that competitive binding between ID1 and E2F1 to Cdc20 regulates E2F1 degradation and thymidylate synthase expression to promote esophageal cancer chemoresistance. The ID1-E2F1-IGF2 regulatory axis has important implications for cancer prognosis and treatment (12). These data indicate that ID1 is up-regulated by chemotherapeutic drugs and may be involved in chemoresistance. However, the mechanisms of ID1 affecting chemoresistance have yet to be elucidated.
The transcription factor activator protein-1 (AP-1) is a menagerie of dimeric basic region leucine zipper proteins that recognize either 12-O-tetradecanoylphorbol-13-acetate response elements (5′-TGAG/CTCA-3′) or cAMP response elements (5′-TGACGTCA-3′) (20). AP-1 is a mammalian transcription factor and collectively describes a group of structurally and functionally related members of the Jun protein family (c-Jun, JunB, and JunD) and Fos protein family (c-Fos, FosB, Fra-1, and Fra-2) (20, 21). It has been reported that AP-1 is required for cell survival and involved in multidrug resistance (22, 23). Recent research demonstrated that the aberrantly high levels of ID1 expression in cancer are often a consequence of transcriptional induction by many proteins that are activated in a constitutive manner in cancer cells and affect chemoresistance (24–26). Bearing in mind the key roles of AP-1 and ID1 in chemoresistance, the transcriptional regulation between ID proteins and AP-1 is of particular interest.
In this study, we report that ID1 conferred etoposide chemoresistance through inhibiting caspase 3 activity and PARP cleavage. Ablation of ID1 promoted etoposide-induced apoptosis. Mechanistically, c-Jun/c-Fos bound directly to the ID1 promoter region and activated its transcription in vivo. Ectopic expression of c-Jun/c-Fos enhanced ID1 transactivation. Conversely, knockdown of c-Jun/c-Fos inhibited ID1 transactivation. Overexpression of ID1 rescued cells from apoptosis in c-Jun/c-Fos knockdown cells. The expression level of ID1 was positively correlated with c-Jun/c-Fos in human cancers. More importantly, analysis of gene expression profiles of multiple cancer types indicated that high expression of ID1 and c-Jun or c-Fos is correlated with poor survival in cancer patients. These findings suggested that c-Jun/c-Fos was involved in chemosensitivity pathways and contributed to the regulation of ID1 in response to chemotherapeutic drug-induced apoptosis.
Materials and Methods
Cell Lines and Cell Culture Conditions
Human ESCC cell lines (KYSE series) were generous gifts from Dr. Shimada Y (Kyoto University). KYSE30, 140, 180, and 450 cell lines used in this study were originally established from primary esophageal squamous cell carcinoma tissue samples after surgery in ESCC patients, who had not received prior cytotoxic therapy, whereas KYSE150 were from patients who had received cytotoxic therapy previously (27). The cells were maintained in RPMI 1640 supplemented with 10% fetal bovine serum, 100 units/ml streptomycin, and 100 units/ml penicillin.
Patient Tissue Samples
Tissue samples from 34 patients with ESCC were used for ID1, c-Jun, and c-Fos mRNA expression analysis, and patients were consecutively recruited at the Chinese Academy of Medical Sciences Cancer Hospital (Beijing, China). At recruitment, informed consent was obtained from each subject. This study was approved by the Institutional Review Board of the Chinese Academy of Medical Sciences Cancer Institute and Hospital. A tissue microarray from 110 patients with ESCC was previously made in our lab (28).
Plasmids Construction and Site-directed Mutagenesis
Full-length cDNA of human ID1 was cloned into the mammalian expression vector pLVX. The promoter region of ID1 (−2209 to −163) was cloned into the pGL3-basic vector, designed as ID1-pro-2000. One point mutation was introduced into target site by mutagenesis PCR. The resulting construct was verified by direct sequencing. c-Jun and TAM67 expression plasmids were generated in our laboratory. c-Fos expression plasmids were provided by Dr. Marta Barbara Wisniewska (University of Warsaw, Warsaw, Poland).
Western Blot Analysis
Western blot was performed as described previously (29). The following antibodies were used: ID1, cleaved caspase 3, PARP, p53, c-Jun, and c-Fos (Santa Cruz, Delaware, CA) and β-actin (Sigma-Aldrich).
Immunohistochemistry
Immunohistochemistry were performed as described previously (30). The human ESCC tissue microarray was subjected to immunohistochemistry using antibodies against ID1 (Santa Cruz).
siRNA Transfection, RNA Isolation, and PCR Analysis
The cells were transfected with siRNAs (10 nm) by HiperFect (Qiagen) following the manufacturer's protocol. ID1 siRNA (GS3397; Qiagen), c-Jun siRNA (GS3725; Qiagen), c-Fos siRNA (GS8061; Qiagen), and negative control siRNA (1027310; Qiagen) were purchased from Qiagen. RNA purification and qRT-PCR were performed as described previously (31). The primers used are listed in Table 1.
TABLE 1.
qRT-PCR primers
| qRT-PCR primers | Sequences |
|---|---|
| ID1 mRNA forward | ACACAAGATGCGATCGTCC |
| ID1 mRNA reverse | GGAATCCGAAGTTGGAACC |
| c-Jun mRNA forward | CAACATGCTCAGGGAACAGG |
| c-Jun mRNA reverse | GTTAGCATGAGTTGGCACCC |
| c-Fos mRNA forward | TTACTACCACTCACCCGCAG |
| c-Fos mRNA reverse | AGTGACCGTGGGAATGAAGT |
| GAPDH forward | GTCGGAGTCAACGGATTTGG |
| GAPDH reverse | AAAAGCAGCCCTGGTGACC |
Chromatin Immunoprecipitation Assay and Luciferase Assay
The luciferase assay and ChIP was performed as described previously (29). The antibodies against c-Jun and c-Fos were from Beijing Golden Bridge Biotechnology Company.
Cell Proliferation Assay
The cell proliferation assay was performed as described previously (31).
Cell Apoptosis Assay
Apoptosis assay was measured using the BD FITC annexin V apoptosis detection kit (BD Biosciences) according to the manufacturer's protocol. Briefly, cells were digested with trypsin-EDTA into single-cell suspensions and then collected. The resuspended cells (1 × 105) were centrifuged at 1,000 rpm for 5 min to remove the supernatant, and the cells were resuspended in 100 μl of annexin V binding solution and transferred into a 5-ml culture tube. Annexin V-FITC (3 μl) was added to the solution and incubated at room temperature for 15 min in the dark, followed by the addition of 400 μl of annexin V binding solution, and propidium iodide (3 μl) was added for flow cytometry.
Statistical Analysis
We statistically evaluated experimental results using two independent sample t tests, a one-way analysis of variance test, and Pearson correlation analysis. Survival analysis was performed by PROGgeneV2, a web-based resource combining genomic/clinical database and analysis tools that enable single/multiple gene-based prognostic assessment (32). All tests of significance were set at p < 0.05.
Results
ID1 Expression Was Induced by Etoposide in Esophageal Cancer Cells
Previous studies indicated that ID1 was commonly up-regulated by chemotherapeutic drug treatment (18, 19). To evaluate the possible role of ID1 in ESCC, we first analyzed ID1 expression in ESCC tumor tissues and ESCC cell lines KYSE150, KYSE30, KYSE140, KYSE450, KYSE180, and KYSE410. qRT-PCR and immunohistochemistry results indicated that the expression of ID1 was high in primary ESCC tumors rather than tumor-adjacent normal tissues (Fig. 1, A and B). qRT-PCR and Western blot results showed that ID1 was low in KYSE150 and KYSE30 and moderate in KYSE140 and KYSE450 but high in KYSE180 and KYSE410 cells (Fig. 1C). To examine whether therapeutic drug influences ID1 expression, we measured the expression of ID1 in ESCC cells treated with etoposide, and a time-dependent stimulation of endogenous ID1 in different ESCC cell lines was observed (Fig. 1D). These results indicated that ID1 might play an important role in ESCC cell resistance to etoposide.
FIGURE 1.
ID1 expression was induced by etoposide in ESCC cell lines. A, up-regulated ID1 mRNA level was detected in 34 tumors compared with normal adjacent epithelia by qRT-PCR (paired t test). B, an example case showed the expression of ID1 in ESCC tumors and normal counterparts by immunohistochemistry staining on the tissue microarray (upper panels). Quantitative analysis of the ID1 staining between ESCC tissues and the matched normal esophageal epithelia is shown in the lower panel (paired t test). C, mRNA and protein level of endogenous ID1 was detected in ESCC cell lines by qRT-PCR (left panel) and Western blot (right panel). D, KYSE140, KYSE150, and KYSE450 cells were treated with 10 μm etoposide for the indicated time and harvested. ID1 expression was determined by qRT-PCR (upper panels) and Western blot (lower panels). β-Actin was used as a loading control. The data are shown as means ± S.E. from multiple independent experiments, one-way analysis of variance test. *, p < 0.05; **, p < 0.01; ***, p < 0.001.
Overexpression or Knockdown of ID1 Moderately Influences Cell Resistance to Etoposide
To evaluate the role of ID1 in response to DNA damage, we first measured IC50 values of etoposide in KYSE150, KYSE140, KYSE450, and KYSE180 ESCC cells. As shown in Fig. 2A, the IC50 values of KYSE180 and KYSE450 cells were higher than those of KYSE150 and KYSE140 cells, which might be due to increased expression of endogenous ID1. Next, we examined the effect of etoposide on KYSE150 and KYSE450 cells with ectopic expression of ID1. As shown in Fig. 2B, cell viability was significantly increased by overexpression of ID1 in response to etoposide, indicating that overexpression of ID1 enhanced cell resistance to etoposide in esophageal cancer cells. To further study whether ID1 may influence cellular chemoresistance, we measured the cell apoptosis in pLVX and pLVX-ID1 cells treated with etoposide. Overexpression of ID1 significantly reduced etoposide-induced cell apoptosis in KYSE450 cells (Fig. 2C). A previous study showed that ID1 indirectly repressed p53, which promotes chemoresistance in HCT116 cells (19). Consistent with the previous report, we also found that p53 was markedly decreased following etoposide treatment in ID1 stable transfectants, which further inhibited caspase 3 activity and PARP cleavage (Fig. 2D). Conversely, silencing of ID1 enhanced etoposide-induced apoptosis in KYSE450 cells (Fig. 2, E and F). Taken together, overexpression of ID1 could enhance cell resistance to etoposide, whereas knockdown of ID1 reduced the chemoresistance in ESCC cells.
FIGURE 2.
Overexpression of ID1 enhances cellular resistance to etoposide. A, KYSE150, KYSE140, KYSE450, and KYSE180 cells were treated with increasing concentrations of etoposide for 48 h, and then cell viability was examined by MTS assay. B, KYSE150 and KYSE450 cells stably transfected with empty vector (pLVX) or ID1 (pLVX-ID1) were incubated with DMSO (control) or etoposide (10 μm) for the indicated time, and cell growth was detected using MTS assay. The values are the means ± S.D. of absorbance at 490 nm for three independent experiments. C and D, ID1 transfectants and empty vector controls were treated with 10 μm etoposide for 48 h and then subjected to annexin V-FITC and propidium iodide (PI) staining. The values are expressed as percentages of annexin V-positive versus total cells (C). The expression levels of ID1, p53, cleaved caspase 3, and PARP were examined by Western blot (D). β-Actin was used as a loading control. E and F, KYSE450 cells were transiently transfected with negative control (NC) or ID1 siRNA, followed by 10 μm etoposide treatment. The cells were labeled with annexin V-FITC and propidium iodide and analyzed by flow cytometry. The values are expressed as percentages of annexin V-positive versus total cells (E). The expression levels of ID1, p53, cleaved caspase 3, and PARP were examined by Western blot (F). β-Actin was used as a loading control. The data are expressed as means ± S.D. *, p < 0.05; **, p < 0.01, one-way analysis of variance test.
Up-regulating ID1 upon Etoposide Activation Is Mediated through AP-1 Binding Sites
To explore whether the increase of ID1 induced by etoposide was in transcriptional or post-transcriptional regulation, we constructed the promoter of ID1 (2 kb) and transfected KYSE450 cells treated with or without etoposide to examine ID1 transcriptional activity. As shown in Fig. 3A, etoposide treatment dramatically activated the promoter of ID1 in KYSE450 cells. These data indicated that the increased expression of ID1 was due to the transcriptional activity in response to etoposide and may involve in other transcriptional factors. Previous study revealed that AP-1 regulates responsive promoter via binding to its canonical TGAG/CTCA motif or TGACGTCA boxes located in the promoter regions of the target genes (33). To further determine the direct regulation of ID1 by AP-1, we first searched for putative AP-1 binding sites on the human ID1 promoter. Remarkably, we identified one potential AP-1 binding site at −919 to −911 bp upstream of the ID1 ATG codon. Moreover, the putative TGACGTCA site is highly conserved among different species (Fig. 3B), suggesting that ID1 might be a direct target gene of c-Jun/c-Fos. To confirm whether the putative AP-1 binding site was involved in transactivation, we next used ID1 promoter reporter constructs containing either wild-type or mutant putative AP-1 binding site. These constructs were cotransfected with or without c-Jun/c-Fos, and then luciferase activity was determined. As shown in Fig. 3C, a 5-fold increase of wild-type putative AP-1 binding site cotransfected with c-Jun/c-Fos was observed, but no significant activation of the mutant was found, indicating that c-Jun/c-Fos activates ID1 through the conserved AP-1 binding site. We also observed a 2.5-fold increase of wild-type putative AP-1 binding site treated with etoposide, but no significant activation of the mutant, indicating that etoposide-induced ID1 promoter activation requires this conserved site (Fig. 3D). To further examine whether AP-1 regulates ID1 gene transcription in vivo, we performed a quantitative ChIP assay using samples with or without etoposide treatment and antibodies against c-Jun and c-Fos. The results showed that AP-1 specifically binds the promoter region encompassing the putative conserved AP-1 binding site of the ID1 gene especially after etoposide treatment. In contrast, IgG did not precipitate detectable DNA (Fig. 3E), providing additional evidence to support the active role of c-Jun/c-Fos in ID1 gene transcription in vivo.
FIGURE 3.
Up-regulating ID1 upon etoposide activation is mediated through AP-1 binding sites. A, KYSE450 cells were transiently transfected with the promoter construct of ID1 for 24 h and treated with 10 or 20 μm etoposide. After 24 h, the luciferase activity was determined and normalized to an internal cytomegalovirus Renilla luciferase control. B, comparison of nucleotide sequences among seven different species. The AP-1 DNA binding site is represented with a shaded box. * indicates the same nucleotide sequence. C, schematic representation depicts the location of the mutant variant in the 2-kb ID1 promoter. TSS stands for transcription start site (upper panel). KYSE450 cells were cotransfected with ID1 wild-type or mutant luciferase reporters, together with c-Jun/c-Fos or control vector for 24 h. Then luciferase activity was determined and normalized to an internal cytomegalovirus Renilla luciferase control. The data are shown as means ± S.E. from multiple independent experiments (lower panel). D, KYSE450 cells were transfected with ID1 promoter reporter construct containing either wild-type or mutant putative AP-1 binding site and treated with or without 10 μm etoposide, and then the luciferase activity was determined. E, KYSE450 cells were treated with 10 μm etoposide for 4 h, and then ChIP assays were carried out with antibody against c-Jun, c-Fos, or IgG. The percentages of input of coprecipitating DNAs were calculated by qRT-PCR. The data represent the means ± S.D. of triplicate experiments. *, p < 0.05; **, p < 0.01; ***, p < 0.001, one-way analysis of variance test.
The Activation of ID1 Required c-Jun and c-Fos in Response to Etoposide
Recent studies demonstrated that the aberrantly high expression of ID1 in cancers is often a consequence of transcriptional induction by many proteins that are activated in a constitutive manner (25, 26). Our previous study indicated that among the AP-1 family of transcription factors, c-Jun/AP-1 could bind and activate the expression of a series of genes in esophageal cancer cells (34, 35). Therefore, we speculated that transcriptional regulation by AP-1 might contribute to the underlying mechanism of ID1 involved in esophageal cancer cells response to etoposide. To clarify this, we examined c-Jun and c-Fos expression in KYSE450 cells treated with etoposide. qRT-PCR and Western blot results clearly showed that c-Jun/c-Fos and ID1 expression was induced by etoposide (Fig. 4, A and B), suggesting that c-Jun and c-Fos may involve in the transcription of ID1 responding to etoposide. To examine the transcriptional mechanism, we performed experiments using c-Jun, c-Fos, TAM67 expression plasmids, or c-Jun and c-Fos siRNA in KYSE450 ESCC cells. TAM67 is a dominant-negative form of c-Jun that interacts broadly with all AP-1 transcription factors to inhibit transactivation (36). As shown in Fig. 4C, ectopic expression of c-Jun/c-Fos, rather than TAM67, increased the expression of ID1 in KYSE450 cells. Moreover, compared with control groups, silencing of c-Jun/c-Fos in KYSE450 and KYSE150 cells decreased ID1 expression (Fig. 4D). These results indicated that c-Jun and c-Fos were involved in the transcriptional regulation of ID1, responding to etoposide in ESCC cells.
FIGURE 4.
The activation of ID1 required c-Jun/c-Fos in response to etoposide. A and B, KYSE450 cells were treated with 10 μm etoposide for the indicated time, and the expression of c-Jun/c-Fos and ID1 was determined by qRT-PCR (A) and Western blot (B). C, KYSE450 cells were transiently transfected with c-Jun, c-Fos, c-Jun/c-Fos, and TAM67 as described under “Experimental Procedures.” After 24 h, the expression of c-Jun, c-Fos, and ID1 was determined by qRT-PCR and Western blot. D, KYSE450 and KYSE150 cells were transiently transfected with c-Jun/c-Fos siRNA as described under “Experimental Procedures.” After 24 h, the expression of c-Jun, c-Fos, and ID1 was determined by Western blot. The data represent the means ± S.D. of triplicate experiments. NC, negative control. **, p < 0.01; ***, p < 0.001, one-way analysis of variance test.
ID1 Inhibits Etoposide-induced Cell Apoptosis in a c-Jun/c-Fos-dependent Manner in ESCC Cells
To assess whether targeting of c-Jun/c-Fos could contribute to cellular chemoresistance to etoposide, we investigated p53-mediated cell apoptosis by siRNA against c-Jun/c-Fos under the treatment of etoposide. As shown in Fig. 5A, knockdown of c-Jun/c-Fos following etoposide treatment markedly increased the expression of p53, which enhanced activity of caspase 3 and PARP cleavage. Furthermore, we used flow cytometry to investigate cell apoptosis induced by this pathway. As shown in Fig. 5B, the pLVX control group, etoposide treatment induced cell apoptosis by 5.9% in the control cells, as opposed to 19.1% in c-Jun silencing cells and 17.8% in c-Fos silencing cells. The difference is statistically significant (p < 0.01). Moreover, we rescued the expression of ID1 after ablation of c-Jun/c-Fos and then analyzed cell apoptosis under the treatment of etoposide. As shown in Fig. 5B, compared with pLVX control cells, ID1 rescued cells could dramatically reduce cell apoptosis under etoposide treatment. Taken together, these results indicated that the etoposide-induced ID1 increase was AP-1-dependent. Elimination of c-Jun/c-Fos or ID1 attenuated the effect of etoposide on the modulation of ID1 and showed the important role of the AP-1-ID1 signaling in mediating the effect of etoposide on ESCC cell apoptosis.
FIGURE 5.
ID1 inhibits etoposide-induced cell apoptosis in a c-Jun/c-Fos-dependent manner. A, KYSE450 cells were transiently transfected with either negative control (NC) or c-Jun/c-Fos siRNA as indicated. After 24 h, cells were incubated with DMSO or 10 μm etoposide. The expression of c-Jun, c-Fos, ID1, p53, cleaved caspase 3, and PARP was determined by Western blot. β-Actin was used as a loading control. B, KYSE450 cells were transiently transfected with c-Jun/c-Fos siRNA and rescued ID1 with pLVX-ID1 compared with pLVX for 24 h. After that, cells were treated with DMSO or 10 μm etoposide and then subjected to Annexin V-FITC and propidium iodide (PI) staining. The values are expressed as a percentage of annexin V-positive versus total cells. The data are expressed as means ± S.D. *, p < 0.05, one-way analysis of variance test.
Positive Correlation between c-Jun/c-Fos and ID1 in Human Cancers and Prognostic Value of High c-Jun/c-Fos and ID1 Expression for Cancer Patients Survival
To evaluate the up-regulation of c-Jun/c-Fos on ID1 expression in human cancers, we examined the mRNA levels of c-Jun/c-Fos and ID1 in diverse human tumors including ESCC, acute myeloid leukemia, ovarian cancer, and colorectal cancer. As shown in Fig. 6A, the expression of c-Jun/c-Fos and ID1 is positively correlated in ESCC. The same results were obtained in three GEO database including acute myeloid leukemia (GSE12417), ovarian cancer (GSE49997), and colorectal cancer (GSE24551). It strikingly supports a positive relationship for c-Jun/c-Fos and ID1 in cancers (Fig. 6B). To investigate the role of c-Jun/c-Fos-ID1 in cancer progression, we first analyzed clinical outcome data using PROGgeneV2 from published studies for correlations between c-Jun/c-Fos-ID1 expression levels and survival of cancer patients. Interestingly, high expression of ID1 and c-Jun or c-Fos is correlated with poor survival in cancer patients (Fig. 6B). These results indicated that concurrent high expression of c-Jun/c-Fos and ID1 may predict a poor prognosis for cancer patients.
FIGURE 6.
Positive correlation between c-Jun/c-Fos and ID1 in human cancers and prognostic value of high c-Jun/c-Fos and ID1 expression for cancer patients survive. A, a statistically significant positive correlation between c-Jun/c-Fos and ID1 mRNA was observed by Pearson's method in ESCC and patients in three independent published data sets including acute myeloid leukemia (GSE12417), ovarian cancer (GSE49997), and colorectal cancer (GSE24551), Pearson correlation analysis. B, clinical outcome data were analyzed by using PROGgeneV2 from published studies for correlations between c-Jun/c-Fos-ID1 expression levels and survival of cancer patients.
Discussion
Recently, tumor resistance to chemotherapy remains a clinical problem. Functional screens have been directed at finding novel targets affecting sensitivity to chemotherapy, but it remains unclear whether these targets have direct roles in chemoresistance or offer prognostic value to clinicians. ID1 was involved in chemoradioresistant in human cancer and was exploited as a therapeutic target (13, 16–18). Therefore, the biological functions and mechanisms of ID1 under the chemotherapeutic drug treatment need to be intensively studied.
A recent study revealed that competitive binding between ID1 and E2F1 to CDC20 regulates E2F1 degradation and thymidylate synthase expression to promote esophageal cancer chemoresistance (12). Moreover, another previous study showed that ID1 was also induced by nicotine, and ectopic expression of ID1 might enhance cell resistance to damage (13). In line with this, we found that ID1 expression was induced by etoposide in esophageal cancer cells (Fig. 1D). These results suggest that ID1 expression was induced by DNA damage response and maybe correlated with esophageal cancer chemoresistance. Moreover, we found that KYSE180, with a higher endogenous expression of ID1 than KYSE450, KYSE140, and KYSE150 cells, displays greater resistant to etoposide (Fig. 2A). Additionally, our data indicate that overexpression of ID1 can enhance cell resistance to etoposide-induced apoptosis, and knockdown of ID1 increased the percentage of the apoptosis (Fig. 2, C and E). DNA damage, such as that induced by radiation or chemotherapeutic drugs, is a potent activator of p53 (37). ID1 was interacted with p53 in DNA damage response (16, 38). Previous study showed that ID1 is an effector of the p53-dependent DNA damage response pathway, and DEC1 represses the transcription of the ID1 gene under the treatment of doxorubicin or camptothecin (38). ID1 up-regulates MDM2, a key negative regulator of p53, and promotes p53 protein degradation in human colorectal cancer cells (16). We found that up-regulation of ID1 reduced p53 expression, whereas knockdown of ID1 promoted p53-mediated caspase 3 activity and PARP cleavage under etoposide treatment (Fig. 2, D and F). However, the regulatory mechanism of ID1 induced by etoposide still remains elusive.
To explore the molecular mechanism by which the expression of ID1 might be induced with etoposide treatment in ESCC cells, we first detected that etoposide dramatically activated the promoter of ID1 (Fig. 3A), indicating that etoposide-induced ID1 expression was at the transcriptional level, which may involve in some transcriptional factors. Next, we explored which transcription factor was involved in regulating ID1 expression. With computer-aided transcription factor-binding site analysis, we identified one TGACGTCA motif, and it is highly conserved among different species (Fig. 3B). The TGACGTCA motif is one of the most common regulatory elements widely distributed in promoters or enhancers and was generally regarded as the transcription factor AP-1 family functional binding elements (33). Transcription factor AP-1 is mainly composed of Jun (c-Jun, JunB, and JunD) and Fos (c-Fos, FosB, Fra-1, and Fra-2) (20, 21). Previous study showed that AP-1 is required for cell survival and involved in multidrug resistance (22, 23). In this study, using ChIP and dual luciferase reporter assay, we show for the first time that c-Jun/c-Fos can directly bind to the ID1 promoter, thereby activating ID1 transcription and expression in vivo (Fig. 3, C and E). Moreover, we found that etoposide increased c-Jun/c-Fos and ID1 expression (Fig. 4, A and B), and ectopic expression of c-Jun or c-Fos increased ID1 expression, whereas repressed expression of c-Jun or c-Fos had the opposite effects (Fig. 4, C and D). Furthermore, we found that ID1 expression positively correlated with c-Jun/c-Fos in esophageal cancer, as well as a variety of other cancer types (Fig. 6A). These results showed that transcription factor AP-1 was involved in regulating ID1 transcription and expression in ESCC.
Apoptosis is a cellular process regulated by the balance of pro- and anti-apoptotic proteins (33, 39). Robust and persistent activation of AP-1 in cells containing damaged DNA causes defective replication and may trigger apoptosis through the same mechanisms that induce cell death after constitutive expression of oncogenes (40). Here, we showed that ablation of c-Jun/c-Fos resulted in an increase in the percentage of apoptosis (Fig. 5, A and B). Moreover, elimination of c-Jun/c-Fos with ID1 rescued cells could dramatically reduce cell apoptosis under etoposide treatment (Fig. 5B). These results suggest that ID1 inhibits etoposide-induced apoptosis in a c-Jun/c-Fos-dependent manner in human ESCC cells. However, deletion of c-Jun/c-Fos can neither completely abolish the expression of ID1 nor antagonize the effect of etoposide-induced cell apoptosis. This recalls the existence of other transcriptional factors regulating ID1 expression and other downstream targets participating in etoposide-mediated cell apoptosis.
ID1 is known to be associated positively with pathological N stage and could be considered as a prognostic predictor for stage III ESCC patients (11). ID1 and ID3 function together to govern colon cancer-initiating cell self-renewal by p21 (7). It is also known to be induced by Stat3 and then up-regulates MDM2 to promote p53 protein degradation (16). Moreover, ID1 increases thymidylate synthase dependent upon E2F1 to promote cancer chemoresistance (12). These findings indicate that ID1 expression associates with other molecular markers and may not be an independent prognostic factor. Here, we show that simultaneous high expression of ID1 and c-Jun or c-Fos is correlated with poor survival in human cancer patients (Fig. 6B) and further suggests that c-Jun/c-Fos-ID1 regulatory mechanism has clinical significance in human cancer.
Overall, our results are of significance in finding that AP-1 can transcriptionally regulate ID1 in DNA damage response, thus causing chemoresistance to therapeutic drugs in ESCC cells. ID1 expression was positively correlated with that of c-Jun and c-Fos in human cancers. More importantly, concurrent high ID1 and c-Jun/c-Fos expression in human tumors is significantly correlated with shorter survival of cancer patients. We also demonstrated the importance of c-Jun/c-Fos-ID1 signaling pathway in chemoresistance of esophageal cancer cells. This will provide an insight to target c-Jun/c-Fos-ID1 for cancer therapeutic strategies. Additionally, our results facilitate the development of innovative anti-cancer strategies and provide considerable insight into understanding the underlying molecular mechanisms in ESCC cell biology.
Author Contributions
Y. Z., S. L., and A. L. conducted most of the experiments, analyzed the results, and wrote most of the paper. Z. L. conceived the idea for the project and designed the experiments. W. Z., H. C., Y. L., and F. D. provided technical assistance and contributed to the preparation of the figures. F. H. conducted the luciferase assay. All authors reviewed the results and approved the final version of the manuscript.
Acknowledgments
We thank Dr. Shimada Y from Kyoto University for the gifts of the human ESCC cell lines (KYSE series). We also acknowledge Dr. Marta Barbara Wisniewska University of Warsaw for the gifts of c-Fos expression plasmids.
This work was supported by National Basic Research Program of China Grant 2013CB911004 and National Natural Science Foundation of China Grants 81130043, 81420108025, and 81472791. The authors declare that they have no conflicts of interest with the contents of this article.
- ESCC
- esophageal squamous cell carcinoma
- AP-1
- activator protein-1
- MTS
- 3-(4,5-dimethylthiazol-2-yl)-5(3-carboxymethonyphenol)-2-(4-sulfophenyl)-2H-tetrazolium
- qRT-PCR
- quantitative RT-PCR
- PARP
- poly(ADP-ribose) polymerase.
References
- 1. Pennathur A., Gibson M. K., Jobe B. A., and Luketich J. D. (2013) Oesophageal carcinoma. Lancet 381, 400–412 [DOI] [PubMed] [Google Scholar]
- 2. Yang H., Li X. D., Zhou Y., Ban X., Zeng T. T., Li L., Zhang B. Z., Yun J., Xie D., Guan X. Y., and Li Y. (2015) Stemness and chemotherapeutic drug resistance induced by EIF5A2 overexpression in esophageal squamous cell carcinoma. Oncotarget 6, 26079–26089 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Luo A., Chen H., Ding F., Zhang Y., Wang M., Xiao Z., and Liu Z. (2013) Small proline-rich repeat protein 3 enhances the sensitivity of esophageal cancer cells in response to DNA damage-induced apoptosis. Mol. Oncol. 7, 955–967 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Dutton S. J., Ferry D. R., Blazeby J. M., Abbas H., Dahle-Smith A., Mansoor W., Thompson J., Harrison M., Chatterjee A., Falk S., Garcia-Alonso A., Fyfe D. W., Hubner R. A., Gamble T., Peachey L., Davoudianfar M., Pearson S. R., Julier P., Jankowski J., Kerr R., and Petty R. D. (2014) Gefitinib for oesophageal cancer progressing after chemotherapy (COG): a phase 3, multicentre, double-blind, placebo-controlled randomised trial. Lancet Oncol. 15, 894–904 [DOI] [PubMed] [Google Scholar]
- 5. Zhang S., Tang W., Weng S., Liu X., Rao B., Gu J., Chen S., Wang Q., Shen X., Xue R., and Dong L. (2014) Apollon modulates chemosensitivity in human esophageal squamous cell carcinoma. Oncotarget 5, 7183–7197 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Li B., Tsao S. W., Li Y. Y., Wang X., Ling M. T., Wong Y. C., He Q. Y., and Cheung A. L. (2009) Id-1 promotes tumorigenicity and metastasis of human esophageal cancer cells through activation of PI3K/AKT signaling pathway. Int. J. Cancer 125, 2576–2585 [DOI] [PubMed] [Google Scholar]
- 7. O'Brien C. A., Kreso A., Ryan P., Hermans K. G., Gibson L., Wang Y., Tsatsanis A., Gallinger S., and Dick J. E. (2012) ID1 and ID3 regulate the self-renewal capacity of human colon cancer-initiating cells through p21. Cancer Cell 21, 777–792 [DOI] [PubMed] [Google Scholar]
- 8. Ling M. T., Wang X., Zhang X., and Wong Y. C. (2006) The multiple roles of Id-1 in cancer progression. Differentiation 74, 481–487 [DOI] [PubMed] [Google Scholar]
- 9. Ling F., Kang B., and Sun X. H. (2014) Id proteins: small molecules, mighty regulators. Curr. Top. Dev. Biol. 110, 189–216 [DOI] [PubMed] [Google Scholar]
- 10. Hu Y. C., Lam K. Y., Law S., Wong J., and Srivastava G. (2001) Profiling of differentially expressed cancer-related genes in esophageal squamous cell carcinoma (ESCC) using human cancer cDNA arrays: overexpression of oncogene MET correlates with tumor differentiation in ESCC. Clin. Cancer Res. 7, 3519–3525 [PubMed] [Google Scholar]
- 11. Liu J., Hu Y., Hu W., Xie X., Ela Bella A., and Fu J. (2010) Expression and prognostic relevance of Id1 in stage III esophageal squamous cell carcinoma. Cancer Biomark. 8, 67–72 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Li B., Xu W. W., Guan X., Qin Y. R., Law S., Lee N. P., Chan K. T., Tam P. Y., Li Y. Y., Chan K. W., Yuen H. F., Tsao S. W., He Q. Y., and Cheung A. L. (2015) Competitive binding between Id1 and E2F1 to Cdc20 regulates E2F1 degradation and thymidylate synthase expression to promote esophageal cancer chemoresistance. Clin. Cancer Res. 10.1158/1078-0432.CCR-15-1196 [DOI] [PubMed] [Google Scholar]
- 13. Treviño J. G., Pillai S., Kunigal S., Singh S., Fulp W. J., Centeno B. A., and Chellappan S. P. (2012) Nicotine induces inhibitor of differentiation-1 in a Src-dependent pathway promoting metastasis and chemoresistance in pancreatic adenocarcinoma. Neoplasia 14, 1102–1114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Yap W. N., Zaiden N., Tan Y. L., Ngoh C. P., Zhang X. W., Wong Y. C., Ling M. T., and Yap Y. L. (2010) Id1, inhibitor of differentiation, is a key protein mediating anti-tumor responses of gamma-tocotrienol in breast cancer cells. Cancer Lett. 291, 187–199 [DOI] [PubMed] [Google Scholar]
- 15. Castañon E., Bosch-Barrera J., López I., Collado V., Moreno M., López-Picazo J. M., Arbea L., Lozano M. D., Calvo A., and Gil-Bazo I. (2013) Id1 and Id3 co-expression correlates with clinical outcome in stage III-N2 non-small cell lung cancer patients treated with definitive chemoradiotherapy. J. Transl. Med. 11, 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Yu H., Yue X., Zhao Y., Li X., Wu L., Zhang C., Liu Z., Lin K., Xu-Monette Z. Y., Young K. H., Liu J., Shen Z., Feng Z., and Hu W. (2014) LIF negatively regulates tumour-suppressor p53 through Stat3/ID1/MDM2 in colorectal cancers. Nat. Commun. 5, 5218. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Li B., Tsao S. W., Chan K. W., Ludwig D. L., Novosyadlyy R., Li Y. Y., He Q. Y., and Cheung A. L. (2014) Id1-induced IGF-II and its autocrine/endocrine promotion of esophageal cancer progression and chemoresistance: implications for IGF-II and IGF-IR-targeted therapy. Clin. Cancer Res. 20, 2651–2662 [DOI] [PubMed] [Google Scholar]
- 18. Hernández-Vargas H., Ballestar E., Carmona-Saez P., von Kobbe C., Bañón-Rodríguez I., Esteller M., Moreno-Bueno G., and Palacios J. (2006) Transcriptional profiling of MCF7 breast cancer cells in response to 5-fluorouracil: relationship with cell cycle changes and apoptosis, and identification of novel targets of p53. Int. J. Cancer 119, 1164–1175 [DOI] [PubMed] [Google Scholar]
- 19. McNeely S. C., Xu X., Taylor B. F., Zacharias W., McCabe M. J. Jr., and States J. C. (2006) Exit from arsenite-induced mitotic arrest is p53 dependent. Environ. Health Perspect. 114, 1401–1406 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Hess J., Angel P., and Schorpp-Kistner M. (2004) AP-1 subunits: quarrel and harmony among siblings. J. Cell Sci. 117, 5965–5973 [DOI] [PubMed] [Google Scholar]
- 21. Subramanian D., Bunjobpol W., and Sabapathy K. (2015) Interplay between TAp73 protein and selected activator protein-1 (AP-1) family members promotes AP-1 target gene activation and cellular growth. J. Biol. Chem. 290, 18636–18649 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Sun N. K., Huang S. L., Lu H. P., Chang T. C., and Chao C. C. (2015) Integrative transcriptomics-based identification of cryptic drivers of taxol-resistance genes in ovarian carcinoma cells: analysis of the androgen receptor. Oncotarget 6, 27065–27082 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Boeckx C., Blockx L., de Beeck K. O., Limame R., Camp G. V., Peeters M., Vermorken J. B., Specenier P., Wouters A., Baay M., and Lardon F. (2015) Establishment and characterization of cetuximab resistant head and neck squamous cell carcinoma cell lines: focus on the contribution of the AP-1 transcription factor. Am. J. Cancer Res. 5, 1921–1938 [PMC free article] [PubMed] [Google Scholar]
- 24. Lasorella A., Benezra R., and Iavarone A. (2014) The ID proteins: master regulators of cancer stem cells and tumour aggressiveness. Nat. Rev. Cancer 14, 77–91 [DOI] [PubMed] [Google Scholar]
- 25. Ma J., Shi M., Li G., Wang N., Wei J., Wang T., Ma J., and Wang Y. (2013) Regulation of Id1 expression by epigallocatechin3gallate and its effect on the proliferation and apoptosis of poorly differentiated AGS gastric cancer cells. Int. J. Oncol. 43, 1052–1058 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Birkenkamp K. U., Essafi A., van der Vos K. E., da Costa M., Hui R. C., Holstege F., Koenderman L., Lam E. W., and Coffer P. J. (2007) FOXO3a induces differentiation of Bcr-Abl-transformed cells through transcriptional down-regulation of Id1. J. Biol. Chem. 282, 2211–2220 [DOI] [PubMed] [Google Scholar]
- 27. Shimada Y., Imamura M., Wagata T., Yamaguchi N., and Tobe T. (1992) Characterization of 21 newly established esophageal cancer cell lines. Cancer 69, 277–284 [DOI] [PubMed] [Google Scholar]
- 28. Chen H., Ma J., Sunkel B., Luo A., Ding F., Li Y., He H., Zhang S., Xu C., Jin Q., Wang Q., and Liu Z. (2013) S100A14: novel modulator of terminal differentiation in esophageal cancer. Mol. Cancer Res. 11, 1542–1553 [DOI] [PubMed] [Google Scholar]
- 29. He H., Li S., Chen H., Li L., Xu C., Ding F., Zhan Y., Ma J., Zhang S., Shi Y., Qu C., and Liu Z. (2014) 12-O-Tetradecanoylphorbol-13-acetate promotes breast cancer cell motility by increasing S100A14 level in a Kruppel-like transcription factor 4 (KLF4)-dependent manner. J. Biol. Chem. 289, 9089–9099 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. He H., Li S., Hong Y., Zou H., Chen H., Ding F., Wan Y., and Liu Z. (2015) Kruppel-like factor 4 promotes esophageal squamous cell carcinoma differentiation by up-regulating keratin 13 expression. J. Biol. Chem. 290, 13567–13577 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Li S., Zhou Q., He H., Zhao Y., and Liu Z. (2013) Peroxisome proliferator-activated receptor gamma agonists induce cell cycle arrest through transcriptional regulation of Kruppel-like factor 4 (KLF4). J. Biol. Chem. 288, 4076–4084 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Goswami C. P., and Nakshatri H. (2014) PROGgeneV2: enhancements on the existing database. BMC Cancer 14, 970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Shaulian E., and Karin M. (2002) AP-1 as a regulator of cell life and death. Nat. Cell Biol. 4, E131–E136 [DOI] [PubMed] [Google Scholar]
- 34. Luo A., Yu X., Li G., Ma G., Chen H., Ding F., Li Y., and Liu Z. (2014) Differentiation-associated genes regulated by c-Jun and decreased in the progression of esophageal squamous cell carcinoma. PLoS One 9, e96610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Yu X., Luo A., Zhou C., Ding F., Wu M., Zhan Q., and Liu Z. (2006) Differentiation-associated genes regulated by TPA-induced c-Jun expression via a PKC/JNK pathway in KYSE450 cells. Biochem. Biophys. Res. Commun. 342, 286–292 [DOI] [PubMed] [Google Scholar]
- 36. Wu Y., Zhang X., and Zehner Z. E. (2003) c-Jun and the dominant-negative mutant, TAM67, induce vimentin gene expression by interacting with the activator Sp1. Oncogene 22, 8891–8901 [DOI] [PubMed] [Google Scholar]
- 37. Bunz F., Hwang P. M., Torrance C., Waldman T., Zhang Y., Dillehay L., Williams J., Lengauer C., Kinzler K. W., and Vogelstein B. (1999) Disruption of p53 in human cancer cells alters the responses to therapeutic agents. J. Clin. Invest. 104, 263–269 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Qian Y., and Chen X. (2008) ID1, inhibitor of differentiation/DNA binding, is an effector of the p53-dependent DNA damage response pathway. J. Biol. Chem. 283, 22410–22416 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. di Pietro A., Koster R., Boersma-van Eck W., Dam W. A., Mulder N. H., Gietema J. A., de Vries E. G., and de Jong S. (2012) Pro- and anti-apoptotic effects of p53 in cisplatin-treated human testicular cancer are cell context-dependent. Cell Cycle 11, 4552–4562 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Zhang X., Huang X., and Olumi A. F. (2009) Repression of NF-κB and activation of AP-1 enhance apoptosis in prostate cancer cells. Int. J. Cancer 124, 1980–1989 [DOI] [PMC free article] [PubMed] [Google Scholar]






