Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2016 Feb 8;291(13):7060–7069. doi: 10.1074/jbc.M115.707430

Central Role of Pyruvate Kinase in Carbon Co-catabolism of Mycobacterium tuberculosis*

Tahel Noy ‡, Olivia Vergnolle ‡, Travis E Hartman §, Kyu Y Rhee §, William R Jacobs Jr ¶,‖, Michael Berney ‖,1, John S Blanchard ‡,2
PMCID: PMC4807288  PMID: 26858255

Abstract

Mycobacterium tuberculosis (Mtb) displays a high degree of metabolic plasticity to adapt to challenging host environments. Genetic evidence suggests that Mtb relies mainly on fatty acid catabolism in the host. However, Mtb also maintains a functional glycolytic pathway and its role in the cellular metabolism of Mtb has yet to be understood. Pyruvate kinase catalyzes the last and rate-limiting step in glycolysis and the Mtb genome harbors one putative pyruvate kinase (pykA, Rv1617). Here we show that pykA encodes an active pyruvate kinase that is allosterically activated by glucose 6-phosphate (Glc-6-P) and adenosine monophosphate (AMP). Deletion of pykA prevents Mtb growth in the presence of fermentable carbon sources and has a cidal effect in the presence of glucose that correlates with elevated levels of the toxic catabolite methylglyoxal. Growth attenuation was also observed in media containing a combination of short chain fatty acids and glucose and surprisingly, in media containing odd and even chain fatty acids alone. Untargeted high sensitivity metabolomics revealed that inactivation of pyruvate kinase leads to accumulation of phosphoenolpyruvate (P-enolpyruvate), citrate, and aconitate, which was consistent with allosteric inhibition of isocitrate dehydrogenase by P-enolpyruvate. This metabolic block could be relieved by addition of the α-ketoglutarate precursor glutamate. Taken together, our study identifies an essential role of pyruvate kinase in preventing metabolic block during carbon co-catabolism in Mtb.

Keywords: allosteric regulation, bacterial metabolism, fatty acid metabolism, microbial pathogenesis, Mycobacterium tuberculosis, pyruvate kinase, tricarboxylic acid cycle (TCA cycle) (Krebs cycle)

Introduction

Mycobacterium tuberculosis (Mtb)3 pathogenesis has been studied for decades, however, our knowledge concerning the metabolism and physiology of the bacterium during host infection is still limited (1–4). Specifically, we lack understanding of nutrient availability in the host microenvironments during the different phases of infection and consequently, which nutrients (e.g. carbon and nitrogen sources) are used by the bacterium for growth and maintenance of replicative and non-replicative states (5). In vitro evidence suggests that Mtb does not utilize carbon catabolite repression, a regulatory mechanism that allows bacteria and single-cell eukaryotes to gain growth advantage through prioritized metabolism of one carbon source over the other (6), but rather co-catabolizes multiple carbon sources at once (4). Several lines of evidence suggest that Mtb relies mainly on fatty acid metabolism in the non-replicative state within the host (1, 7–12). During growth on fatty acids Mtb bypasses the carbon dioxide releasing steps of the TCA cycle by running the glyoxylate shunt to conserve carbon (4). Nevertheless, Mtb maintains a functional and intact glycolytic pathway, suggesting that glycolysis plays a role under certain in vivo conditions. Recent studies with the adenosine triphosphate (ATP) synthase inhibitor, Bedaquiline, showed a delayed cidal effect when Mtb was grown on fermentable carbon sources (13), suggesting that Mtb can produce ATP through substrate level phosphorylation when oxidative-phosphorylation is limited. However, studies in mice with Mtb strains containing knockouts of glycolytic enzymes did not result in strong attenuation, thus leaving the role of glucose metabolism in the virulence and physiology of Mtb unclear (14, 15).

Pyruvate kinase (PK) catalyzes the final step in glycolysis in which phosphoenolpyruvate (P-enolpyruvate) and adenosine diphosphate (ADP) are converted to pyruvate and ATP. The product, pyruvate, is then used to prime the tricarboxylic acid (TCA) cycle with carbon metabolites. PK is one of the rate-limiting steps of glycolysis, thus potentially controlling the flux through and out of glycolysis (16). In many organisms, PK is a crucial point for regulating the switch between glycolysis and gluconeogenesis, serving to prevent a futile cycle between glycolysis and gluconeogenesis (17–22). In humans, during tumor development, proliferating malignant cells up-regulate the expression of a less active PK, PKM2, which leads to the accumulation of upstream glycolytic metabolites that serve as precursors for the synthesis of phospholipids and nucleotides needed for the replicating cells (23). In bacteria, inhibitors designed against PK from Staphylococus aureus showed bacteriocidal effects against methicillin-resistant S. aureus (MRSA) strains and a wide range of both Gram-positive and Gram-negative bacteria, thus suggesting PK as a potential antibacterial drug target (24).

In most studied organisms, PK activity is regulated by the upper glycolysis metabolite, fructose 1,6-bisphosphate (25–27). Through this feed-forward activation mechanism of PK, the rates of upper glycolysis, the ATP investing steps, and lower glycolysis, ATP producing steps, are balanced (28). This balance allows for the net production of 2 ATP and 1 nicotinamide adenine dinucleotide (NADH) molecules per molecule of glucose metabolized during glycolysis. The feed-forward activation of PK prevents the accumulation of intermediate glycolytic metabolites, which can undergo unfavorable, non-enzymatic side reactions, resulting in the production of toxic metabolites such as methylglyoxal (MG) (29, 30).

Despite its importance for the metabolism of different organisms, PK had been thought to be dispensable for Mtb due to several observations. First, Mycobacterium bovis, the causative agent of bovine tuberculosis, contains an inactive PK enzyme, and thus lacks the ability to metabolize fermentable carbon sources (31). Second, gluconeogenesis through the combined reaction of pyruvate carboxylase and phosphoenolpyruvate carboxykinase (PEPCK) was shown to be essential for survival of Mtb in mice, indicating that glycolytic substrates cannot be scavenged from this host (1).

Over the past few years, a limited number of studies have aimed at describing the role of PK in the physiology of Mtb. Kearing et al. (32) showed that complementing H37Rv with the M. bovis pykA gene yielded a strain whose colony morphology resembled that of M. bovis. Chavadi et al. (31) demonstrated that H37Rv ΔpykA up-regulated the expression of genes that are involved in fatty acid β-oxidation, suggesting that in the absence of PK, Mtb utilizes fatty acids as energy source. However, neither of these studies described the activity or potential role of PK in the global context of Mtb metabolism.

In this study we used biochemical and genetic approaches to define the role of PK and glycolysis in the metabolism of Mtb. We show that pykA encodes an active pyruvate kinase, which is subjected to allosteric regulation by the upstream glycolytic intermediate glucose 6-phosphate. We demonstrate that PK is essential for metabolism of glucose as a sole carbon source, for co-metabolism of glucose in combination with other carbon sources, and for odd-chain fatty acid metabolism. Finally, we present evidence that PK is important to control the levels of MG and activity of isocitrate dehydrogenase.

Experimental Procedures

Materials

All chemicals were purchased from Sigma.

Expression and Purification of Mtb PK

The pykA gene (Rv1617) was PCR amplified from Mtb H37Rv genomic DNA using primers PK_Rv_ XhoI (GAACTCGAGTCAGACGTCATCTTCCCCGATGCG) and PK_Fw_NdeI (GGGTTAATTCCATATGACGAGACGCGGGAAAATCGC) and cloned into pET28 plasmid and transformed into T7 express Escherichia coli cells (Invitrogen). A single colony was selected, grown in 25 ml of LB medium supplemented with 30 μg/ml of kanamycin. These cells were used to inoculate 6 liters of the same media. The cells were grown to mid-log phase (A600 = 0.6) at 37 °C, induced by the addition of 1 mm isopropyl β-d-1-thiogalactopyranoside and cultured for 18 h at 18 °C. The cells were harvested by centrifugation and the pellet was resuspended in buffer containing 50 mm sodium phosphate buffer, pH 8.0, containing 300 mm NaCl (buffer A). The cells were lysed in an EmulsiFlex-C3 homogenizer (Avestin) and centrifuged for 1 h at 38,000 × g. The supernatant was loaded onto a nickel-nitrilotriacetic acid column (Qiagen) pre-equilibrated with buffer A. The unbound proteins were eluted with 5 column volumes of 10 mm imidazole in buffer A, and eluted with a 20 column volume linear imidazole gradient, from 10 to 250 mm imidazole. The N-terminal His6 tag was removed by overnight thrombin cleavage in 100 mm HEPES, pH 8.0, containing 100 mm KCl and 10 mm CaCl2 followed by size exclusion chromatography using Supedex200 (GE Healthcare). Fractions containing pure PK were identified by SDS-PAGE followed by Coomassie Blue staining. Fractions were pooled and dialyzed against 100 mm HEPES, pH 7.5, containing 100 mm KCl, followed by concentration with an Amicon concentrator (Millipore) with a 30-kDa cutoff.

Enzyme Activity Assay

Initial velocities of the PK reaction were assayed spectrophotometrically by coupling the formation of pyruvate from P-enolpyruvate and ADP to the reaction of lactate dehydrogenase following the decrease in absorbance of NADH at 340 nm (ϵ340 = 6220 m−1 cm−1). All reactions were performed at 25 °C using a Shimadzu UV-2450 spectrophotometer. A typical reaction mixture contained 100 mm HEPES, pH 7.5, 100 mm KCl, 20 mm MgCl2, 0.1 mm NADH, pyruvate kinase, 6 units of lactate dehydrogenase, PK at a final concentration of 25 nm, and variable concentrations of the substrates: P-enolpyruvate and ADP. The reaction mixtures were incubated for 1 min at room temperature and initiated by the addition of P-enolpyruvate. Reactions were followed for 3–5 min and reaction velocities were calculated assuming 1 molecule NADH was oxidized for each pyruvate molecule formed. The activity of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was measured spectrophotometrically by monitoring the conversion of NAD+ to NADH at 340 nm. Reactions were conducted in 100 mm HEPES, pH 8, including substrates NAD+, Na2AsO4, and varying concentrations of Glc-3-P in a total volume of 0.5 ml. The activity of ICDH was measured by following the conversion of oxidized nicotinamide adenine dinucleotide phosphate (NADP+) to NADPH at 340 nm. A typical reaction was carried out in 100 mm HEPES, pH 7.5, containing 5 mm MnCl2, and varying amounts of isocitrate and fixed concentrations of NADP+, in a final reaction volume of 0.5 ml.

Data Analysis

The kinetic parameters for ADP were determined by fitting the initial velocity data for each concentration to Equation 1 using GraphPad 6.

graphic file with name zbc01316-4081-m01.jpg

The kinetic parameters for P-enolpyruvate were determined by fitting the initial velocities data for each concentration to Equation 2 using GraphPad 6.

graphic file with name zbc01316-4081-m02.jpg

Where v is velocity, V is maximal velocity, A is substrate concentration, K0.5 is Khalf, K is the Michaelis constant, and H is the hill constant.

Bacterial Strains and Growth Conditions

The bacterial strains used in this study are listed in Table 1. Mtb mc26230 and CDC1551 were grown in modified Hartmans de Bondt (HdB) minimal medium (33) supplemented with the relevant carbon sources. When fatty acids were used as carbon sources (propionate, butyrate) media were supplemented with 10 μg/ml of vitamin B12. Selective media plates consisted of Middlebrook 7H9 supplemented with 5 g/liter of bovine serum albumin (BSA), 0.05 g/liter of oleic acid, 0.004 g/liter of catalase, 0.85 g/liter of NaCl, 40 mm pyruvate, 50 μg/ml of pantothenic acid, and either 75 μg/ml of hygromycin or 20 μg/ml of kanamycin. The gene pykA (Rv1617) was deleted by specialized transduction as described previously (34) and confirmed by PCR using primers Rv1617R (CGTCCCAACCTGATCTTC), Rv1617L (GCTGATATTGACCGACAAAG) and a universal uptag (GATGTCTCACTGAGGTCTCT. ΔpykA was complemented with the plasmid pMV306 (35) harboring a copy of pykA and 500 bp of upstream sequence containing the native promoter of the gene using primers Fw_PK_HindIII (AGCTAAGCTTGCTAGCGGGCGTCAACG) and Rv_PK_XbaI (CTAGTCTAGACTAGACGTCATCTTCCCCG).

TABLE 1.

Strains used in this study

Strain number M. tuberculosis parent Genotype How constructed Source
mc22 H37Rv Wild type
mc26230 H37Rv RD1 ΔpanCD Ref 57<zrefx
mc27887 H37Rv RD1 ΔpanCD ΔpykA::hyg Specialized transduction of mc26230 with phAEΔpykA This work
mc27888 H37Rv RD1 ΔpanCD ΔpykA::hyg attBL5::pYUB1951 ( = pMV306::pykA) Transformation of mc27887 with pMV306::pykA This work
mc22600 CDC1551 Wild type
mc27490 CDC1551 ΔpykA::hyg Specialized transduction of mc22600 with phAEΔpykA This work
mc27497 CDC1551 ΔpykA::hyg attBL5::pYUB1951 ( = pMV306::pykA) Transformation of mc27490 with pMV306::pykA This work
Metabolic Profiling

Cells were grown in HdB supplemented with either 10 mm glucose or 30 mm acetate. Metabolite extraction was performed as described previously (36). Briefly, 5 ml of cell culture was grown to A0.5 and quenched in 10 ml of 100% methanol at 4 °C, spun down, and re-suspended in acetonitrile:methanol:water (2:2:1). Cells were lysed mechanically by using a bead-beater (MP Biomedicals), spun down, and metabolites were removed and filtered. Metabolite content was analyzed by UPLC-coupled mass spectrometry (Waters, Manchester, UK). Untargeted metabolomics was conducted as described (4).

Methylglyoxal Analysis

Cells were grown to mid-log phase in HdB supplemented with 5 mm glucose and either 15 mm acetate or 10 mm pyruvate. Metabolites were extracted and methylglyoxal was derivatized as previously described (37). Samples were analyzed by UPLC-coupled mass spectrometry.

Glucose Killing Assay

Cells were grown on HdB supplemented with 30 mm acetate until early log phase (A600 = 0.2). Cells were washed and inoculated into HdB media or HdB supplemented with either 10 mm glucose or 30 mm acetate to a final concentration of 1 × 106 cells/ml. Cells were sampled on days 0 and 14 for cfu count and plated on agar plates containing Middlebrook 7H9 supplemented with 15 g/liter of agar, 5 g/liter of BSA, 0.05 g/liter of oleic acid, 0.004 g/liter of catalase, 0.85 g/liter of NaCl, and 40 mm pyruvate.

Mouse Experiments

Female SCID mice and female C57BL/6 mice (Jackson Laboratories) were infected via the aerosol route using a 1 × 107 cfu/ml of mycobacterial suspension in PBS containing 0.05% tyloxapol and 0.04% antifoam. This yielded ∼100 bacilli/lung as determined by a 24-h harvest of four mice per group. Subsequently, four mice from each group were sacrificed at days 1, 21, 56, and 112 to determine the bacterial burden in the lungs. SCID mice were kept for survival experiments. All mice infected with Mtb were maintained under appropriate conditions in an animal biosafety level 3 laboratory. Mouse protocols used in this work were approved by the Institutional Animal Care and Use Committee of Albert Einstein College of Medicine.

Ethics Statement

Mouse studies were performed in accordance to National Institutes of Health guidelines using recommendations in the Guide for the Care and Use of Laboratory Animals. The protocols used in this study were approved by the Institutional Animal Care and Use Committee of Albert Einstein College of Medicine (protocol 20120114).

Results

Pyruvate Kinase Activity Does Not Change in Acetate- or Glucose-fed Cultures

Pyruvate kinase has been shown to modulate flux through glycolysis in many different organisms, thus controlling the accumulation of glycolytic intermediates that are essential for cellular replication (22, 23, 25). As a glycolytic enzyme, the activity of PK is expected to be lower in the presence of a gluconeogenic carbon source to prevent a futile cycle between the glycolytic and gluconeogenic pathways (17–22). We tested if PK activity in Mtb is carbon source-dependent. Mtb was grown in HdB minimal medium containing acetate or glucose as the sole source of carbon. An enzymatically active cell lysate was prepared and the activity of different enzymes was tested. Surprisingly, PK activity was not altered in the acetate or the glucose-fed cell lysates (Table 2). Similarly, the activity of GAPDH and ICDH were unchanged in the acetate-fed and glucose-fed lysates (Table 2). This result demonstrates that PK is expressed and active regardless of the carbon source, suggesting that PK activity is necessary for carbon metabolism of fermentable and non-fermentable carbon sources.

TABLE 2.

Kinetic parameters different enzymes in whole cell lysate of acetate- or glucose-fed cultures

Enzyme Acetate
Glucose
Km Vmax Km Vmax
mm mm mg−1 protein−1 mm mm mg−1 protein−1
PKa 0.032 ± 0.001 0.062 ± 0.001 0.031 ± 0.003 0.065 ± 0.003
ICDHb 0.15 ± 0.01 0.10 ± 0.01 0.13 ± 0.03 0.11 ± 0.01
GAPDHc 0.89 ± 0.15 0.09 ± 0.01 0.83 ± 0.2 0.07 ± 0.006

a Activity of PK in the presence of 5 mm ADP and 0.02–0.8 mm PEP.

b Activity of GAPDH in the presence of 0.5 mm NAD+, 10 mm Na2AsO4, and 0.2–4 mm Glc-3-P.

c Activity of ICDH in the presence of 1 mm NADH and 0.005–0.1 mm isocitrate.

Mtb PK Is Allosterically Activated by Glucose 6-Phosphate and AMP

Next we assessed if PK is allosterically regulated by intermediates of glycolysis. The most common metabolite that activates PK in other organisms is fructose 1,6-bisphosphate. Fructose 1,6-bisphosphate enhances the flux through glycolysis, and increases glucose uptake and catabolism (24, 25, 38). To measure the potential allosteric regulation of PK in Mtb we cloned, expressed, and purified PKMTB in E. coli, and measured the kinetic parameters of the enzyme. When the enzyme was assayed at saturating concentrations of P-enolpyruvate and varying concentrations of ADP, it showed hyperbolic Michaelis-Menten kinetics (Fig. 1A). The data were fitted to Equation 1 and yielded KmADP = 0.81 ± 0.10 mm and Vmax = 54 ± 3 s−1. When assayed at saturating concentrations of ADP and varying concentrations of P-enolpyruvate (PEP) the enzyme exhibited sigmoidal kinetics (Fig. 1B). The data were fitted to Equation 2 and yielded KmPEP = 1.0 ± 0.1 mm and Vmax = 63 ± 4 s−1 with nH = 2.04 ± 0.4.

FIGURE 1.

FIGURE 1.

Activation of PK by allosteric effectors. A, activity of PK in the presence of 5 mm P-enolpyruvate (PEP) and 0.02–5.2 mm ADP. B, activity of Mtb PK alone (circles) with 0.5 mm Glc-6-P (squares) or 2 mm AMP (triangles) in the presence of 5 mm ADP and 2.5 nm PK. C, activation of PK by Glc-6-P in the presence of 5 mm ADP, 0.4 mm P-enolpyruvate, 2.5 nm PK, and 0–4 mm Glc-6-P. D, activation of PK by AMP in the presence of 5 mm ADP, 0.4 mm P-enolpyruvate, 2.5 nm PK, and 0–4 mm AMP. E, metabolic profile of Mtb grown in HdB with glucose (black bars) or acetate (green bars) as a sole source of carbon. n = 6, statistical significance was determined by t test. * represents p value < 0.005.

The sigmoidal kinetics in the presence of increasing concentrations of P-enolpyruvate suggested that PK is subjected to allosteric regulation. However, neither fructose 1,6-bisphosphate nor ribose 5-phosphate activated the rate, nor changed the sigmoidal kinetics when P-enolpyruvate was the variable substrate (data not shown). Instead we found that AMP or Glc-6-P were able to activate PK 3.6- and 4.7-fold, respectively (Fig. 1, C and D), thus establishing Glc-6-P and AMP as allosteric activators of Mtb PK.

The results above suggest that Glc-6-P reports on the presence of glucose in the media and activates PK in a feed-forward manner. As a physiologically relevant allosteric activator, one would expect Glc-6-P to increase in the presence of glucose and decrease in the presence of acetate. This was shown in a previous study by stable isotope labeling and metabolic flux analysis (4). In the present study, Glc-6-P levels were 5-fold higher in cells grown on glucose compared with acetate, whereas the levels of other metabolites did not change significantly (Fig. 1E).

PK Is Necessary for Optimal Carbon Co-catabolism

To further study the role of PK in Mtb metabolism, a knock-out strain lacking the pykA gene (ΔpykA) was generated by specialized transduction (34) and genetically complemented by an integrative plasmid harboring pykA with its native promoter (Mtb ΔpykAcomp). Next, we tested the ability of the Mtb ΔpykA strain to grow on minimal media containing the fermentable carbon sources glucose and glycerol as well as the non-fermentable substrates pyruvate and acetate (Fig. 2). As expected, ΔpykA failed to grow in media containing glucose and glycerol (Fig. 2, A and B) but was able to grow on acetate and pyruvate at a rate comparable with the WT (Fig. 2, C and D). The similar activity of glycolytic and TCA cycle enzymes in Mtb grown on fermentable and non-fermentable carbon sources (Table 2) indicated that Mtb metabolism is constitutively primed for carbon co-catabolism. To test this hypothesis we grew ΔpykA on mixed carbon sources. The mutant grew slower than the WT or complemented strain in media containing a mixture of glucose and pyruvate (Fig. 2E), and demonstrated a severely attenuated growth rate on glucose and acetate containing medium (Fig. 2F). Growth in a medium containing acetate and pyruvate was not affected (Fig. 2G). These findings demonstrate that PK is essential for carbon co-catabolism in Mtb, and revealed that the impaired growth rate does not arise from the lack of PK produced pyruvate, but rather from the presence of glucose in the medium.

FIGURE 2.

FIGURE 2.

Growth curves of WT (black), ΔpykA (red), and ΔpykAcomp (blue), in the presence of (A) glucose, (B) glycerol, (C) acetate, (D) pyruvate, (E) glucose + pyruvate, (F) glucose + acetate and (G) acetate + pyruvate. Error bars represent standard deviations from 3 biological replicates. OD measurement were stopped when cultures started to clump. Ace, acetate; pyr, pyruvate; gly, glycerol; glu, glucose.

PK Prevents Accumulation of Toxic Methylglyoxal in the Presence of Glucose

Next we assessed glucose toxicity in the pykA mutant by measuring cell survival by colony forming units after 14 days exposure to either glucose or acetate, or in the absence of a carbon source. In the presence of glucose, the viability of the Mtb ΔpykA strain dropped 100-fold, but stayed constant when no carbon source was added (Fig. 3A). It has previously been suggested that one potential mechanism behind glucose toxicity relies on the accumulation of phosphorylated hexoses and trioses that give rise to the spontaneous side reactions that generate MG (3, 29). We compared the levels of MG in WT and mutant strains when grown on a medium containing glucose and acetate. MG levels were 3.5–4 times higher in the ΔpykA strain compared with the WT (Fig. 3B). This result suggests that PK influences the concentrations of upstream triose phosphates that can spontaneously degrade to MG, producing a toxic electrophilic species.

FIGURE 3.

FIGURE 3.

A, cfu count of ΔpykA grown on acetate (light green), glucose (black), or no carbon (dark green). B, methylglyoxal quantification of WT, ΔpykA, and ΔpykAcomp grown HdB supplemented with glucose and acetate. n = 3, significance was determined by t test, * represents p value < 0.005.

Pyruvate Kinase Is Essential for Growth of Mtb on Propionate or Butyrate as Sole Carbon Sources

Mtb relies on fatty acid catabolism during persistence (1, 7–12), hence we investigated if inactivation of PykA would affect the ability of Mtb to grow on short chain fatty acids. To do so, WT, ΔpykA, and ΔpykAcomp were grown in HdB medium supplemented with either butyrate (an even-chain fatty acid) or propionate (odd-chain fatty acids), or a combination of glucose with either of the fatty acids (Fig. 4). Mtb ΔpykA failed to grow in the combination of any short chain fatty acid with glucose (Fig. 4, A and B). Surprisingly, ΔpykA growth was also severely attenuated on HdB containing propionate (Fig. 4C) and failed to grow in the presence of butyrate (Figs. 4D), even though all fatty acid containing media were supplemented with 10 μg/ml of vitamin B12. Catabolism of odd-chain fatty acids results in the production of the toxic metabolite propionyl-CoA, which can be detoxified by the B12-dependent methylmalonyl pathway (39, 40). Hence, our results indicate that PK is essential for co-metabolism of glucose and short chain fatty acids, and essential for the metabolism of short chain fatty acids alone. This also suggested that inactivation of PK elicits a metabolic block beyond the accumulation of toxic glycolytic substrates. To address this hypothesis, we performed untargeted metabolomics on WT, ΔpykA, and ΔpykAcomp strains grown in minimal medium containing acetate or a combination of acetate and glucose. The ΔpykA strain accumulated P-enolpyruvate under both conditions compared with the WT strain, but P-enolpyruvate levels were substantially higher when the ΔpykA strain was grown in the presence of glucose in the media (Fig. 5). Surprisingly, the ΔpykA strain also accumulated high levels of citrate and aconitate, which pointed to an inhibition of ICDH activity in the ΔpykA strain. In fact, it has been shown that P-enolpyruvate inhibits ICDH in E. coli (41) enabling feed-forward control of metabolic flux through the TCA cycle and glyoxylate shunt based on the activity of glycolysis. Therefore, we measured the activity of ICDH in Mtb whole cell lysates in the presence and absence of 10 mm P-enolpyruvate. We observed a 10-fold increase in the Km value of ICDH toward isocitrate in the presence of P-enolpyruvate (Fig. 6A), indicating that P-enolpyruvate inhibits ICDH in Mtb lysates. The metabolic block at ICDH depletes the cell of α-ketoglutarate and the addition of this metabolite should rescue the pykA strain for growth on fatty acids. Because Mtb efficiently transports and converts glutamate to α-ketoglutarate (42) we added glutamate (0.5 g/liter) to the medium. Consistent with our hypothesis, glutamate rescued Mtb growth on propionate and butyrate (Fig. 6, B and C).

FIGURE 4.

FIGURE 4.

Growth curves of WT (black), ΔpykA (red), and ΔpykAcomp (blue) in the presence of (A) glucose + propionate, (B) glucose + butyrate, (C) propionate, and (D) butyrate. Error bars represent standard deviations from 3 biological replicates. C3, propionate; C4, butyrate.

FIGURE 5.

FIGURE 5.

Metabolic profiling of WT (black), ΔpykA (red), and ΔpykAcomp (blue) growing in HdB solid media supplemented with acetate or a combination of acetate and glucose. n = 3, significance was tested by using t test. * represents p value < 0.005.

FIGURE 6.

FIGURE 6.

Upper panel: A, ICDH activity in whole cell lysate in the presence (triangles) or absence (circles) of 10 mm P-enolpyruvate (PEP). Data were fitted to Equation 1 to obtain Km values of 0.027 and 0.190 mm in the absence and presence of P-enolpyruvate, respectively. kcat values were 0.008 and 0.0125 mm min−1 mg of protein−1 in the absence or presence of P-enolpyruvate, respectively. Lower panel: growth curves of WT (black), ΔpykA (red), and ΔpykAcomp (blue) in the presence of propionate + glutamate or butyrate + glutamate (C). Error bars represent standard deviations from 3 biological replicates. C3, propionate; C4, butyrate; glut, glutamate.

Pyruvate Kinase Is Not Essential for Mtb Infection in a Mouse Model

The inability of ΔpykA to efficiently co-catabolize fermentable and non-fermentable carbon sources as well as the absence of growth on short chain fatty acids pointed to a potential role of PK for survival in vivo. We tested Mtb ΔpykA for its ability to proliferate and survive in immunocompetent (C57BL/6) or immunocompromised (SCID) mice. Mice were infected with Mtb CDC1551, Mtb ΔpykA, and Mtb ΔpykAcomp via the aerosol route with ∼100 bacteria per lungs to mimic the natural route of infection. Bacterial burdens in lungs from C57BL/6 mice were determined 1, 3, 8, and 16 weeks after infection (4 mice per group and time point), whereas SCID mice were left to determine mouse survival. No significant difference in bacterial lung burden between the different strains could be observed throughout the experiment (Fig. 7). However, SCID mice infected with the ΔpykA strain died significantly faster (10 days difference) than mice infected with WT or complemented strains (Fig. 7).

FIGURE 7.

FIGURE 7.

A, survival plot of SCID mice infected with low dose aerosol of CDC 1551 (black), ΔpykA (red), and ΔpykAcomp (blue). SCID mouse survival was significantly different between ΔpykA and CDC 1551 or complemented strain (p value < 0.01, Gehan-Breslow-Wilcoxon test). B, lung burden of CDC 1551, ΔpykA, and ΔpykAcomp in C57BL/6 mice infected with low dose aerosol.

Discussion

The metabolic strategies used by Mtb to survive in the host are not well understood. Evidence exists that the diet of Mtb consist primarily of host lipids and fatty acids, however, this obligate intracellular pathogen has retained its ability to grow on sugars and readily co-catabolizes fermentable and non-fermentable carbon sources due to the absence of carbon catabolite repression (4). Our data demonstrate that regardless of the type of carbon source present in the media (glycolytic or gluconeogenic), the activities of PK, ICDH, and GAPDH remain unchanged, which argues that Mtb is constantly primed for carbon co-catabolism. However, this brings higher energetic costs for the cell due to a potential futile cycle between glycolytic and gluconeogenic enzymes and may explain why the growth rate of Mtb is so similar on fermentable and non-fermentable carbon sources. In the absence of carbon catabolite repression, other regulatory mechanisms, like allostery, are likely to play a more prominent role in the control of carbon metabolism in Mtb. Our results show that PK is allosterically regulated by Glc-6-P and AMP in a feed-forward fashion. As expected, Glc-6-P levels were higher in glucose grown cells than in acetate grown cells, which is consistent with previously published data (4). Rapid activation of glycolytic flux could be particularly important in situations where rapid reduction of sugar phosphate levels is needed to prevent accumulation of toxic intermediates such as methylglyoxal (29, 43), and to balance the ATP investing steps of upper glycolysis to ATP producing steps in lower glycolysis (44).

Genetic and metabolic studies indicate that Mtb is able to substitute the conversion of P-enolpyruvate to pyruvate by the reversible reaction of pyruvate phosphate dikinase (45) or via a combination of PEPCK and pyruvate carboxylase that can catalyze the conversion of P-enolpyruvate to oxaloacetate and then pyruvate (46). However, deletion of pykA rendered Mtb unable to grow on glucose or combinations of fatty acids and glucose, which argues that the proposed pathways could not complement for the loss of PK under these conditions. This stands in contrast to the model bacterium E. coli where PK-deficient mutants can still grow on glucose due to the activities of PEPCK and pyruvate carboxylase albeit at a reduced growth rate (47, 48). A metabolic block at the level of PK in the presence of glucose is likely to increase the levels of the triose phosphates that covert to the toxic electrophile MG via a non-enzymatic reaction. Consistent with this mechanism, glucose was bactericidal for Mtb ΔpykA and correlated with the accumulation of MG.

Previous studies with a phosphofructokinase A knock-out strain of Mtb showed glucose toxicity under hypoxic but not aerobic conditions (15). The difference in phenotype may arise from the position of the two enzymes in the glycolytic pathway. As an upper glycolytic enzyme, deletion of phosphofructokinase A will result in accumulation of hexose phosphates that can be shunted through the pentose phosphate pathway to support nucleic acid and cell wall biosynthesis during replication under aerobic conditions (23, 49). In contrast to phosphofructokinase A, PK is a lower glycolysis enzyme, whose deletion will result in no net ATP production from glycolysis and non-enzymatic production of MG derived from triose phosphates accumulation (50).

The ΔpykA strain demonstrated an attenuated growth rate in the presence of glucose and additional carbon sources, suggesting that the lack of PK affects the ability of the bacteria to co-catabolize different carbon sources. However, the growth phenotype was not identical between the combinations of glucose with either acetate or pyruvate. The ΔpykA strain demonstrated substantial growth attenuation in the presence of glucose and acetate compared with glucose and pyruvate, indicating that pyruvate can partially rescue the growth phenotype. Pyruvate metabolism can proceed in Mtb via either lactate dehydrogenase, pyruvate dehydrogenase, or the reductive branch of the TCA cycle. Reduction of pyruvate via these pathways regenerates NAD+ molecules that were consumed in glycolysis and the TCA cycle, and helps in refueling these pathways. This cannot be achieved when the culture is supplemented with acetate, because it enters the TCA cycle through AcCoA, and requires NAD+ for its catabolism (51, 52).

The inability of the ΔpykA strain to grow on short chain fatty acids pointed to an additional metabolic block beyond the glucose toxicity effects described above. This observation could be explained by an accumulation of P-enolpyruvate that inhibits the activity of ICDH and leads to depletion of α-ketoglutarate, thus preventing an efficient flux through the TCA cycle. Reduced flux through the TCA cycle slows down anabolic reactions and energy production. Addition of the α-ketoglutarate precursor glutamate relieved this metabolic block, revealing an important role for glutamate in maintaining efficient flux through the TCA cycle during growth on fatty acids.

Despite the essential role of PK in carbon co-catabolism and fatty acid catabolism, we did not observe a difference in the mutants ability to replicate and persist in immunocompetent mice. However, the mutant was slightly more virulent than WT and the complemented strain in this experiment. Interestingly, M. bovis, a strain that naturally lacks pyruvate kinase activity is much more virulent than its Mtb relatives in mouse models (53). These results imply that pyruvate kinase might help in fine-tuning the in vivo growth rate of Mtb in mice. Knowing that ΔpykA cannot grow on short chain fatty acids in vitro, it is tempting to speculate that the in vivo diet contains substrates like acetate, lactate, and glutamate. In fact, mass spectrometric determination of the metabolome of Mtb-infected human macrophages and granulomatous tissue of guinea pigs show the presence of acetate, lactate, and glutamate (5, 54). Moreover, 13C-metabolic flux analysis of M. tuberculosis grown in THP-1 macrophages showed that glutamate is among the substrates preferentially taken up from the phagosome (55). Although our studies show that PK is not essential for Mtb pathogenesis in mice, it is important to note that mouse models do not perfectly mimic the human disease and that many enzymatic reactions, although non-essential for mouse infection, were shown to be essential to infect higher organisms (56).

Taken together, our data describe a central role of PK in actively growing Mtb cells and provides the first systematic characterization of PK in Mtb metabolism and pathogenesis. PK is crucial to facilitate co-catabolism of glycolytic and gluconeogenic substrates and is essential for the detoxification of sugar phosphates during glucose metabolism as well as for growth on short chain fatty acids. This argues that PK is needed to keep Mtb primed at all times to rapidly react to potential changes in carbon availability in its environment.

Author Contributions

T. N., K. Y. R., W. R. J., M. B., and J. S. B. planned and designed research; T. N., O. V., T. E. H., and M. B. conducted experiments; T. N., T. E. H., K. Y. R., W. R. J., M. B., and J. S. B. analyzed data; T. N., M. B., and J. S. B. wrote the paper.

Acknowledgments

We thank Annie Zhi Dai and Linda Berney-Meyer for technical support.

*

This work was supported, in whole or in part, by National Institutes of Health Grants AI060899 (to J. S. B.), AI26170 (to W. R. J.), AI119573 (to M. B.), and a Burroughs Wellcome Career Award in the Biomedical Sciences (to K. Y. R.).

3
The abbreviations used are:
Mtb
M. tuberculosis
PK
pyruvate kinase
ICDH
isocitrate dehydrogenase
P-enolpyruvate
phosphoenolpyruvate
TCA
tricarboxylic acid
MG
methylglyoxal
PEPCK
phosphoenolpyruvate carboxykinase
HdB
Hartmans de Bondt.

References

  • 1. Marrero J., Rhee K. Y., Schnappinger D., Pethe K., and Ehrt S. (2010) Gluconeogenic carbon flow of tricarboxylic acid cycle intermediates is critical for Mycobacterium tuberculosis to establish and maintain infection. Proc. Natl. Acad. Sci. U.S.A. 107, 9819–9824 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Nandakumar M., Nathan C., and Rhee K. Y. (2014) Isocitrate lyase mediates broad antibiotic tolerance in Mycobacterium tuberculosis. Nat. Commun. 5, 4306. [DOI] [PubMed] [Google Scholar]
  • 3. Trujillo C., Blumenthal A., Marrero J., Rhee K. Y., Schnappinger D., and Ehrt S. (2014) Triosephosphate isomerase is dispensable in vitro yet essential for Mycobacterium tuberculosis to establish infection. MBio 5, e00085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. de Carvalho L. P., Fischer S. M., Marrero J., Nathan C., Ehrt S., and Rhee K. Y. (2010) Metabolomics of Mycobacterium tuberculosis reveals compartmentalized co-catabolism of carbon substrates. Chem. Biol. 17, 1122–1131 [DOI] [PubMed] [Google Scholar]
  • 5. Somashekar B. S., Amin A. G., Rithner C. D., Troudt J., Basaraba R., Izzo A., Crick D. C., and Chatterjee D. (2011) Metabolic profiling of lung granuloma in Mycobacterium tuberculosis infected guinea pigs: ex vivo 1H magic angle spinning NMR studies. J. Proteome Res. 10, 4186–4195 [DOI] [PubMed] [Google Scholar]
  • 6. Kovárová-Kovar K., and Egli T. (1998) Growth kinetics of suspended microbial cells: from single-substrate-controlled growth to mixed-substrate kinetics. Microbiol. Mol. Biol. Rev. 62, 646–666 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Bloch H., and Segal W. (1956) Biochemical differentiation of Mycobacterium tuberculosis grown in vivo and in vitro. J. Bacteriol. 72, 132–141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Muñoz-Elías E. J., and McKinney J. D. (2006) Carbon metabolism of intracellular bacteria. Cell. Microbiol. 8, 10–22 [DOI] [PubMed] [Google Scholar]
  • 9. Kendall S. L., Burgess P., Balhana R., Withers M., Ten Bokum A., Lott J. S., Gao C., Uhia-Castro I., and Stoker N. G. (2010) Cholesterol utilization in mycobacteria is controlled by two TetR-type transcriptional regulators: kstR and kstR2. Microbiology 156, 1362–1371 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Kendall S. L., Withers M., Soffair C. N., Moreland N. J., Gurcha S., Sidders B., Frita R., Ten Bokum A., Besra G. S., Lott J. S., and Stoker N. G. (2007) A highly conserved transcriptional repressor controls a large regulon involved in lipid degradation in Mycobacterium smegmatis and Mycobacterium tuberculosis. Mol. Microbiol. 65, 684–699 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Brzostek A., Sliwiński T., Rumijowska-Galewicz A., Korycka-Machal̸a M., and Dziadek J. (2005) Identification and targeted disruption of the gene encoding the main 3-ketosteroid dehydrogenase in Mycobacterium smegmatis. Microbiology 151, 2393–2402 [DOI] [PubMed] [Google Scholar]
  • 12. Yam K. C., D'Angelo I., Kalscheuer R., Zhu H., Wang J. X., Snieckus V., Ly L. H., Converse P. J., Jacobs W. R. Jr., Strynadka N., and Eltis L. D. (2009) Studies of a ring-cleaving dioxygenase illuminate the role of cholesterol metabolism in the pathogenesis of Mycobacterium tuberculosis. PLoS Pathog. 5, e1000344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Koul A., Vranckx L., Dhar N., Göhlmann H. W., Özdemir E., Neefs J. M., Schulz M., Lu P., Mørtz E., McKinney J. D., Andries K., and Bald D. (2014) Delayed bactericidal response of Mycobacterium tuberculosis to bedaquiline involves remodelling of bacterial metabolism. Nat. Commun. 5, 3369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Marrero J., Trujillo C., Rhee K. Y., and Ehrt S. (2013) Glucose phosphorylation is required for Mycobacterium tuberculosis persistence in mice. PLoS Pathog. 9, e1003116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Phong W. Y., Lin W., Rao S. P., Dick T., Alonso S., and Pethe K. (2013) Characterization of phosphofructokinase activity in Mycobacterium tuberculosis reveals that a functional glycolytic carbon flow is necessary to limit the accumulation of toxic metabolic intermediates under hypoxia. PLoS ONE 8, e56037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Kayne F. J. (1973) Pyruvate Kinase. in The Enzymes (Boyer P. D., ed) pp. 353–382, Elsevier, New York [Google Scholar]
  • 17. Cortassa S., Aon J. C., and Aon M. A. (1995) Fluxes of carbon, phosphorylation, and redox intermediates during growth of Saccharomyces cerevisiae on different carbon sources. Biotechnol. Bioeng. 47, 193–208 [DOI] [PubMed] [Google Scholar]
  • 18. Sauer U., and Eikmanns B. J. (2005) The PEP-pyruvate-oxaloacetate node as the switch point for carbon flux distribution in bacteria. FEMS Microbiol. Rev. 29, 765–794 [DOI] [PubMed] [Google Scholar]
  • 19. Wang Q., Zhang Y., Yang C., Xiong H., Lin Y., Yao J., Li H., Xie L., Zhao W., Yao Y., Ning Z. B., Zeng R., Xiong Y., Guan K. L., Zhao S., and Zhao G. P. (2010) Acetylation of metabolic enzymes coordinates carbon source utilization and metabolic flux. Science 327, 1004–1007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Wilson A. J., and Bhattacharjee J. K. (1986) Regulation of phosphoenolpyruvate carboxykinase and pyruvate kinase in Saccharomyces cerevisiae grown in the presence of glycolytic and gluconeogenic carbon sources and the role of mitochondrial function on gluconeogenesis. Can. J. Microbiol. 32, 969–972 [DOI] [PubMed] [Google Scholar]
  • 21. Zhao S., Xu W., Jiang W., Yu W., Lin Y., Zhang T., Yao J., Zhou L., Zeng Y., Li H., Li Y., Shi J., An W., Hancock S. M., He F., Qin L., Chin J., Yang P., Chen X., Lei Q., Xiong Y., and Guan K. L. (2010) Regulation of cellular metabolism by protein lysine acetylation. Science 327, 1000–1004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Xu Y. F., Amador-Noguez D., Reaves M. L., Feng X. J., and Rabinowitz J. D. (2012) Ultrasensitive regulation of anapleurosis via allosteric activation of PEP carboxylase. Nat. Chem. Biol. 8, 562–568 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Anastasiou D., Yu Y., Israelsen W. J., Jiang J. K., Boxer M. B., Hong B. S., Tempel W., Dimov S., Shen M., Jha A., Yang H., Mattaini K. R., Metallo C. M., Fiske B. P., Courtney K. D., et al. (2012) Pyruvate kinase M2 activators promote tetramer formation and suppress tumorigenesis. Nat. Chem. Biol. 8, 839–847 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Zoraghi R., See R. H., Axerio-Cilies P., Kumar N. S., Gong H., Moreau A., Hsing M., Kaur S., Swayze R. D., Worrall L., Amandoron E., Lian T., Jackson L., Jiang J., Thorson L., et al. (2011) Identification of pyruvate kinase in methicillin-resistant Staphylococcus aureus as a novel antimicrobial drug target. Antimicrob. Agents Chemother. 55, 2042–2053 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Xu Y. F., Zhao X., Glass D. S., Absalan F., Perlman D. H., Broach J. R., and Rabinowitz J. D. (2012) Regulation of yeast pyruvate kinase by ultrasensitive allostery independent of phosphorylation. Mol. Cell 48, 52–62 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Zoraghi R., See R. H., Gong H., Lian T., Swayze R., Finlay B. B., Brunham R. C., McMaster W. R., and Reiner N. E. (2010) Functional analysis, overexpression, and kinetic characterization of pyruvate kinase from methicillin-resistant Staphylococcus aureus. Biochemistry 49, 7733–7747 [DOI] [PubMed] [Google Scholar]
  • 27. Valentini G., Chiarelli L., Fortin R., Speranza M. L., Galizzi A., and Mattevi A. (2000) The allosteric regulation of pyruvate kinase. J. Biol. Chem. 275, 18145–18152 [DOI] [PubMed] [Google Scholar]
  • 28. Kremling A., Bettenbrock K., and Gilles E. D. (2008) A feed-forward loop guarantees robust behavior in Escherichia coli carbohydrate uptake. Bioinformatics 24, 704–710 [DOI] [PubMed] [Google Scholar]
  • 29. Ferguson G. P., Tötemeyer S., MacLean M. J., and Booth I. R. (1998) Methylglyoxal production in bacteria: suicide or survival? Arch. Microbiol. 170, 209–218 [DOI] [PubMed] [Google Scholar]
  • 30. Ferguson G. P. (1999) Protective mechanisms against toxic electrophiles in Escherichia coli. Trends Microbiol. 7, 242–247 [DOI] [PubMed] [Google Scholar]
  • 31. Chavadi S., Wooff E., Coldham N. G., Sritharan M., Hewinson R. G., Gordon S. V., and Wheeler P. R. (2009) Global effects of inactivation of the pyruvate kinase gene in the Mycobacterium tuberculosis complex. J. Bacteriol. 191, 7545–7553 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Keating L. A., Wheeler P. R., Mansoor H., Inwald J. K., Dale J., Hewinson R. G., and Gordon S. V. (2005) The pyruvate requirement of some members of the Mycobacterium tuberculosis complex is due to an inactive pyruvate kinase: implications for in vivo growth. Mol. Microbiol. 56, 163–174 [DOI] [PubMed] [Google Scholar]
  • 33. Berney M., Weimar M. R., Heikal A., and Cook G. M. (2012) Regulation of proline metabolism in mycobacteria and its role in carbon metabolism under hypoxia. Mol. Microbiol. 84, 664–681 [DOI] [PubMed] [Google Scholar]
  • 34. Jain P., Hsu T., Arai M., Biermann K., Thaler D. S., Nguyen A., González P. A., Tufariello J. M., Kriakov J., Chen B., Larsen M. H., and Jacobs W. R. Jr. (2014) Specialized transduction designed for precise high-throughput unmarked deletions in Mycobacterium tuberculosis. MBio 5, e01245–e01214 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Stover C. K., de la Cruz V. F., Fuerst T. R., Burlein J. E., Benson L. A., Bennett L. T., Bansal G. P., Young J. F., Lee M. H., and Hatfull G. F. (1991) New use of BCG for recombinant vaccines. Nature 351, 456–460 [DOI] [PubMed] [Google Scholar]
  • 36. Berney M., Berney-Meyer L., Wong K. W., Chen B., Chen M., Kim J., Wang J., Harris D., Parkhill J., Chan J., Wang F., and Jacobs W. R. (2015) Essential Roles of Methionine and S-adenosylmethionine in the Autarkic Lifestyle of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U.S.A. 112, 10008–10013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Randell E. W., Vasdev S., and Gill V. (2005) Measurement of methylglyoxal in rat tissues by electrospray ionization mass spectrometry and liquid chromatography. J. Pharmacol. Toxicol. Methods 51, 153–157 [DOI] [PubMed] [Google Scholar]
  • 38. Veith N., Feldman-Salit A., Cojocaru V., Henrich S., Kummer U., and Wade R. C. (2013) Organism-adapted specificity of the allosteric regulation of pyruvate kinase in lactic acid bacteria. PLoS Comput. Biol. 9, e1003159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Eoh H., and Rhee K. Y. (2013) Multifunctional essentiality of succinate metabolism in adaptation to hypoxia in Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U.S.A. 110, 6554–6559 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Savvi S., Warner D. F., Kana B. D., McKinney J. D., Mizrahi V., and Dawes S. S. (2008) Functional characterization of a vitamin B12-dependent methylmalonyl pathway in Mycobacterium tuberculosis: implications for propionate metabolism during growth on fatty acids. J. Bacteriol. 190, 3886–3895 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Ogawa T., Murakami K., Mori H., Ishii N., Tomita M., and Yoshin M. (2007) Role of phosphoenolpyruvate in the NADP-isocitrate dehydrogenase and isocitrate lyase reaction in Escherichia coli. J. Bacteriol. 189, 1176–1178 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Maksymiuk C., Balakrishnan A., Bryk R., Rhee K. Y., and Nathan C. F. (2015) E1 of α-ketoglutarate dehydrogenase defends Mycobacterium tuberculosis against glutamate anaplerosis and nitroxidative stress. Proc. Natl. Acad. Sci. U.S.A. 112, E5834–E5843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Kalapos M. P. (1999) Methylglyoxal in living organisms: chemistry, biochemistry, toxicology and biological implications. Toxicol. Lett. 110, 145–175 [DOI] [PubMed] [Google Scholar]
  • 44. van Heerden J. H., Wortel M. T., Bruggeman F. J., Heijnen J. J., Bollen Y. J., Planqué R., Hulshof J., O'Toole T. G., Wahl S. A., and Teusink B. (2014) Lost in transition: start-up of glycolysis yields subpopulations of nongrowing cells. Science 343, 1245114. [DOI] [PubMed] [Google Scholar]
  • 45. Griffin J. E., Pandey A. K., Gilmore S. A., Mizrahi V., McKinney J. D., Bertozzi C. R., and Sassetti C. M. (2012) Cholesterol catabolism by Mycobacterium tuberculosis requires transcriptional and metabolic adaptations. Chem. Biol. 19, 218–227 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Beste D. J., Bonde B., Hawkins N., Ward J. L., Beale M. H., Noack S., Nöh K., Kruger N. J., Ratcliffe R. G., and McFadden J. (2011) 13C metabolic flux analysis identifies an unusual route for pyruvate dissimilation in mycobacteria which requires isocitrate lyase and carbon dioxide fixation. PLoS Pathog. 7, e1002091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Zhu T., Phalakornkule C., Koepsel R. R., Domach M. M., and Ataai M. M. (2001) Cell growth and by-product formation in a pyruvate kinase mutant of E. coli. Biotechnol. Prog. 17, 624–628 [DOI] [PubMed] [Google Scholar]
  • 48. Ponce E. (1999) Effect of growth rate reduction and genetic modifications on acetate accumulation and biomass yields in Escherichia coli. J. Biosci. Bioeng. 87, 775–780 [DOI] [PubMed] [Google Scholar]
  • 49. Siddiquee K. A., Arauzo-Bravo M. J., and Shimizu K. (2004) Effect of a pyruvate kinase (pykF gene) knockout mutation on the control of gene expression and metabolic fluxes in Escherichia coli. FEMS Microbiol. Lett. 235, 25–33 [DOI] [PubMed] [Google Scholar]
  • 50. Booth I. R., Ferguson G. P., Miller S., Li C., Gunasekera B., and Kinghorn S. (2003) Bacterial production of methylglyoxal: a survival strategy or death by misadventure? Biochem. Soc. Trans. 31, 1406–1408 [DOI] [PubMed] [Google Scholar]
  • 51. Boshoff H. I., and Barry C. E. 3rd. (2005) Tuberculosis: metabolism and respiration in the absence of growth. Nat. Rev. Microbiol. 3, 70–80 [DOI] [PubMed] [Google Scholar]
  • 52. Watanabe S., Zimmermann M., Goodwin M. B., Sauer U., Barry C. E. 3rd, and Boshoff H. I. (2011) Fumarate reductase activity maintains an energized membrane in anaerobic Mycobacterium tuberculosis. PLoS Pathog. 7, e1002287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Dunn P. L., and North R. J. (1995) Virulence ranking of some Mycobacterium tuberculosis and Mycobacterium bovis strains according to their ability to multiply in the lungs, induce lung pathology, and cause mortality in mice. Infect. Immun. 63, 3428–3437 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Cheng J., Che N., Li H., Ma K., Wu S., Fang J., Gao R., Liu J., Yan X., Li C., and Dong F. (2013) Extraction, derivatization, and determination of metabolome in human macrophages. J. Sep. Sci. 36, 1418–1428 [DOI] [PubMed] [Google Scholar]
  • 55. Beste D. J., Nöh K., Niedenführ S., Mendum T. A., Hawkins N. D., Ward J. L., Beale M. H., Wiechert W., and McFadden J. (2013) 13C-flux spectral analysis of host-pathogen metabolism reveals a mixed diet for intracellular Mycobacterium tuberculosis. Chem. Biol. 20, 1012–1021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Mehra S., Foreman T. W., Didier P. J., Ahsan M. H., Hudock T. A., Kissee R., Golden N. A., Gautam U. S., Johnson A. M., Alvarez X., Russell-Lodrigue K. E., Doyle L. A., Roy C. J., Niu T., Blanchard J. L., Khader S. A., Lackner A. A., Sherman D. R., and Kaushal D. (2015) The DosR regulon modulates adaptive immunity and is essential for Mycobacterium tuberculosis persistence. Am. J. Respir. Crit. Care Med. 191, 1185–1196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Sambandamurthy V. K., Derrick S. C., Hsu T., Chen B., Larsen M. H., Jalapathy K. V., Chen M., Kim J., Porcelli S. A., Chan J., Morris S. L., and Jacobs W. R. Jr. (2006) Mycobacterium tuberculosis ΔRD1 ΔpanCD: a safe and limited replicating mutant strain that protects immunocompetent and immunocompromised mice against experimental tuberculosis. Vaccine 24, 6309–6320 [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES