Molecular Characterisation of Endophytic Fungi from Roots of Wild Banana (Musa acuminata)

Abstract

Endophytic fungi inhabit apparently healthy plant tissues and are prevalent in terrestrial plants, especially root tissues, which harbour a wide assemblage of fungal endophytes. Therefore, this study focused on the isolation and characterisation of endophytic fungi from the roots of wild banana (Musa acuminata). A total of 31 isolates of endophytic fungi were isolated from 80 root fragments. The endophytic fungi were initially sorted according to morphological characteristics and identified using the sequences of the translation elongation factor-1α (TEF-1α) gene of Fusarium spp. and the Internal Transcribed Spacer (ITS) regions of other fungi. The most common fungal isolates were species of the genus Fusarium, which were identified as F. proliferatum, Fusarium sp., F. solani species complex, and F. oxysporum. Other isolated endophytic fungi included Curvularia lunata, Trichoderma atroviride, Calonectria gracilis, Rhizoctonia solani, Bionectria ochroleuca, and Stromatoneurospora phoenix (Xylariceae). Several of the fungal genera, such as Fusarium, Trichoderma, Rhizoctonia, and Xylariceae, are among the common fungal endophytes reported in plants. This study showed that the roots of wild banana harbour a diverse group of endophytic fungi.

Studies on endophytic fungi were initially undertaken mainly in temperate plants. Plant diversity is higher in tropical regions, and these plants might harbour a wider assemblage and more diverse fungal communities. Therefore, the fungal endophytes from tropical plants have received much attention, and most studies indicate that the fungal endophytes from these tropical plants consist of a very diverse and species-rich fungal assemblage (Arnold & Lutzoni 2007; Rungjindamai et al. 2008; Tejesvi et al. 2009; Huang et al. 2009; Rocha et al. 2011; Orlandelli et al. 2012; Tayung et al. 2012). Studies on the occurrence and diversity of fungal endophytes are expected to yield potential sources of natural products and bioactive compounds for medicinal, agricultural and industrial uses, such as new antibiotics as well as novel biological control agents (Molina et al. 2012).

Endophytic fungi are usually defined as fungal isolates that grow within plant host tissues without causing any disease symptoms (Schulz et al. 1999). Fungal endophytes also refer to fungi within apparently healthy, functional root tissues at the ‘moment’ of sample collection (Sieber 2002). This concept was supported by Schulz and Boyle (2005) to describe bacteria and fungi that can be detected at a particular ‘moment’ within the tissues of apparently healthy plant hosts.

Almost all vascular plant species harbour fungal endophytes, which are present in virtually all plant tissues and organs. Some endophytic fungal taxa are regarded as seed-borne endophytes (Hyde & Soytong 2008). Endophytic fungi also contribute to fungal biodiversity, which was estimated to include 5.1 million existing species (Blackwell 2011).

Wild banana (Musa acuminata) is in the family Musaceae, which is native to Southeast Asia and is an ancestor of the edible banana. The highest species diversity in the Musaceae family occurs in South East Asia, with representative species found across the Old World Tropics. Studies on the endophytes of Musa sp. were conducted in Australia and Hong Kong, mostly on isolations from the leaves of cultivated banana plants (Brown et al. 1998; Photita et al. 2001). In this study, endophytic fungi were isolated from the roots of wild banana (M. acuminata). Many reports have indicated that plant roots harbour diverse groups of fungi and, moreover, the occurrence of endophytic fungi in Musa sp. in Malaysia is not well-documented. Therefore, the objective of this study was to isolate and identify the endophytic fungal taxa in the roots of wild banana.

Banana root samples were randomly collected from healthy and symptomless wild banana trees at five locations along Balik Pulau Road, Pulau Pinang. The roots were taken by digging the soil around the banana tree. All root samples were put in plastic bags according to their respective locations.

The soil attached to the roots was removed by washing them with running tap water for 24 hr. To isolate the endophytic fungi, the surfaces were sterilised. The roots were cut into small fragments (2.0–3.0 cm), dipped in 70% ethanol for 30 sec, then dipped in 1% sodium hypochlorite for 3 min, 95% ethanol for 5 min and finally rinsed 3 times with sterile distilled water. The root fragments were then dried using sterile filter paper, cut into much smaller fragments (1.0–1.5 cm) and plated onto potato dextrose agar (PDA).

Four root fragments were plated onto a PDA plate, and a total of 80 root fragments were used for isolation. Before plating onto the PDA plate, the root fragment was imprinted on the PDA plate to detect the presence of epiphytes on the root fragment (Schulz et al. 1993). The plates were incubated at 27±1°C and observed every day to detect any fungal growth from the root fragments. Mycelial growths from the roots were sub-cultured onto new PDA plates.

To identify the endophytic fungal isolates, pure cultures from a single spore isolation were used. The fungal isolates were identified using microscopic and macroscopic characters according to the methods and fungal descriptions of Ellis (1971), Barnett and Hunter (2006), and The Fusarium Laboratory Manual (Leslie & Summerell 2006). The main purpose of morphological identification is to group the fungal isolates according to similar morphological characteristics. The fungal isolates were considered as belonging to the same group or genus if their morphological characteristics matched the morphological descriptions previously described or reported.

For species confirmation of the morphologically identified isolates, sequencing of the translation elongation factor-1α (TEF-1α) gene and Internal Transcribed Spacer (ITS) regions was performed. TEF-1α sequences were used to confirm the morphologically identified Fusarium isolates (Geiser et al. 2004); ITS regions were used for the other morphologically identified endophytic fungal isolates. The ITS region is regarded as a DNA barcode marker for the identification of fungi (Schoch et al. 2012): therefore, this region was used in this study.

ITS regions were amplified using ITS1 and ITS4 primer pairs (White et al. 1990). PCR amplifications were performed in a total volume of 25 μL containing 0.5 µL of 0.5 µM template DNA, 5 µL 5× PCR buffer, 4.0 mM MgCl₂, 0.8 mM dNTP mix (Promega, WI, USA) of both forward and reverse primers and 0.625 U of Taq polymerase (Promega, WI, USA), in a PTC-100 Peltier Thermal Cycler (MJ Research Inc., MA, USA). PCR cycles began with an initial denaturation at 95°C for 3 min, followed by 34 cycles of denaturation at 95°C for 1 min, annealing at 52°C for 30 s, extension at 72°C for 1 min, and a final extension at 72°C for 10 min.

The TEF-1α gene was amplified using EF1 (ATGGGTAAGGAGGACAAGAC) and EF2 (GGAAGTACCAGTGATCATGTT) primers modified from O’Donnell et al. (1998). PCR amplification was performed in a 25 µL reaction mixture containing 5 µL 5× PCR buffer, 2.5 mM MgCl₂, 0.2 µL template DNA, 0.64 mM of dNTPs mix (Promega), 0.625 unit Taq polymerase (Promega), and 0.8 µM of both forward and reverse primers, and the PCR was also performed using a PTC-100 Peltier Thermal Cycler (MJ Research Inc.). The PCR cycles were based on O’Donnell et al. (1998) with some modifications: the initial denaturation at 94°C for 1 min was followed by 36 cycles of denaturation at 95°C of 35 sec, annealing at 59°C for 55 sec, and extension at 72°C for 90 sec, followed by a final extension at 72°C for 10 min. The PCR products were visualised using gel electrophoresis.

The PCR products were purified using a QIAquick Purification kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol, and the PCR products were sent to a service provider (MyTACG Bioscience Enterprise, Selangor, Malaysia) for sequencing. After sequencing, pairwise alignment of the sequences was achieved using BioEdit software (Hall 1999). Using Basic Local Alignment Search Tool (BLAST), the consensus sequences of Fusarium isolates were compared with other sequences in the Fusarium-ID database and with other fungal isolates using Genbank. Identification of all fungal isolates was based on the closest match of the BLAST search.

A total of 31 fungal isolates (Tables 1 and 2) from 80 fragments of wild banana roots were successfully isolated and identified. Fungal mycelia were not observed on the imprint plates used in the surface sterilisation, indicating the effectiveness of the surface sterilisation method for isolating endophytic fungi from the root fragments. The results also indicated that all the fungal isolates successfully isolated from the roots were endophytes, as epiphytic fungi inhabiting the surface of the root could not grow after surface sterilisation (Schulz et al. 1993).

Table 1:

Species identities of endophytic Fusarium spp. based on TEF-1α sequences.

Isolate	Morphological identification	TEF-1α sequence	% similarity
S1-R	F. proliferatum	F. proliferatum	98
S1-U	F. verticillioides	F. proliferatum	99
S1-V	F. proliferatum	F. proliferatum	99
S1-W	F. proliferatum	F. proliferatum	96
S1-X	F. proliferatum	Fusarium sp.	99
S1-Y	F. proliferatum	F. proliferatum	99
S2-S	F. proliferatum	Fusarium sp.	99
S2-T	F. proliferatum	Fusarium sp.	99
S3-S	F. proliferatum	F. proliferatum	98
S3-U	F. proliferatum	F. proliferatum	99
S4-N	F. solani	F. solani species complex	99
S4-R	F. proliferatum	F. proliferatum	99
S4-S	F. verticillioides	F. proliferatum	99
S4-T	F. verticillioides	F. proliferatum	99
S4-U	F. proliferatum	F. proliferatum	99
S5-R	F. proliferatum	F. proliferatum	99
S5-S	F. proliferatum	F. proliferatum	99
S5-U	F. proliferatum	F. proliferatum	99

Table 2:

Species identity of endophytic fungi based on ITS sequences.

Isolate	Morphological identification	ITS sequence	% similarity
S1-S	Curvularia lunata	Curvularia lunata	99
S3-T	Unidentified	F. oxysporum	99
S3-F	Unidentified	F. solani	99
S3-I	Cylindrocladium sp.	Calonectria gracilis	99
S3-N	Trichoderma viride	Trichoderma atroviride	99
S3-Q	Cylindrocladium sp.	Calonectria gracilis	99
S2-A	Mycelia sterilia	Rhizoctonia solani	95
S2-C	Unidentified	F. proliferatum	99
S2-M	Unidentified	F. oxysporum	99
S1-E	Mycelia sterilia	Bionectria ochroleuca	99
S1-M	Trichoderma viride	Trichoderma atroviride	99
S3-M	Trichoderma viride	Trichoderma atroviride	99
S1-L	Xylaria sp.	Stromatoneuspora phoenix	97

The most common endophytic fungal isolates recovered were from the genus Fusarium. The isolates were identified molecularly as F. proliferatum, Fusarium sp., and F. solani species complex based on the TEF-1α sequences; three Fusarium species were identified on the basis of the ITS regions, namely, F. oxysporum, F. solani, and F. proliferatum (Tables 1 and 2). The three Fusarium species, F. oxysporum, F. solani, and F. proliferatum, were morphologically ‘unidentified’, as the microscopic and macroscopic characteristics observed did not fall within the range of the descriptions of Fusarium species; therefore, the ITS regions were used for identification.

For the TEF-1α sequences, a BLAST search was performed using the Fusarium-ID database, as this database is strongly recommended for the identification of most Fusarium species (Geiser et al. 2004). Three isolates were identified only as members of the genus Fusarium sp., as the correct identity of these isolates remain ‘uncertain’ until rigorous morphological and multilocus phylogenetic studies are completed (Geiser et al. 2004). One isolate was identified as F. solani species complex, a species complex within which dozens of phylogenetic species have been recognised (Geiser et al. 2004).

Species in the genus Fusarium are reported to be among the common root endophytic fungal communities (Sieber 2002). Endophytic Fusarium sp. was among the fungal flora identified from the healthy root tissues of wild banana in South China (Cao et al. 2002). Fusarium sp. has also been isolated from the leaves of mature wild banana from different localities in Sao Paulo, Brazil (Pereira et al. 1993) and from young and old leaf tissues of wild banana in Thailand (Photita et al. 2001).

In this study, F. proliferatum was the most common species isolated and identified from the root fragments. Endophytic F. proliferatum has been recovered from Celastrus angulatus, a traditional Chinese medicinal plant, (Ji et al. 2005); the stems of Kandelia, a mangrove plant (Cheng et al. 2008); the inner bark tissue of a medicinal plant, Dysoxylum binectariferum (Mohana Kumara et al. 2012); and the leaves of the oil-seed crop Jatropha curcas (Kumar & Kaushik 2013). These studies showed that although F. proliferatum is a well-known plant pathogen, the species can also be an endophyte.

Endophytic F. solani and F. oxysporum have been isolated from the root fragments of wild banana plants (Latiffah & Nur Hidayah 2011), and both species have been isolated from the healthy roots of the Cavendish banana (Athman 2006). F. solani has been isolated from the healthy leaf pieces of Musa spp. in Hong Kong and South East Queensland (Brown et al. 1998). Similar to F. proliferatum, both F. solani and F. oxysporum are well-known plant pathogens and can also be endophytes.

Based on the ITS sequences, other endophytic fungi isolated included C. lunata, T. atroviride, C. gracilis, R. solani, B. ochroleuca and S. phoenix (Table 2). These fungi are reported to be endophytic in different types of host plants.

C. lunata was identified from its morphological characteristics and ITS sequences. C. lunata is among the common endophytic fungi isolated from plants, and the occurrence of endophytic C. lunata has been reported in several studies, such as Rajagopal et al. (2010), Verma et al. (2011), Al-Mahi et al. (2013), and Tuppad and Shishupala (2013).

T. atroviride was morphologically identified as T. viride, but according to the ITS sequences, the isolates exhibit the closest match (99%) to T. atroviride. Endophytic T. atroviride has been isolated from the roots of red sage (Salvia miltiorrhiza), which is used as a Chinese herbal medicine (Ming et al. 2013). Xia et al. (2011) reported the occurrence of various species of endophytic Trichoderma associated with banana roots.

A morphologically identified Cylindrocladium sp. was identified as C. gracilis (Table 2). The genus Cylindrocladium has a Calonectria teleomorph, and Calonectria species are commonly characterised by their Cylindrocladium anamorphs (Crous & Wingfield 1994). The genus Calonectria consists of saprophytic and plant pathogenic species, which are associated with a wide range of diseases in various host plants worldwide (Crous 2002). The endophytic C. gracilis isolates in this study have a 99% similarity with C. gracilis as reported by Lombard et al. (2010). C. gracilis has not previously been reported to be endophytic.

Two morphologically identified mycelia sterilia were identified as R. solani and B. ochroleuca on the basis of the ITS sequences. These two isolates did not produce any sporulating structure on PDA and therefore were morphologically identified as mycelia sterilia (Table 2). The two mycelia sterilia isolates showed a high sequence similarity (99%) with R. solani and B. ochroleuca. Endophytic R. solani has been recovered from the leaves of Taxus mairei (Wang et al. 2008) and from tropical orchids, and the occurrence of endophytic Rhizoctonia-like fungi was reported by Otero et al. (2002). Bionectria is rarely isolated as an endophyte; however, an endophytic B. ochroleuca was isolated from Nothapodytes foetida, a tree that grows wild in the forests of the Western Ghats (Samaga et al. 2013), and from healthy tissues of chili pepper plants (Narayan et al. 2013).

A morphologically identified Xylaria sp. was identified as S. phoenix, a species in the family Xylariaceae, on the basis of the ITS sequences. Endophytic Xylariaceae have been reported in Magnolia liliifera (Promputtha et al. 2005), Pinus tabulaeformis (Wang et al. 2005), Piper aduncum (Silva et al. 2010), and the medicinal plant Dendrobium (Chen et al. 2013).

This study showed that the roots of wild banana harbour diverse endophytic fungal taxa. The effect of endophytic fungi on the wild banana plant is relatively unknown. However, endophytic fungi are generally positioned between the trophic niches of pathogen and mutualist (Saikkonen et al. (1998). Some root endophytes may be latent pathogens, which in later stages can weaken or damage the roots (Schulz et al. 1999). Many other root endophytes provide benefits to the host plants by improving plant growth (Schulz et al. 2002), assisting in phosphorus uptake (Sieber 2002) and protecting against pests and diseases.