Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2016 Mar 18;17(3):274. doi: 10.3390/ijms17030274

Identification and Characterization of the Gene CYP340W1 from Plutella xylostella and Its Possible Involvement in Resistance to Abamectin

Xue Gao 1, Jiaqiang Yang 1, Baoyun Xu 1, Wen Xie 1, Shaoli Wang 1, Youjun Zhang 1, Fengshan Yang 2, Qingjun Wu 1,*
Editor: Baohong Zhang
PMCID: PMC4813138  PMID: 26999122

Abstract

Abamectin has been used to control the diamondback moth, Plutella xylostella (P. xylostella), which is a major agricultural pest that can rapidly develop resistance against insecticides including abamectin. Although cytochrome P450 has been confirmed to play an important role in resistance in P. xylostella, the specific P450 genes associated with the resistance are unclear. The full-length cDNA of the cytochrome P450 gene CYP340W1 was cloned and characterized in the present study. The cDNA assembly yielded a sequence of 1929 bp, containing the open reading frame (ORF) 1491 bp and encodes a 496-amino acid peptide. CYP340W1 was expressed in all P. xylostella developmental stages but its expression level was highest in larvae and especially in the heads of larvae. The expression of CYP340W1 was significantly higher in an abamectin-resistant strain (ABM-R) than in its susceptible counterpart (ABM-S). In addition, expression of CYP340W1 was increased when the ABM-R strain was exposed to abamectin. When injected into third-stage ABM-R larvae, CYP340W1 dsRNA significantly reduced CYP340W1 expression at 6 h and reduced expression by 83% at 12 h. As a consequence of RNAi, the mortality of the injected abamectin-resistant larvae increased after a 48-h exposure to abamectin. The results indicate that the overexpression of CYP340W1 plays an important role in abamectin resistance in P. xylostella.

Keywords: Plutella xylostella, P450 CYP340W1, overexpression, abamectin resistance, RNA interference

1. Introduction

The diamondback moth (DBM) Plutella xylostella (L.) (P. xylostella) is a serious cosmopolitan pest that can cause great damage, mainly to cruciferous crops. The total annual cost of damage caused by P. xylostella has been estimated to be US$4–5 billion [1]. P. xylostella is notorious for its rapid development of resistance to insecticides, including abamectin. Abamectin, which was developed from secondary metabolites of the soil bacterium Streptomyces avermitilis, is a mixture of avermectin B1a and avermectin B1b of the macrocyclic lactone group [2]. Avermectins have a broad spectrum of activity against crop pests, including mites and also insects in the orders Coleoptera, Homoptera, Diptera, Orthoptera, Isoptera, Hymenoptera, and Lepidoptera [3]. P. xylostella was highly susceptible to abamectin during the initial years of application, but abamectin resistance in P. xylostella was first found in 1996 in the Cameron Highlands in Malaysia [4]. Abamectin resistance in P. xylostella was subsequently reported in Brazil [5] and Pakistan [6]. A high level of resistance to abamectin in P. xylostella was found in southern China; in Yunnan Province, for instance, the resistance level was about 5000-fold [7]. Despite this, abamectin and its derivatives are still used to control P. xylostella and other pests in northern China and in other countries [8,9]. Managing abamectin resistance and prolonging the life of avermectins depends on understanding the resistance mechanism (s).

Researchers have studied the mechanisms underlying P. xylostella resistance to abamectin, and they have proposed many hypotheses. Previous studies indicated that abamectin resistance in P. xylostella is autosomal, incompletely dominant, and polygenic in both field and laboratory-selected strains [7,10]. Reduced cuticle penetration of insecticides [11], increased detoxification enzymes [12,13], target-site mutations [14], and ATP-binding cassette (ABC) transporters [15] have been reported to contribute to abamectin resistance in P. xylostella. The increased activity of cytochromome P450 monooxygenase was confirmed to play an important role in abamectin resistance in P. xylostella [7]. The role of P450s in insecticide resistance was first reported in the early 1960s when researchers found that the resistance of houseflies to carbaryl could be eliminated by the P450 inhibitor sesame [16]. Since then, P450s have been a focus of resistance research, and the evidence indicating that P450s mediate resistance has increased rapidly [17,18]. The up-regulation of P450 genes belonging to the families CYP6, CYP9, and CYP12 has been reported in resistant insects [19]. Overexpression of CYP4G61 is associated with pyriproxyfen resistance in the greenhouse whitefly Trialeurodes vaporariorum [20]. Knockdown of the CYP6BG1 gene in P. xylostella by RNA interference (RNAi) significantly reduced the resistance to permethrin [21]. High levels of abamectin resistance in Tetranychus urticae are associated with the metabolism of abamectin by CYP392A16 [22]. The overexpression of the cytochrome P450 gene Cyp12a4 is associated with lufenuron resistance in a natural population of Drosophila melanogaster [23]. CYP9A12 and CYP9A14 are associated with pyrethroid resistance in Helicoverpa armigera [24]. Finally, a recent report indicated that CYP340 genes probably contribute to the detoxification of insecticides or plant toxins in P. xylostella [25].

Although P450s have been confirmed to be important for abamectin resistance in P. xylostella, the specific P450 genes associated with this resistance are unclear. We previously sequenced the transcriptomes of abamectin-susceptible and -resistant strains of P. xylostella using Illumina HiSeqTM 2000. We found that only one gene among the large P450 family was significantly up-regulated in the resistant strain (unpublished data). In the current study, we cloned and characterized this gene and investigated its function. Our objective was to clarify the characteristic of CYP340W1 gene in P. xylostella population and investigate role of CYP340W1 in the abamectin resistance of P. xylostella.

2. Results

2.1. Cloning and Characterization of the CYP340W1 Gene

The full-length sequence of the P450 gene was obtained by RT-PCR and RACE methods based on the partial sequence in the unpublished transcriptome database. The cDNA sequences were submitted to the P450 nomenclature committee, who assigned the gene to the CYP340 family and named it CYP340W1. The full-length cDNA of CYP340W1 includes a 1491-bp open reading frame (ORF), a 299-bp 5’-untranslated region (UTR) containing a TATA box, and a 139-bp 3’UTR containing a 26-bp poly-A tail. The predicted isoelectric point of the protein is 9.54, and the theoretical molecular weight is 56.29 kDa. The CYP340W1 cDNA encodes 496 amino acids. The amino acid sequence contains conserved domains characteristic of P450s such as the helix C motif (WxxxR, position 24), the oxygen-binding motif (helix I) (GxDTS, position 307), the helix K motif (ExxRxxP, position 363), and the heme-binding motif (FxxGxxxCxG, position 437) (Figure 1).

Figure 1.

Figure 1

Nucleotide sequence and deduced amino acid sequence of CYP340W1 in P. xylostella. The following P450 signature motifs are underlined in black: helix C motif (position 24), the oxygen-binding motif (helix I) (position 307), the helix K motif (position 363), and the heme-binding motif (position 437). The initiation and termination codons are shaded gray color. * indicates stop codon.

2.2. Expression Profile of CYP340W1 in Different Developmental Stages and Tissues of P. xylostella

Susceptible strain of P. xylostella was used to measure the CYP340W1 expression at different developmental stages and the expression profiling at tissue level was for the fourth instars. CYP340W1 was expressed during the entire life cycle of P. xylostella (Figure 2A). CYP340W1 levels were significantly higher in the second- and fourth-instar larvae than in other developmental stages (p < 0.05; Tukey’s test). The relative expression level of CYP340W1 was about six-fold higher in the head than in the other tissues (Figure 2B). The expression level was similar in tissues of the integument, midgut, malpighian tubules, and testis.

Figure 2.

Figure 2

Expression profiles of CYP340W1 in different developmental stages (A) and tissues of the fourth instars (B) of ABM-S. L1 to L4: the first- to fourth- instar larva. Expression in pupa (A) and midgut (B) was set to 1. Values are means ± SEs for three independent replicates. In each panel, means with different letters are significantly different (p < 0.05; Tukey’s test).

2.3. Transcriptional Response of CYP340W1 to Abamectin Exposure

The resistance ratio of the ABM-R strain was about 115-fold relative to the ABM-S strain (Table 1). In the absence of abamectin treatment, the CYP340W1 level was significantly higher in the ABM-R strain than in the ABM-S strain (Figure 3). To investigate the effect of abamectin on CYP340W1 in P. xylostella, the third-instar larvae of ABM-R were treated with abamectin at 0.4 mg/L, which is the LC10 value for the ABM-R strain (Table 1). The CYP340W1 expression level had increased significantly after 48 h with abamectin treatment (Figure 4). The most of mortality was realized within 48 h.

Table 1.

Susceptibility of P. xylostella strains to abamectin treatment.

Strain LC50 (mg/L) (95% FL) Slope ± SE Χ2 (df) RR a LC10 (95% FL) (mg/L) LC20 (95% FL) (mg/L)
ABM-S 0.024 (0.020–0.028) 1.862 ± 0.335 2.856 (3) 1 0.004 (0.001–0.009) 0.008 (0.013–0.015)
ABM-R 2.822 (2.013–4.920) 1.485 ± 0.257 5.529 (3) 114.96 0.478 (0.136–0.802) 0.879 (0.399–1.285)

a LC50: median lethal concentration; FL: 95% fiducial limits; SE: standard error; RR: resistance ratio; LC50 of ABM-R/LC50 of ABM-S; Χ2 is Chi square and df is degree of freedom.

Figure 3.

Figure 3

The relative expression of CYP340W1 in the fourth instars of ABM-S and ABM-R in the absence of abamectin treatment. Expression in the ABM-S strain was set to 1. Expression of the elongation factor 1 (EF1) and ribosomal protein L32 (RPL32) genes were used as the internal standard. Values are means and standard errors. The asterisk indicates a significant difference between the ABM-S and ABM-R strain (p < 0.05; Tukey’s test; n = 3).

Figure 4.

Figure 4

Relative gene expressions of CYP340W1 in ABM-R after the third instars were treated with LC10 concentration of abamectin for different time. Expression at 0 h was set to 1. Data are presented as means ± SE. The lowercase letters above the error bars mean significant difference in expression levels according to Tukey’s test p < 0.05 (n = 3).

2.4. Expression of CYP340W1 after RNAi

To investigate the efficiency of RNAi knockdown of CYP340W1 in third-instar larvae of P. xylostella, the levels of CYP340W1 mRNA were measured with qRT-PCR at 0 to 24 h after the larvae had been injected with CYP340W1 dsRNA. Relative to CYP340W1 expression levels injected with dsEGFP, the CYP340W1 expression levels injected with dsCYP340W1 were significantly reduced at 6, 12, and 18 h but not at 24 h after dsRNA injection (Figure 5).

Figure 5.

Figure 5

Relative expression levels of CYP340W1 (grey bars) at different times after CYP340W1 dsRNA was injected into third-stage larvae of ABM-R. Expression is relative to that of CYP340W1 injected dsEGFP (black bars), and CYP340W1 expression injected dsEGFP was set to 1. Values are means and standard errors. The lowercase letters above the error bars mean significant difference in expression levels according to Tukey’s test p < 0.05 (n = 3).

2.5. Effect of CYP340W1 Silencing on Larval Mortality

Third-stage larvae of ABM-R were placed in abamectin solutions 6 h after they had been injected with dsCYP340W1 or dsEGFP, and their mortality was assessed 48 h later. With both concentrations of abamectin, mortality was significantly higher after injection with dsCYP340W1 than after injection with dsEGFP (Figure 6). About 36% mortality was observed in larvae injected with dsCYP340W1 treated with 0.8 μg/mL (LC20) of abamectin, while only 13% mortality was observed in control larvae injected with dsEGFP. When the abamectin concentration was 2.8 μg/mL (LC50), about 63% mortality was detected in larvae injected with dsCYP340W1, while 40% mortality was observed in control.

Figure 6.

Figure 6

Mortality of strain ABM-R after the third instars were injected with dsRNA targeting CYP340W1 (grey bars) or with dsRNA targeting EGFP (black bars) and then treated with one of two concentrations of abamectin. The larvae were treated with abamectin 6 h after they had been injected with the dsRNA, and mortality was assessed 48 h later. Values are means and standard errors. Means with different letters are significantly different (p < 0.05; Tukey’s test; n = 3).

3. Discussion

Abamectin has been used to control P. xylostella for more than 20 years, and many P. xylostella populations worldwide have developed resistance to the insecticide [4,26,27]. Although cytochrome P450-mediated metabolic resistance is recognized as important in the resistance of P. xylostella [21,28], no cytochrome P450 gene from P. xylostella had been reported to be responsible for abamectin resistance before the current study. From our transcriptome database, we found that the expression of only one P450 gene was higher in abamectin-resistant than in abamectin-susceptible P. xylostella (unpublished dada). In the present study, the full-length cDNA of this gene was obtained by RT-PCR and RACE methods and was named CYP340W1 by the Nomenclature Committee.

P450 gene overexpression usually has two kinds of mechanism, on the one hand, genetic mutation gene promoter or enhancer [20], on the other hand, is caused by gene amplification quantity increases [29]. We used qRT-PCR to investigate the expression profile of CYP340W1. The results showed that CYP340W1 is expressed in all developmental stages of P. xylostella and that expression is highest in larvae. The expression of another P450 gene, CYP6A1, in the housefly is high in both larvae and adults but low in pupae and eggs [30]. In the Asian corn borer, CYP6AE25 is expressed in all life stages [31]. The current results suggest that cytochrome P450 CYP340W1 is more important in larvae than in eggs, pupae, or adults. It is well known that insect P450s are expressed in various tissues when the insects are exposed to diverse physiological and environmental stimuli [32]. Unlike other P450 genes that are highly expressed in the midgut [33,34], which is regarded as the primary detoxification organ, CYP340W1 is much more abundant in the head than in other tissues. The P450 gene CYP4G15 is also primarily expressed in the brain of third instars of Drosophila [35]. Abamectin is a neurotoxin insecticide that interferes with neural and neuromuscular system mostly by enhancing the glutamate-gate chloride channel [36]. The high expression of CYP340W1 in the heads of P. xylostella larvae might provide the last line of defense to protect the target site [37]. Zhu et al. found that the P450 gene CYP6BQ9 was predominantly expressed in the brain and was responsible for deltamethrin resistance in Tribolium castaneum. The authors suggested that the brain-specific expression of this gene could enhance the ability of brain cells to metabolize deltamethrin and to thus reduce the levels of the insecticide at the target site [38].

We found that the expression of CYP340W1 was significantly higher in an abamectin-resistant strain than in an abamectin-susceptible strain of P. xylostella. This is consistent with many reports that insecticide resistance is related to the overexpression of P450 genes [32,39,40]. Induced expression is an important way to study the insecticide resistance that is caused by detoxification enzymes. In Drosophila, for example, mutation resulting in the higher expression of an inducible cytochrome P450 gene was thought to be a likely way in which pesticide resistance developed [41]. The P450 gene CYP6BG1 in permethrin-resistant P. xylostella can be induced by a low dose of permethrin [42]. In the present study, CYP340W1 in the resistant strain was significantly induced by a low dose of abamectin. This induction suggested that CYP340W1 might be involved in abamectin resistance in P. xylostella. Because RNAi has been widely used to investigate gene functions in insecticide-resistant insects, we injected dsRNA of CYP340W1 into the third-instar larvae of the resistant strain and found that the expression level of CYP340W1 was significantly decreased at 6 h and was lowest at 12 and 18 h post injection. Based on previous reports, RNAi reduction in the expression level of P450 genes usually requires 24 h [21,28], i.e., the reduction documented in the current study occurred sooner than previously reported for other P450 genes in P. xylostella. We then found that larval mortality caused by abamectin in the abamectin-resistant strain of P. xylostella was significantly increased after CYP340W1 was silenced, strongly indicating that this gene is involved in abamectin resistance in P. xylostella.

4. Materials and Methods

4.1. Insects

A susceptible strain of P. xylostella (ABM-S) was originally collected in 1990 from a cabbage (Brassica sp.) field in Guangzhou, Guangdong Province, China, and has since been reared in the laboratory without further exposure to insecticide. The abamectin-selected strain (ABM-R) consisted of the offspring of ABM-S that had been selected with abamectin. The P. xylostella larvae were reared on cabbage plants under conditions of 25 ± 1 °C, 60%–70% relative humidity and a light: dark cycle of 16:8 h. Adults were provided with a 10% honey solution.

4.2. Chemicals and Bioassay

Abamectin (containing 93% avermectin B1a and 7% avermectin B1b) was obtained from the Department of Applied Chemistry, China Agricultural University. The leaf-dipping method (in which larvae are placed on segments of cabbage leaves that have been dipped into abamectin solutions) was used for the bioassay as described by Liu et al. [43] to establish LC50, LC20, and LC10 values. Five series of concentrations was set and each concentration was performed in three replicates with ten 3rd instar larvae for each replicate. For ABM-R strain the concentration ranged from 0.625 to 10 μg/mL, and for ABM-S strain the concentration ranged from 0.00625 to 0.1 μg/mL. Mortality was assessed at 48 h post-treatment. The Poloplus program (LeOra Software 2002) was used for probit analysis of the dose data.

4.3. Molecular Cloning of CYP340W1

Total RNA of the P. xylostella was exacted from the fourth instar larvae by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. First-strand cDNA was synthesized with the PrimeScript II 1st strand cDNA synthesis kit with oligo dT primer (Takara Biotechnology, Dalian, China). Rapid amplification of cDNA ends (RACE) with SMARTer RACE cDNA Amplification (Clontech, Palo Alto, CA, USA) kits was used to obtain the full-length cDNA of CYP340W1 following the manufacturer’s instructions. Gene-specific primers (GSPs) were designed with Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA), and the RACE primers were listed in Table 2. The 3’ RACE was performed directly using 3’ GSP1 and the universal adaptor primer (UPM). The PCR reactions (25 μL total volume) contained 15.5 μL of double-distilled H2O (ddH2O), 2.5 μL of 10× LA Taq Buffer, 2 μL of dNTP Mix, 1 μL of specific primer, 1.5 μL of first-strand cDNA template, 2 μL of UPM, and 0.5 μL of Advantage2 Taq HS (TaKaRa). The touchdown PCR reaction conditions were: five cycles of 94 °C for 30 s and 72 °C for 3 min; followed by five cycles of 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 3 min; and finally 25 cycles of 94 °C for 30 s, 66 °C for 30 s, and 72 °C for 3 min. In 5’RACE, the PCR reactions contained 15.7 μL of ddH2O, 2.5 μL of 10× LA Taq Buffer, 2 μL of dNTP Mix, 1 μL of specific primer, 2 μL of UPM, 1.5 μL of first-strand cDNA template, and 0.3 μL of LA Taq HS polymerase. The PCR reaction conditions were: five cycles of 94 °C for 30 s and 72 °C for 3 min; followed by five cycles of 94 °C for 30 s, 66 °C for 30 s, and 72 °C for 3 min; and finally 25 cycles of 94 °C for 30 s, 62 °C for 30 s, and 72 °C for 3 min. To verify the full-length of P450 cDNA, a pair of primers (CYP-Full-F and CYP-Full-R, Table 2) was used to amplify the open reading frame (ORF) of CYP340W1 cDNA. The PCR reactions (25 μL total volume) contained, 2.5 μL of 10× LA Taq Buffer, 2 μL of dNTP Mix, 1 μL of first-strand cDNA template, 1 μL of specific primer, 0.25 μL LA Taq HS polymerase (TaKaRa), and 18.25 μL of double-distilled H2O (ddH2O). All PCR reactions were carried out with a S1000 PCR Thermal Cycler (Bio-Rad, Shanghai, China). PCR was performed using the following program: an initial denaturation at 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 2 min and a final extension at 72 °C for 10 min.

Table 2.

Primers used for cloning and expression analysis of CYP340W1.

Experiment Primer Name Primer Sequence (5’-3’)
3’RACE CYP-RACE3’ CGGCTACGACACGTCTTCCACCACT
5’RACE CYP-RACE5’ GAACCGCTGCCGGGGGATGCTGAAC
Full-length confirmation CYP-Full-F CATCAATGTCTGTATCATTGCTTCT
CYP-Full-R TCTAGAAACATATTAATTAACAGGC
qRT-PCR CYP340-QF GTTTTCGGCAACTCGGACAG
CYP340-QR TGGGGATGGTCACGTTTTTC
Reference gene EF1-F GCCTCCCTACAGCGAATC
EF1-R CCTTGAACCAGGGCATCT
RPL32-F CCAATTTACCGCCCTACC
RPL32-R TACCCTGTTGTCAATACCTCT

The open reading frame (ORF) was predicted using the ORF Finder tool at the NCBI website (http://www.ncbi.nlm.nih.gov/guide/all/#tools_). The gene sequence was assembled with DNAMAN 7.0 (Lynnon BioSoft, San Ramon, CA, USA). The cDNA sequence was translated into an amino acid sequence with the translate tool at the ExPASy proteomic website (http://www.expasy.org/tools).

4.4. Quantitative RT-PCR

Using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR), we measured the relative expression levels of CYP340W1 in larvae of ABM-S and ABM-R strains. Relative expression levels of CYP340W1 were also measured in different developmental stages and in different tissues of fourth-instar ABM-S larvae. Regarding expression in different developmental stages including eggs, larvae (first to fourth instars), pupae, and female and male adults with one day old were used Regarding expression in different tissues, the head, integument, midgut, malpighian tubules, and testis of fourth-instar larvae were dissected and placed in PBS (137 mM/L NaCl, 2.7 mM/L KCl, 10 mM/L Na2HPO4, and 2 mM/L KH2PO4). Abamectin induction of the CYP340W1 gene was measured by the leaf-dipping method, i.e., third-instar larvae of the ABM-R strain were placed on segments of cabbage leaves that had been dipped in a solution containing 0.4 mg of abamectin/L (the LC10); CYP340W1 induction was measured by qRT-PCR after the larvae had been on the leaves for 1, 2, and 3 days. Dissociation curve of four replicates using five 2-fold serial dilutions (1:1, 1:2, 1:4, 1:8, and 1:16) were analyzed to obtain the amplification efficiencies and linear correlation between the quantity of cDNA templates and the quantity of PCR product, which was generated by the gene-specific primers. Screening all the results, only those with single-peak melting curve and 95%–100% primer amplification efficiencies were adopted. Four technical replicates and three biological replicates were used for each treatment.

After total RNA for RT-qPCR was extracted using TRIzol reagent (Invitrogen), 1 μg was used to prepare the first-strand cDNA using the PrimeScript RT kit (containing gDNA Eraser, Perfect Real Time) (TaKaRa) following the manufacturer’s instructions. qRT-PCR was performed with an ABI PRISM 7500 Real-time PCR System (Applied Biosystems, Foster, CA, USA) using the SuperReal PreMix Plus (SYBR Green) kit (Tiangen, Beijing, China). The primers CYP340-QF and CYP340-QR (Table 2) were designed with Primer Premier 5 software to specifically amplify a 160-bp fragment of the CYP340W1 gene. The primer elongation factor 1 gene (EF1) accession number EF417849 and ribosomal protein L32 gene (RPL32) accession number AB180441 (Table 2) were used as reference genes [44]. Normalizing the CYP340W1 expression with two housekeeping genes was performed according to Vandesompele et al. (2002) [45]. PCR reactions (20 μL) contained 2 μL of cDNA, 0.5 μL of forward primer, 0.5 μL of reverse primer, 10 μL of 2× SuperReal PreMix Plus, 0.4 μL of 50× ROX Reference Dye, and 6.6 μL of RNase-free ddH2O. The thermal cycling conditions included polymerase activation at 95 °C for 15 min followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 32 s, and elongation at 72 °C for 32 s. The melt curve analysis included a final step at 95 °C for 15 s and 60 °C for 60 s. The RT-qPCR analysis included three biological replicates and four technical replicates for each treatment. The relative abundance of gene transcripts was calculated according to the 2−∆∆Ct method [46].

4.5. dsRNA Synthesis

A double-stranded RNA (465 bp) corresponding to a portion of the CYP340w1 gene was synthesized. The amplicon was used as template for in vitro transcription reactions to generate dsRNA using the T7 Ribomax Express RNAi System (Promega, Madison, WI, USA). The P. xylostella genome was blasted and designed to the specific region of dsRNA to avoid potential off-target effects. The SnapDragon tool (http://www.flyrnai.org/cgi-bin/RNAi_find_primers.pl) was used to design specific primers as shown in Table 2. The PCR products of 465 bp were examined on agarose gel before in vitro transcription to verify that the products consisted of a single band of the expected sizes. EGFP was used as reference gene, and the primers for dsEGFP were used according to Guo et al. (2015) [47]. Injection was performed with the volume ratio 1:1 of Metafectene PRO transfection reagent (Biontex, Planegg, Germany) Mixed at 25 °C after incubation for 20 min to increase dsRNA stability and facilitate dsRNA delivery. All dsRNA preparations were quantified and then stored at −20 °C.

4.6. RNAi Assays

Expression of the CYP340W1 gene was silenced by injecting CYP340W1 dsRNA into the early third-instar of P. xylostella larvae of the ABM-R strain. Sterilized fine glass capillary microinjection needles was pulled by P-97 micropipette puller (Sutter Instrument, Novato, CA, USA), which was used to deliver 70 nL of injection dsCYP340W1 (300 ng) or dsEGP (containing Metafectene PRO solution) into the hemocoel of each larva. The injection was carried out with an SXZ10 microscope and nanoliter 2000 microinjection system (World Precision Instruments Inc. Sarasota, FL, USA) The treated larvae were starved for 6 h and anesthetized for 30 min on ice before injection. The experiment was performed for three times and over 20 larvae were injected for each time to investigate effectiveness of RNAi. At 0 to 24 h post-injection, total RNA was isolated from the specimens as described earlier, and tested expression of CYP340W1 by qRT-PCR.

The effect of RNAi resulting from injection of dsCYP340W1 or dsEGFP was assessed by measuring mortality of injected larvae after they were exposed to abamectin via the leaf-dip bioassay; the leaf-dip bioassay was initiated 6 h after dsRNA injection and used abamectin concentrations approximating the LC20 value (0.8 μg/mL) and LC50 value (2.8 μg/mL). The leaf-dip assays were terminated after 48 h. Bioasssays were performed with thirty larvae per RNAi treatment and abamectin concentration, and each bioassay replicated three times.

4.7. Statistical Analysis

Results are presented as means and standard errors. The means were separated by Tukey’s test at p < 0.05 using SPSS 19.0 for Windows (SPSS Inc., Chicago, IL, USA).

5. Conclusions

In conclusion, we identified and characterized a cytochrome P450 gene, CYP340W1, in P. xylostella. The expression of CYP340W1 was significantly up-regulated in an abamectin-resistant strain of P. xylostella. CYP340W1 was induced by a low dose of abamectin. Microinjection of dsRNA of CYP340W1 significantly reduced CYP340W1 expression and significantly increased the susceptibility of resistant larvae to abamectin. Overall, the results suggest that overexpression of CYP340W1 plays an important role in abamectin resistance in P. xylostella.

Acknowledgments

All This work was funded by grants from the National Science and Technology Support task (2012BAD19B06), the Natural Science Foundation of China (31171876), the Special Fund for Agro-scientific Research in the Public Interest (201103021), the Beijing Key Laboratory for Pest Control and Sustainable Cultivation of Vegetables, and the Science and Technology Innovation Program of the Chinese Academy of Agricultural Sciences (AAS-ASTIP-IVFCAAS).

Author Contributions

Xue Gao and Jiaqiang Yang conceived and designed the experiments; Xue Gao performed the experiments; Jiaqiang Yang and Xue Gao analyzed the data; Baoyun Xu, Wen Xie, Shaoli Wang, Youjun Zhang and Fengshan Yang contributed reagents/materials/analysis tools; Xue Gao and Qingjun Wu wrote the paper; Qingjun Wu contributed to the final editing and supervised.

Conflicts of Interest

The authors declare no conflict of interest.

References

  • 1.Furlong M.J., Wright D.J., Dosdall L.M. Diamondback moth ecology and management: Problems, progress and prospects. Annu. Rev. Entomol. 2013;58:517–541. doi: 10.1146/annurev-ento-120811-153605. [DOI] [PubMed] [Google Scholar]
  • 2.Burg R.W., Miller B.M., Baker E.E., Birnbaum J., Currie S.A., Hartman R., Kong Y.L., Monaghan R.L., Olson G., Putter I., et al. Avermectins, new family of potent anthelmintic agents: Producing organism and fermentation. Antimicrob. Agents Chemother. 1979;15:361–367. doi: 10.1128/AAC.15.3.361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Putter I., Mac Connell J.G., Preiser F.A., Haidri A.A., Ristich S.S., Dybas R.A. Avermectins: Novel insecticides, acaricides and nematicides from a soil microorganism. Cell. Mol. Life Sci. 1981;37:963–964. doi: 10.1007/BF01971780. [DOI] [Google Scholar]
  • 4.Iqbal M., Wright D.J. Evaluation of resistance, cross-resistance and synergism of abamectin and teflubenzuron in a multi-resistant field population of Plutella xylostella (Lepidoptera: Plutellidae) Bull. Entomol. Res. 1997;87:481–486. doi: 10.1017/S0007485300041341. [DOI] [Google Scholar]
  • 5.De Oliveira A.C., Abreu de Siqueira H.A., de Oliveira J.V., Da Silva J.E., Michereff Filho M. Resistance of brazilian diamondback moth populations to insecticides. Sci. Agricola. 2011;68:154–159. [Google Scholar]
  • 6.Attique M.N.R., Khaliq A., Sayyed A.H. Could resistance to insecticides in Plutella xylostella (Lep., Plutellidae) be overcome by insecticide mixtures? J. Appl. Entomol. 2006;130:122–127. doi: 10.1111/j.1439-0418.2006.01035.x. [DOI] [Google Scholar]
  • 7.Pu X., Yang Y., Wu S., Wu Y. Characterisation of abamectin resistance in a field-evolved multiresistant population of Plutella xylostella. Pest Manag. Sci. 2010;66:371–378. doi: 10.1002/ps.1885. [DOI] [PubMed] [Google Scholar]
  • 8.Abro G.H., Syed T.S., Kalhoro A.N., Sheikh G.H., Awan M.S., Jessar R.D., Shelton A.M. Insecticides for control of the diamondback moth, Plutella xylostella (L.)(Lepidoptera: Plutellidae) in Pakistan and factors that affect their toxicity. Crop Prot. 2013;52:91–96. doi: 10.1016/j.cropro.2013.05.017. [DOI] [Google Scholar]
  • 9.Lai K.P., Liao P.F., Mo Y.B., Fang F., Ye Y.Q. Toxicity and field efficacy of abamectin 0.8% CS against main vegetable pests. Plant Prot. 2011;37:157–160. [Google Scholar]
  • 10.Liang P., Gao X.W., Zheng B.Z. Genetic basis of resistance and studieson cross-resistance in a population of diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) Pest Manag. Sci. 2003;59:1232–1236. doi: 10.1002/ps.760. [DOI] [PubMed] [Google Scholar]
  • 11.Wu Q.J., Zhang W.J., Zhang Y.J., Xu B.Y., Zhu G.R. Cuticular penetration and desensitivity of GABA_ (A) receptor in abamectin resistant Plutella xylostella. L. Acta Entomol. Sin. 2002;45:336–340. [Google Scholar]
  • 12.Qian L., Cao G.C., Song J.X., Yin Q., Han Z. Biochemical mechanisms conferring cross-resistance between tebufenozide and abamectin in Plutella xylostella. Pestic. Biochem. Physiol. 2008;91:175–179. doi: 10.1016/j.pestbp.2008.03.011. [DOI] [Google Scholar]
  • 13.Huang H.S., Hu N.T., Yao Y.E., Wu C.Y., Chiang S.W., Sun C.N. Molecular cloning and heterologous expression of a glutathione S-transferase involved in insecticide resistance from the diamondback moth, Plutella xylostella. Insect Biochem. Mol. Biol. 1998;28:651–658. doi: 10.1016/S0965-1748(98)00049-6. [DOI] [PubMed] [Google Scholar]
  • 14.Zhou X.M., Wu Q.J., Zhang Y.J., Bai L.Y., Huang X.Y. Cloning and characterization of a GABA receptor from Plutella xylostella (Lepidoptera: Plutellidae) J. Econ. Entomol. 2008;101:1888–1896. doi: 10.1603/0022-0493-101.6.1888. [DOI] [PubMed] [Google Scholar]
  • 15.Tian L.X., Yang J.Q., Hou W.J., Xu B.Y., Xie W., Wang S.L., Zhang Y.J., Zhou X.G., Wu Q.J. Molecular cloning and characterization of a P-glycoprotein from the diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) Int. J. Mol. Sci. 2013;14:22891–22905. doi: 10.3390/ijms141122891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Eldefrawi M.E., Miskus R., Sutcher V. Methylenedioxyphenyl derivatives as synergists for carbamate insecticides in susceptible, DDT-and parathion-resistant house flies. J. Econ. Entomol. 1960;53:231–234. doi: 10.1093/jee/53.2.231. [DOI] [Google Scholar]
  • 17.Demaeght P., Dermauw W., Tsakireli D., Khajehali J., Nauen R., Tirry L., Vontas J., Lümmen P., Leeuwen T.V. Molecular analysis of resistance to acaricidal spirocyclic tetronic acids in Tetranychus urticae: CYP392E10 metabolizes spirodiclofen. Insect Biochem. Mol. Biol. 2013;43:544–554. doi: 10.1016/j.ibmb.2013.03.007. [DOI] [PubMed] [Google Scholar]
  • 18.Zhou X.J., Ma C.X., Li M., Sheng C.F., Liu H.X., Qiu X.H. CYP9A12 and CYP9A17 in the cotton bollworm Helicoverp armigera: Sequence similarity, expression profile and xenobiotic response. Pest Manag. Sci. 2010;66:65–73. doi: 10.1002/ps.1832. [DOI] [PubMed] [Google Scholar]
  • 19.Li X.C., Schuler M.A., Berenbaum M.R. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 2007;52:231–253. doi: 10.1146/annurev.ento.51.110104.151104. [DOI] [PubMed] [Google Scholar]
  • 20.Karatolos N., Williamson M.S., Denholm I., Gorman K., Richard H., Ffrench-Constant R.H., Bass C. Over-expression of a cytochrome P450 is associated with resistance to pyriproxyfen in the greenhouse whitefly Trialeurodes vaporariorum. PLoS ONE. 2012;7:274. doi: 10.1371/journal.pone.0031077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bautista M.A.M., Miyata T., Miura K., Tanaka T. RNA interference-mediated knockdown of a cytochrome P450, CYP6BG1, from the diamondback moth, Plutella xylostella, reduces larval resistance to permethrin. Insect Biochem. Mol. Biol. 2009;39:38–46. doi: 10.1016/j.ibmb.2008.09.005. [DOI] [PubMed] [Google Scholar]
  • 22.Riga M., Tsakireli D., Ilias A., Morou E., Myridakis A., Stephanou E.G., Nauen R., Dermauw W. Abamectin is metabolized by CYP392A16, a cytochrome P450 associated with high levels of acaricide resistance in Tetranychus urticae. Insect Biochem. Mol. Biol. 2014;46:43–53. doi: 10.1016/j.ibmb.2014.01.006. [DOI] [PubMed] [Google Scholar]
  • 23.Bogwitz M.R., Chung H., Magoc L., Rigby S., Wong W., Keefe M.O., Mckenzie J.A., Batterham P., Daborn P.J. Cyp12a4 confers lufenuron resistance in a natural population of Drosophila melanogaster. Proc. Natl. Acad. Sci. USA. 2005;102:12807–12812. doi: 10.1073/pnas.0503709102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yang Y.H., Yue L., Chen S., Wu Y.D. Functional expression of Helicoverpa Armigera CYP9A12 and CYP9A14 in Saccharomyces cerevisiae. Pestic. Biochem. Physiol. 2008;92:101–105. doi: 10.1016/j.pestbp.2008.07.001. [DOI] [Google Scholar]
  • 25.Yu L.Y., Tang W.Q., He W.Y., Ma X.L., Vasseur L., Baxter S.W., Yang G., Huang S.G., Song F.Q., You M.S. Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.) Sci. Rep. 2015;5 doi: 10.1038/srep08952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kao C.H., Cheng E.Y. Insecticide resistance in Plutella xylostella L. XI. Resistance to newly introduced insecticides in Taiwan (1990–2001) Agric. Res. China. 2001;50:80–89. [Google Scholar]
  • 27.Santos V.C., de Siqueira H.A.A., da Silva J.E., de Farias M.J.D.C. Insecticide resistance in populations of the diamondback moth, Plutella xylostella (L.) (Lepidoptera: Plutellidae), from the state of Pernambuco, Brazil. Neotrop. Entomol. 2011;40:264–270. doi: 10.1590/S1519-566X2011000200017. [DOI] [PubMed] [Google Scholar]
  • 28.Hu Z., Lin Q., Chen H., Li Z., Yin F., Feng X. Identification of a novel cytochrome P450 gene, CYP321E1 from the diamondback moth, Plutella Xylostella (L.) and RNA interference to evaluate its role in chlorantraniliprole resistance. Bull. Entomol. Res. 2014;104:716–723. doi: 10.1017/S0007485314000510. [DOI] [PubMed] [Google Scholar]
  • 29.Puinean A.M., Foster S.P., Oliphant L., Denholm L., Field L.M., Millar N.S., Williamson M.S., Bass C. Amplification of a cytochrome P450 gene is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae. PLoS Genet. 2010;6:274. doi: 10.1371/journal.pgen.1000999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Carino F.A., Koener J.F., Plapp F.W., Feyereisen R. Constitutive overexpression of the cytochrome P450 gene CYP6A1 in a house fly strain with metabolic resistance to insecticides. Insect Biochem. Mol. Biol. 1994;24:411–418. doi: 10.1016/0965-1748(94)90034-5. [DOI] [PubMed] [Google Scholar]
  • 31.Zhang Y.L., Kulye M., Yang F.S., Xiao L., Zhang Y.T., Zeng H.M., Wang J.H., Liu Z.X. Identification, characterization, and expression of a novel P450 gene encoding CYP6AE25 from the Asian corn borer, Ostrinia. furnacalis. J. Insect Sci. 2011;11 doi: 10.1673/031.011.0137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Feyereisen R. Insect cytochrome P450. Compr. Mol. Insect Sci. 2005;4:1–77. [Google Scholar]
  • 33.Mao Y.B., Cai W.J., Wang J.W., Hong G.J., Tao X.Y., Wang L.J., Huang Y.P., Chen X.Y. Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotechnol. 2007;25:1307–1313. doi: 10.1038/nbt1352. [DOI] [PubMed] [Google Scholar]
  • 34.Snyder M.J., Stevens J.L., Andersen J.F., Feyereisen R. Expression of cytochrome P450 genes of the CYP4 family in midgut and fat body of the tobacco hornworm, Manduca. sexta. Arch. Biochem. Biophys. 1995;321:13–20. doi: 10.1006/abbi.1995.1362. [DOI] [PubMed] [Google Scholar]
  • 35.Maıbeche-Coisne M., Monti-Dedieu L., Aragon S., Dauphin-Villemant C. A new cytochrome P450 from Drosophila melanogaster, CYP4G15, expressed in the nervous system. Biochem. Biophys. Res. Commun. 2000;273:1132–1137. doi: 10.1006/bbrc.2000.3058. [DOI] [PubMed] [Google Scholar]
  • 36.Ghosh R., Andersen E.C., Shapiro J.A., Gerke J.P., Kruglyak L. Natural variation in a chloride channel subunit confers avermectin resistance in C. elegans. Science. 2012;335:574–578. doi: 10.1126/science.1214318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Korytko P.J., Scott J.G. CYP6D1 protects thoracic ganglia of houseflies from the neurotoxic insecticide cypermethrin. Arch. Insect Biochem. Physiol. 1998;37:57–63. doi: 10.1002/(SICI)1520-6327(1998)37:1&#x0003c;57::AID-ARCH7&#x0003e;3.0.CO;2-S. [DOI] [PubMed] [Google Scholar]
  • 38.Zhu F., Parthasarathy R., Bai H., Woithe K., Kaussmann M., Nauen R., Harrison D.A., Palli S.R. A brain-specific cytochrome P450 responsible for the majority of deltamethrin resistance in the QTC279 strain of Tribolium castaneum. Proc. Natl. Acad. Sci. USA. 2010;107:8557–8562. doi: 10.1073/pnas.1000059107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Festucci-Buselli R.A., Carvalho-Dias A.S., Oliveira-Andrade D., Caixeta-Nunes C., Li H.M., Stuart J.J., Muir W., Scharf M.E., Pittendrigh B.R. Expression of Cyp6g1 and Cyp12d1 in DDT resistant and susceptible strains of Drosophila melanogaster. Insect Mol. Biol. 2005;14:69–77. doi: 10.1111/j.1365-2583.2005.00532.x. [DOI] [PubMed] [Google Scholar]
  • 40.Zhu F., Liu N. Differential expression of CYP6A5 and CYP6A5v2 in pyrethroid-resistant house flies, Musca domestica. Arch. Insect Biochem. Physiol. 2008;34:147–161. doi: 10.1002/arch.20225. [DOI] [PubMed] [Google Scholar]
  • 41.Le Goff G., Hilliou F., Siegfried B.D., Boundy S., Wajnberg E., Sofer L., Audant P., Ffrench-constant R.H., Feyereisen R. Xenobiotic response in Drosophila melanogaster: Sex dependence of P450 and GST gene induction. Insect Biochem. Mol. Biol. 2006;36:674–682. doi: 10.1016/j.ibmb.2006.05.009. [DOI] [PubMed] [Google Scholar]
  • 42.Bautista M.A.M., Tanaka T., Miyata T. Identification of permethrin-inducible cytochrome P450s from the diamondback moth, Plutella xylostella (L.) and the possibility of involvement in permethrin resistance. Pestic. Biochem. Physiol. 2007;87:85–93. doi: 10.1016/j.pestbp.2006.06.004. [DOI] [Google Scholar]
  • 43.Liu F., Shi X.Z., Liang Y.P., Wu Q.J., Xu B.Y., Xie W., Wang S.L., Zhang Y.J., Liu N.N. A 36-bp deletion in the alpha subunit of glutamate-gated chloride channel contributes to abamectin resistance in Plutella xylostella. Entomol. Exp. Appl. 2014;153:85–92. doi: 10.1111/eea.12232. [DOI] [Google Scholar]
  • 44.Vandesompele J., de Preter K., Pattyn F., Poppe B., Roy N.V., de Paepe A., Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3 doi: 10.1186/gb-2002-3-7-research0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Guo Z.J., Kang S., Zhu X., Xia J.X., Wu Q.J., Wang S.L., Xie W., Zhang Y.J. The novel ABC transporter ABCH1 is a potential target for RNAi-based insect pest control and resistance management. Sci. Rep. 2015;5 doi: 10.1038/srep13728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 47.Guo Z.J., Kang S., Chen D.F., Wu Q.J., Wang S.L., Xie W., Zhu X., Baxter S.W., Zhou X.G., Jurat-fuentes J.L., et al. MAPK signaling pathway alters expression of midgut ALP and ABCC genes and causes resistance to Bacillus thuringiensis Cry1Ac toxin in damondback moth. PLoS Genet. 2015;11:274. doi: 10.1371/journal.pgen.1005124. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES