Crystal structure of the Mycobacterium tuberculosis transcriptional regulator Rv0302

Abstract

Mycobacterium tuberculosis is a pathogenic bacterial species, which is neither Gram positive nor Gram negative. It has a unique cell wall, making it difficult to kill and conferring resistance to antibiotics that disrupt cell wall biosynthesis. Thus, the mycobacterial cell wall is critical to the virulence of these pathogens. Recent work shows that the mycobacterial membrane protein large (MmpL) family of transporters contributes to cell wall biosynthesis by exporting fatty acids and lipidic elements of the cell wall. The expression of the Mycobacterium tuberculosis MmpL proteins is controlled by a complicated regulatory network system. Here we report crystallographic structures of two forms of the TetR‐family transcriptional regulator Rv0302, which participates in regulating the expression of MmpL proteins. The structures reveal a dimeric, two‐domain molecule with architecture consistent with the TetR family of regulators. Comparison of the two Rv0302 crystal structures suggests that the conformational changes leading to derepression may be due to a rigid body rotational motion within the dimer interface of the regulator. Using fluorescence polarization and electrophoretic mobility shift assays, we demonstrate the recognition of promoter and intragenic regions of multiple mmpL genes by this protein. In addition, our isothermal titration calorimetry and electrophoretic mobility shift experiments indicate that fatty acids may be the natural ligand of this regulator. Taken together, these experiments provide new perspectives on the regulation of the MmpL family of transporters.

Introduction

Tuberculosis (TB) is a leading cause of death due to infectious disease despite the availability of antitubercular drugs. Its causative agent, Mycobacterium tuberculosis (Mtb), infects more than one third of the world's population.1 The unique architecture of the mycobacterial cell wall plays a key role in the host–pathogen interface since it is associated with the Mtb pathogenesis and provides a barrier against environmental stresses, antibiotics, and the host immune response. The outer membrane contains an inner leaflet of very long chain mycolic acids covalently bound to the arabinogalactan–peptidoglycan layer and an outer leaflet composed of noncovalently associated lipids, such as phthiocerol dimycocerosate, sulfolipids, and trehalose 6,6′‐dimycolate.2 These surface‐exposed lipids are immunomodulatory and play a role in host–pathogen interactions.3, 4, 5, 6, 7, 8

Recent work demonstrated that the mycobacterial membrane protein large (MmpL) proteins are cell wall lipid transporters. The MmpL transporters are crucial contributors to mycobacterial physiology and pathogenesis. MmpL3 is essential; MmpL4, MmpL5, MmpL7, MmpL8, MmpL10, and MmpL11 are required for full Mtb virulence.9, 10, 11, 12 MmpL3 transports the trehalose dimycolate (TDM) precursor trehalose monomycolate to the mycobacterial surface.12 MmpL3 is therefore essential since TDM biosynthesis and incorporation into the mycobacterial cell wall is required for mycobacterial replication and viability.13, 14

Based on the genomic sequence of H37Rv,15 Mtb harbors 14 different MmpL proteins, belonging to the resistance‐nodulation‐cell division (RND) superfamily of transporters.16 Similar to the RND efflux pumps of Gram‐negative bacteria, several of these MmpL transporters appear to work in conjunction with smaller accessory proteins called mycobacterial membrane protein small (MmpS).9, 17, 18 However, unlike other RND family proteins, the MmpL proteins are not believed to export antibiotics.9 Instead, there is strong evidence that these MmpL transporters and their MmpS accessory proteins are responsible for shuttling fatty acid and lipid components of the cell wall, such as trehalose monomycolate, sulfolipids, phthiocerol dimycocerosate, diacyltrehalose, monomeromycolyl diacylglycerol, and mycolate wax ester.3, 9, 11, 12, 19, 20, 21, 22, 23

The regulation of MmpL protein expression and the role of MmpLs in cell wall remodeling in different environmental conditions has not been explored. Thus we capitalized on data made available by the TB Systems Biology Consortium to begin an in‐depth analysis of how mmpL and mmpS genes are regulated. Currently, chromatin immunoprecipitation sequencing (ChIP‐Seq) data for 82 of the 180+ Mtb transcription factors is available on the TBDatabase (TBDB).24, 25, 26, 27 We recently demonstrated that the MarR‐family regulator Rv0678 regulates the mmpS2‐mmpL2, mmpS4‐mmpL4, and mmpS5‐mmpL5 genes. We also identified that the crystal structure of Rv0678 is bound with a fatty acid glycerol ester 2‐palmitoylglycerol (C₂₁H₄₂O₄), suggesting that fatty acids may be the natural ligands of this regulator.28 This structure has allowed us to elucidate the induction mechanism, where the induced conformational change leading to substrate‐mediated derepression is primarily caused by a rigid body rotational motion of the entire DNA‐binding domain of the regulator toward the dimerization domain.28

In this article, we report crystal structures of two conformational forms of the TetR‐family transcriptional regulator Rv0302, which has predicted regulatory interactions within the mmpL3 and mmpL11 loci. Binding of this transcriptional regulator to the promoter and intragenic regions of mmpL genes is summarized in Figure 1. Typically, the TetR‐family regulators are all helical dimeric proteins, consisting of a smaller N‐terminal DNA‐binding domain and a larger C‐terminal regulatory domain.29, 30 The N‐terminal domains are quite conserved in protein sequences and form a helix‐turn‐helix (HTH) motif for DNA binding. However, the C‐terminal sequences are poorly conserved, forming ligand‐specific binding domains for inducing molecules. Our crystal structures of Rv0302 suggest that ligand binding at the C‐terminal regulatory domain triggers a rotational motion of the regulator. This motion results in inducing the expression of the MmpL transporters by releasing the Rv0302 regulator from cognate DNAs. Using fluorescence polarization and electrophoretic mobility shift assay (EMSA), we demonstrate that Rv0302 is able to bind the promoter regions of these mmpL genes within a nanomolar range.

Figure 1.

Schematic depiction of Rv0302 binding sites in the mmpL genes of interest. ChIPSeq data were obtained from TBDB (www.tbdb.org). In these experiments, FLAG‐tagged (DYKDDDDK) transcription factors were episomally expressed in Mtb under the control of an anhydrotetracycline‐inducible promoter (Galagan et al.27). The red circles corresponding to the Rv0302 transcription factor are placed at the putative binding sites.

Results and Discussion

Overall structure of Rv0302

M. tuberculosis Rv0302 is a 210 amino acid (aa) protein that belong to the TetR family of transcriptional regulators. Two distinct conformations of Rv0302 with space groups P6₁22 (form I) and P2₁2₁2₁ (form II) were captured in two different forms of crystals. The form I structure was determined to a resolution of 2.04 Å using single isomorphous replacement. The form II conformation was resolved to a resolution of 2.65 Å using molecular replacement with anomalous scattering using the form I structure as a search model (Table 1 and Fig. 2). By applying the crystallographic symmetry operators, a dimeric arrangement of the structure was found. In the form II structure, two monomers were found in the asymmetric unit arranged as a dimer. Overall, the architecture of these two Rv0302 structures are in good agreement with those of the TetR‐family regulators, including TetR,31, 32 QacR,33, 34 CprB,35 EthR,36, 37 CmeR,38, 39 AcrR,40 SmeT,41 Rv3066,42 and Rv1219c.43

Table 1.

Data Collection, Phasing, and Structural Refinement Statistics of Rv0302

Data set	Form I	Ta6 ${\text{Br}}_{12}^{2+}$ derivative	Form II
PDB ID	5D18		5D19
Data collection
Wavelength (Å)	0.9792	1.2550	0.9792
Space group	P6122	P6122	P21212
Cell constants (Å)
A	116.6	117.7	46.1
B	116.6	117.7	77.1
C	94.1	93.7	118.6
α, β, γ (°)	90,90,120	90,90,120	90,90,90
Resolution (Å)	2.04 (2.11–2.04)	4.10 (4.25–4.10)	2.65 (2.74–2.65)
Completeness (%)	99.8 (100)	91.4 (92.1)	97.3 (97.6)
Total reflections	216,053	303,871	847,565
Unique reflections	24,642	3,377	12,880
Redundancy	7.6 (7.6)	3.1 (3.0)	4.5 (4.5)
R merge (%)	4.3 (38.3)	13.0 (39.4)	10.5 (33.4)
⟨I/σ(I)⟩	52.6 (4.9)	8.3 (3.7)	12.2 (3.7)
Phasing
Number of sites		2
Resolution used (Å)		4.1
Phasing power (acentric/centric)		0.81/0.55
R Cullis (acentric/centric)		0.88/0.84
Figure of merit (acentric/centric)		0.34/0.19
Refinement
Resolution (Å)	40–2.04		40–2.65
R work (%)	19.2		23.3
R free (%)	21.5		26.8
B‐factors
Overall (Å2)	55.2		49.5
Ligands (Å2)	51.5
Rms deviations
Bond (Å)	1.336		0.576
Angles (°)	0.013		0.002
Ramachandran analysis
Most favored (%)	97.8		98.0
Allowed (%)	2.2		2.0
Generously allowed (%)	0.0		0.0
Disallowed (%)	0.0		0.0

Figure 2.

Electron density maps of the M. tuberculosis Rv0302 regulator. (A) Stereo view of the experimental electron density map of the form I structure at a resolution of 2.04 Å. The electron density map is contoured at 1.0σ. The Cα traces of the Rv0302 molecule in the asymmetric unit is colored green. Anomalous signals of the two Ta₆ ${\text{Br}}_{12}^{2+}$ cluster sites (contoured at 3σ) found in the asymmetric unit are colored red. (B) Representative section of electron density in the vicinity of helices α4 and α7. The solvent‐flattened electron density (40–2.04 Å) is contoured at 1.0σ and superimposed with the final refined model (green, carbon; red, oxygen; blue nitrogen; yellow, sulfur). (C) Stereo view of the electron density map of the form II structure at a resolution of 2.65 Å. The electron density map is contoured at 1.0σ. The Cα traces of the Rv0302 molecules in the asymmetric unit are in orange and yellow.

Each subunit of Rv0302 is composed of nine helices (α1–α9 and α1′–α9′, respectively) that are organized to form two functional motifs: the N‐terminal DNA‐binding and C‐terminal ligand‐binding domains (Fig. 3). The helices of Rv0302 are designated numerically from the N‐terminus as α1 (residues 14–29), α2 (residues 37–44), α3 (residues 48–55), α4 (residues 58–76), α5 (residues 88–104), α6 (residues 107–117), α7 (residues 123–147), α8 (residues 154–181), and α9 (residues 188–208). In this arrangement, the smaller N‐terminal DNA‐binding domain includes helices α1 through α3 and the N‐terminal end of α4 (residues 58–65), with α2 and α3 forming a typical HTH motif. However, the larger C‐terminal ligand‐binding domain comprises the C‐terminal end of helices α4 (residues 66–76) through α9. Helices α6, α8, and α9 are involved in the dimerization of the regulator, and helix α9 contacts both α8 and α9′ to secure the dimerization interface.

Figure 3.

Structure of the M. tuberculosis Rv0302 regulator. (A) Ribbon diagram of a protomer of the form I structure of Rv0302. The molecule is colored using a rainbow gradient from the N‐terminus (blue) to the C‐terminus (red). (B) Ribbon diagram of the form I structure of the Rv0302 dimer. Each subunit of Rv0302 is labeled with a different color (red and yellow). The Figure was prepared using PyMOL (http://www.pymol.sourceforge.net).

In both form I and form II structures, the 21 aa helix α9 folds uniquely along the top of the dimer, forming the ceiling for the ligand‐binding domain. To make space for this fold, helix α8 is oriented at an approximate 25° angle away from the dimerization interface. Comparing the dimeric structures of forms I and II suggests that these two structures depict two different transient states of the regulator. Superimposition of the forms I and II dimeric structures of Rv0302 results in an overall rms deviation of 3.0 Å. The difference between the two conformations is a 9° rotational motion of the right subunit with respect to the left protomer (Fig. 4). Based on this structural information, it is likely that ligand binding triggers a rotational motion within the dimer of the regulator. Presumably, this movement prohibits the binding of the dimeric regulator to its cognate DNA, which in turn releases the regulator from the promoter region and allows for the expression of the corresponding MmpL transporters. If this is the case, then the form I conformation should correspond to the ligand induced form of the Rv0302 regulator.

Figure 4.

Structural comparison of forms I and II of the Rv0302 regulator. (A) This is a superimposition of the dimeric structures of forms I and II (green, form I; orange, form II). For clarity, only the right subunit of helices α1–α9 the form II structure (orange) are labeled. The arrow indicates a change in orientation of the right subunit of form I when compared with the structure of form II. (B) Side view of the superimposition of the dimeric structures of forms I and II (green, form I; orange, form II). For clarity, only the right subunit of helices α1–α9 of form II structure (orange) are labeled. This view depicts a 9° rigid body rotation of the right subunit (α1–α9) of form I with respect to that of form II.

The C‐terminal regulatory domain of each subunit of the Rv0302 structures forms a large cavity, presumably creating a ligand‐binding pocket of the regulator. This cavity, which is predominately formed by helices α4–α9, orients more or less vertically and in parallel with the twofold symmetry axis of the dimer. At least 24 amino acids line the wall of this cavity. Among them, eight are aromatic residues (F73, F74, W80, F112, Y113, F140, Y176, and Y192), 11 are hydrophobic residues (I77, L95, L98, L109, V132, A136, L137, L147, V169, and L199), and five are polar or charged residues (S91, Q94, Q102, S143, and D173). Based on these observations, ligand binding in Rv0302 is predominately governed by hydrophobic interactions.

An extra electron density was found within the ligand‐binding pocket of each subunit of the form I structure of Rv0302 [Fig. 5(A)]. The shape of this extra density is compatible with an isopropanol molecule. This was not surprising because we used solutions containing isopropanol for crystallization. Each bound isopropanol molecule is completely buried in the Rv0302 binding pocket. Four aromatic and hydrophobic residues (L109, F112, Y113, and V132) make hydrophobic contacts with the bound isopropanol [Fig. 5(B)]. In addition, one of the side chain oxygens of D173 forms a hydrogen bond with the hydroxyl oxygen of the bound isopropanol to secure the binding.

Figure 5.

Electron density map and the isopropanol binding site. (A) Stereo view of the F _o–F _c electron density map of the bound isopropanol in Rv0302. The bound isopropanol is shown as a stick model (green, carbon; blue, nitrogen). The F _o–F _c map is contoured at 3.0σ (blue mesh). (B) The iospropanol‐binding site of Rv0302. Residues involved in isopropanol binding are in orange sticks. The bound isopropanol is shown as green sticks. Dotted lines depict the hydrogen bonds.

Regulator–ligand interactions

Isothermal titration calorimetry

Recently, we have found that the M. tuberculosis Rv3249c regulator is able to recognize palmitic acid, a saturated fatty acid containing 16 carbons with the molecular formula C₁₆H₃₂O₂.44 Since both Rv0302 and Rv3249c were predicted to regulate the expression of the mmpS1/L1, mmpL3, mmpL7, and mmpL11 genes, it is possible that these two regulators share a similar set of ligands. Therefore, we decided to test if Rv0302 is capable of binding palmitic acid. Isothermal titration calorimetry (ITC) was then used to study the interaction between Rv0302 and this ligand. This titration depicts a typical hyperbolic binding curve, with thermodynamic parameters of −543.6 ± 43.5 cal mol⁻¹ (ΔH) and 21.0 cal mol⁻¹  deg⁻¹ (ΔS). The equilibrium dissociation constant (K _D) for the binding of Rv0302 to palmitic acid was measured to be 10.5 ± 2.3 μM (Fig. 6). Indeed, our data indicate that Rv0302 is capable of recognizing this fatty acid.

Figure 6.

Representative ITC for the binding of palmitic acid to Rv0302. (A) Each peak corresponds to the injection of 10 μL of 500 μM palmitic acid in buffer containing 10 mM Na‐phosphate (pH 7.2), 100 mM NaCl, and 0.001% DDM into the reaction containing 14.5 μM Rv0302 dimer in the same buffer. (B) Cumulative heat of reaction is displayed as a function of the injection number. The solid line is the least‐square fit to the experimental data, giving a K _D of 10.5 ± 2.3 μM.

Regulator–DNA interactions

Fluorescence polarization assay

Fluorescence polarization was used to quantify the strength of regulator–DNA interactions. To identify regulatory targets of these proteins, we used ChIP‐Seq data from Galagan et al. and the TBDB.11, 22, 36 Regions of the M. tuberculosis H37Rv genome that were identified by these experiments to interact with Rv0302 were first examined to find potential binding sequences for each individual protein. Typically, TetR‐family proteins interact with DNAs via symmetric palindromic stretches called inverted repeats (IRs), approximately 15–30 nucleotides long. Thus, the search was narrowed to include sequences that contain these patterns. For Rv0302, we were able to identify a putative IR sequence located in one or more of the M. tuberculosis H37Rv genes encoding MmpL transporter proteins (Table 2). These DNA sequences are in good agreement with both the consensus binding sequences and protein–DNA interactions determined by others.37 In short, we have compiled additional evidence that the Rv0302 protein may act as a regulator for mmpL6 and mmpL11.

Table 2.

Affinity for DNA Binding by Rv0302

DNA sequence	Location	K D (nM)	Hill coefficient, n
5′‐GCCTGCGCCGCGTCGTCGCGGTGCCTGT‐3′a 5′‐F‐ACAGGCACCGCGACGACGCGGCGCAGGC‐3′b	mmpL11	12.6 ± 1.7	1.2. ± 0.2
5′‐TGCCCGGGGCGCGACCACGCCCCGTACCT‐3′ 5′‐F‐AGGTACGGGGCGTGGTCGCGCCCCGGGCA‐3′	mmpL6	19.1 ± 5.2	1.1 ± 0.1
5′‐TTTCTTGGCGGGAACGCCCACTGG‐3′ 5′‐F‐CCAGTGGGCGTTCCCGCCAAGAAA‐3′	rv0302	13.7 ± 2.8	1.1 ± 0.1

^aThe IR sequence was underlined.

^bF denotes the fluorescein which was covalently attached to the 5′ end of the oligodeoxynucleotide (reversed) by a hexamethylene linker.

Fluorescence polarization assays were then performed using the purified Rv0302 regulator protein and duplex DNAs. We quantified the interaction of this regulator with the DNA sequences listed in Table 2. These DNA sequences are located within the operons of mmpL11 and mmpL6. In addition, we were able to locate an IR sequence within the promoter region of rv0302. The experiments suggest that Rv0302 binds these DNA sequences with K _D values in the nanomolar range (Table 2 and Fig. 7). Interestingly, the fluorescence polarization data indicate that Rv0302 binds these DNA with a stoichiometry of one Rv0302 dimer per DNA duplex.

Figure 7.

Representative fluorescence polarization of Rv0302. (A) The binding isotherm of Rv0302 with the 28‐bp DNA located within the promoter region of mmpL11, showing a K _D of 40.4 ± 4.9 nM. (B) The binding isotherm of Rv0302 with the 29‐bp DNA located within the promoter region of mmpL6, showing a K _D of 58.5 ± 2.9 nM. (C) The binding isotherm of Rv0302 with the 24‐bp DNA located within the promoter region of rv0302, showing a K_D of 80.9 ± 9.2 nM. Fluorescence polarization is defined by the equation, FP = (V – H)/(V + H), where FP equals polarization, V equals the vertical component of the emitted light, and H equals the horizontal component of the emitted light of a fluorophore when excited by vertical plane polarized light. FP is a dimensionless entity and is not dependent on the intensity of the emitted light or on the concentration of the fluorophore. mP is related to FP, where 1 mP equals one thousandth of a FP.

Gel filtration

To confirm the dimeric oligomerization of Rv0302 depicted by the crystal structures, we performed a gel filtration experiment using the purified Rv0302 protein. The result suggests an average molecular weight of 46.3 ± 2.5 kDa. This value is in good agreement with the theoretical value of 48.4 kDa for two Rv0302 molecules, indicating that the Rv0302 regulator is dimeric in solution.

Our fluorescence polarization experiments suggest that the Rv0302 protein uses a simple binding stoichiometry with a 1:1 dimeric Rv0302‐to‐duplex DNA molar ratio to interact with the DNA sequences located within the operons of mmpL11, mmpL6, and rv0302, respectively. To confirm this protein–DNA binding stoichiometry, gel filtration experiment was carried out using the purified Rv0302 protein preincubated with the purified, complementary, annealed oligonucleotides that contain the sequences within the operons of mmpL11, mmpL6, and rv0302, individually. The results suggest average molecular weights of 65.5 ± 3.1, 70.7 ± 4.6 and 58.9 ± 4.5 kDa for these Rv0302–DNA complexes (Fig. 8). These values are in good agreement with the corresponding theoretical values of 65.8, 66.4 and 63.3 kDa for two Rv3066 molecules bound to the respective DNAs, confirming the stoichiometry of these Rv0302‐DNA bindings is 1:1 dimeric Rv0302‐to‐DNA molar ratio.

Figure 8.

Representative gel filtration experiment. The experiment demonstrated that Rv0302 is dimeric in solution. In addition, one Rv0302 dimer is found to bind one duplex DNA. The y‐axis values were defined as: K _av = (V _e − V ₀)/(V _T − V ₀), where V _T, V _e, and V ₀ are the total column volume, elution volume, and void volume of the column, respectively. Standards used were: A, cytochrome C (M _r 12,400); B, carbonic anhydrase (M _r 29,000); C, albumin bovine serum (M _r 66,000); D, alcohol dehydrogenase (M _r 150,000); and E, β‐amylase (M _r 200,000). The void volume was measured using blue dextran (M _r 2,000,000). Samples for the measurements were: red triangle, Rv0302; green diamond, Rv0302‐mmpL11; orange inverted triangle, Rv0302‐mmpL6; blue square, Rv0302‐rv0302.

Electrophoretic mobility shift assay

ChIP‐Seq data suggests that Rv0302 regulates expression of rv0302, mmpS2/L2, and mmpL11 [Fig. 9(A)]. We performed EMSAs using purified Rv0302 to demonstrate direct transcriptional regulation by Rv0302. We observed a concentration‐dependent shift of the rv0302, mmpL2, and mmpL11 probes [Fig. 9(B–D)]. As a negative control, we used a DNA probe that has no predicted binding sites for Rv0302. EMSAs were also performed in the presence of nonlabeled “cold” probe. Release of Dig‐labeled probe was observed consistent with specific binding of Rv0302 to the mmpL11 probe [Fig. 9(C)]. As fluorescence polarization study suggested that Rv0302 binds palmitic acid, we performed an EMSA in the presence and absence of palmitic acid to demonstrate this experimentally. Indeed, addition of palmitate reduced binding of Rv0302 to the rv0302 probe [Fig. 8(D)].

Figure 9.

Rv0302 binds to promoter regions of mmpL11 and rv0302 and intragenic region of mmpL2. (A) A schematic depicting the DNA probes used in EMSAs. (B) EMSAs were performed 6 nM Dig‐labeled probe and the indicated micromolar concentrations of protein. (C) To demonstrate specificity, the MmpL11 EMSA was performed in the presence of nonlabeled (“cold”) probe. Reactions were performed with 6 nM Dig‐labeled probe, the indicated micromolar concentrations of protein, and 360 nM cold probe. (D) Ligand‐bound Rv0302 does not bind target probes. EMSA was performed using 12 nM Dig‐labeled probe and 0.1 μM Rv0302 in the absence or presence of the indicated concentration of palmitic acid. An arrow denotes the shifted probes and the asterisk notes the accumulation of free Dig‐labeled probe.

Conclusion

In this article, we describe the crystal structures of the Rv0302 transcriptional regulator, which contribute to the regulatory network that controls the expression levels of the MmpL transporters. Specifically, the Rv0302 protein should regulate the genes mmpL1, mmpL2, mmpL3, mmpL6, mmpL7, mmpL9, and mmpL11. MmpL transporters significantly contribute to the export of important lipid components of the mycobacterial cell wall and are necessary for the virulence of this pathogen. Our experimental data demonstrate a direct binding of this transcriptional regulator to intragenic and promoter DNAs, providing evidence for the transcriptional control of mmpL gene expression. Multiple transcriptional factor binding sites exist within the promoter and intragenic region of the mmpL genes, and each transcriptional regulator recognizes several mmpL regulatory regions. For example, both Rv0302 and Rv3249c are able to bind to different regulatory sequences within the mmpL11 gene. Indeed, our experimental data indicate that these two regulators may also share the same palmitate ligand. These findings suggest that mmpL gene expression may rely on a complex interplay of multiple transcription regulators. Further experiment is needed to confirm this observation.

The TetR family of regulators uses a few distinct mechanisms for modulating transcriptional regulation. However, the net consequence of binding of inducing ligands to these regulators is essentially the same. Ligand binding at the C‐terminal regulatory domain triggers a long distance conformational change at the N‐terminal DNA binding domain, resulting in the release of the regulator from its operator DNA. The TetR‐family regulators use the N‐terminal recognition helix α3 to bind the major groove of B‐DNA. The two crystal structures of Rv0302 have allowed us to understand how this regulator controls gene expression. It appears that ligand binding may trigger a rotational motion of one subunit of Rv0302 in relation to the next subunit within the dimer. This rotational motion presumably makes the relative orientation of the two N‐terminal DNA‐binding domains of the regulator incompatible with the two consecutive major grooves of the operator B‐DNA. Similar rotational movement as rigid bodies has been found in the SimR and Rv3066 regulators, where rigid body rotation within subunits of the dimer in relation to each other contributes to the induction process.34, 38 The net result is that this dimeric Rv0302 regulator is released from the promoter, which in turn initiates the expression of the mmpL genes.

Materials and Methods

Cloning of rv0302

The rv0302 ORF from genomic DNA of M. tuberculosis strain H37Rv was amplified by polymerase chain reaction (PCR) using the primers 5′‐CTTTAAGAA GGAGATATACCATGGTGGGCGTTCCCGCCAAGAA AAAAC‐3′ and 5′‐ GATCCTCAGTGATGATGGTGGT GATGTGTCTCCTCCAGGAGGACGGGAATC‐3′. The corresponding PCR product was digested with NcoI and BamHI, extracted from the agarose gel and inserted into pET15b as described by the manufacturer (Merck, Kenilworth, NJ). The recombinant plasmid, pET15bΩrv1219c, was transformed into DH10b cells, and the transformants were selected on Luria Broth (LB) agar plates containing 100 μg/mL ampicillin. The presence of the correct rv1219c sequence in the plasmid construct was verified by DNA sequencing.

Expression and purification of Rv0302

Briefly, the full‐length protein Rv0302 containing a 6×His tag at the C‐terminus was overproduced in E. coli BL21(DE3) cells possessing pET15bΩrv0302. Cells were grown in 6 L of LB medium with 100 μg/mL ampicillin at 37°C. When the OD₆₀₀ reached 0.5, the culture was treated with 0.2 mM IPTG to induce Rv0302 expression, and cells were harvested within 3 h. The collected bacterial cells were suspended in 100 mL ice‐cold buffer containing 20 mM Na‐HEPES (pH 7.2) and 250 mM NaCl. The cells were then lysed with a French pressure cell. Cell debris was removed by centrifugation for 45 min at 4°C and 20,000 rev/min. The crude lysate was filtered through a 0.2 μm membrane and loaded onto a 5 mL Hi‐Trap Ni²⁺‐chelating column (GE Healthcare Biosciences, Pittsburgh, PA) pre‐equilibrated with 20 mM Na‐HEPES (pH 7.2) and 250 mM NaCl. To remove unbound proteins and impurities, the column was first washed with eight column volumes of buffer containing 20 mM imidazole, 250 mM NaCl, and 20 mM Na‐HEPES (pH 7.2), and then five column volumes of buffer containing 50 mM imidazole, 250 mM NaCl, and 20 mM Na‐HEPES (pH 7.2). The Rv0302 protein was then eluted with three column volumes of buffer containing 300 mM imidazole, 250 mM NaCl, and 20 mM Na‐HEPES (pH 7.2). The purity of the protein was judged using 12.5% SDS‐PAGE stained with Coomassie Brilliant Blue. The purified protein was extensively dialyzed against buffer containing 100 mM imidazole, 150 mM NaCl, and 20 mM Na‐HEPES (pH 7.5) and concentrated to 20 mg/mL.

Crystallization of Rv0302

All crystals of the 6×His Rv0302 regulator were obtained using hanging drop vapor diffusion. The form I Rv0302 crystals were grown at room temperature in 24‐well plates with the following procedures. A 1 μL protein solution containing 20 mg/mL Rv0302 protein in 20 mM Na‐HEPES (pH 7.5), 150 mM NaCl, and 100 mM imidazole was mixed with 1 μL of reservoir solution containing 30% polyethylene glycol (PEG) 400, 0.1M Na‐HEPES (pH 7.5), 0.2M NaCl, and 10% isopropanol, with an addition of 2% benzamidine·HCl. The resultant mixture was equilibrated against 500 μL of the reservoir solution. Crystals appeared overnight and grew to a full size in the drops within 2 weeks. Typically, the dimensions of the crystals were 0.1 mm × 0.3 mm × 0.3 mm. Further cryoprotection was not necessary.

Crystals of the tantalum derivative were prepared by incubating the form I crystals overnight in a solution containing 30% PEG 400, 0.1M Na‐HEPES (pH 7.5), 0.2M NaCl, 10% isopropanol, 2% benzamidine·HCl, and 1 mM (Ta₆Br₁₂)²⁺·2Br⁻ (Jena Bioscience, Jena, Germany).

The form II Rv0302 crystals were grown at room temperature in 24‐well plates by mixing 1 μL of protein solution with 1 μL of reservoir solution containing 18% PEG 2000, 0.1M K‐MES (pH 6.5), 0.2M NaCl, and 10% isopropanol. The resultant mixture was equilibrated against 500 μL of the reservoir solution. Crystals appeared overnight and grew to a full size in the drops within 1 week. Typically, the crystals were plate‐like with dimensions 0.2 mm × 0.2 mm × 0.05 mm. Cryoprotection was achieved by raising the PEG 2000 concentration stepwise to 25%.

Data collection, structural determination, and refinement

All diffraction data were collected at 100K at beamline 24ID‐C located at the Advanced Photon Source, using a Pilatus 6M detector (Dectris, Switzerland). Diffraction data were processed using DENZO and scaled using SCALEPACK.45 The form I crystals of Rv0302 belong to the space group P6₁22 (Table 1). Based on the molecular weight of Rv0302 (23.8 kDa), the asymmetric unit is expected to contain one regulator molecule with a solvent content of 68.7%. Two tantalum cluster sites were identified using SHELXC and SHELXD46 as implemented in the HKL2MAP package.47 Single isomorphous replacement with anomalous scattering was used to obtain experimental phases using the program MLPHARE.48, 49 The resulting phases were then subjected to density modification using the program PARROT.50 The phases were of excellent quality and allowed for tracing of most of the molecule in PHENIX AutoBuild,51 which led to an initial model with over 90% amino acid residues containing side chains. The remaining part of the model was manually constructed using the program Coot.52 Then, the model was refined using PHENIX51 leaving 5% of reflections in Free‐R set. Iterations of refinement using PHENIX51 and CNS53 and model building in Coot52 lead to the current model with excellent geometrical characteristics (Table 1).

The form II crystal took the space group P2₁2₁2₁. This structure was determined by molecular replacement, using the form I structure as the search model. The program PHASER54 was used to carry out the MR calculations. Structural refinements were then performed using PHENIX51 and CNS53 (Table 1).

Isothermal titration calorimetry

We used ITC to determine the binding affinity of palmitic acid to the purified Rv0302 regulator. Measurements were performed on a VP‐Microcalorimeter (MicroCal, Northampton, MA) at 25°C. Before titration, the protein was thoroughly dialyzed against buffer containing 10 mM Na‐phosphate pH 7.2, 100 mM NaCl, and 0.001% n‐dodecyl‐β‐D‐maltoside (DDM). The protein concentration was determined using the Bradford assay and then adjusted to a dimeric concentration of 14.5 μM. The ligand solution containing 500 μM palmitic acid, 10 mM Na‐phosphate pH 7.2, 100 mM NaCl, and 0.001% DDM was used as the titrant. Binding experiments were carried out with the protein solution (1.4 mL) in the cell and the ligand solution as the injectant. Thirty injections of 10 μL each of the ligand solution were used for data collection.

Injections occurred at intervals of 240 s, and the duration time of each injection was 20 s. Heat transfer (μcal/s) was measured as a function of elapsed time (s). The mean enthalpies measured from injection of the ligand in the buffer were subtracted from raw titration data before data analysis with ORIGIN software (MicroCal, Westborough, MA). Titration curves were fitted by a nonlinear least squares method to a function for the binding of a ligand to a macromolecule. Nonlinear regression fitting to the binding isotherm provided us with the equilibrium binding constant (K _A = 1/K _D) and enthalpy of binding (ΔH). Based on the values of K _A, the change in free energy (ΔG) and entropy (ΔS) were calculated with the equation: ΔG = −RT ln K _A = ΔH − TΔS, where T is 273 K and R is 1.9872 cal/K per mol. Calorimetry trials were also carried out in the absence of Rv0302 in the same experimental conditions. No change in heat was observed in the injections throughout the experiment.

Fluorescence polarization assay

Fluorescence polarization assays were used to determine the affinity for DNA binding by Rv0302. All oligodeoxynucleotides and fluorescein‐labeled oligodeoxynucleotides were purchased from Integrated DNA Technologies (Coralville, IA). The sequences of these oligodeoxynucleotides are summarized in Table 2. The fluoresceinated ds‐DNAs were prepared by annealing the oligodeoxynucleotide and its corresponding fluorescein‐labeled oligodeoxynucleotide together. Fluorescence polarization experiment was done using a DNA binding solution containing 10 mM Na‐phosphate (pH 7.2), 100 mM NaCl, 2.5 nM fluoresceinated DNA, and 1 μg of poly(dI‐dC) as nonspecific DNA. The protein solution containing 500 nM dimeric Rv0302 and 2.5 nM fluoresceinated DNA was titrated into the DNA binding solution until the millipolarization (mP) become unchanged. All measurements were performed at 25°C using a PerkinElmer LS55 spectrofluorometer equipped with a Hamamatsu R928 photomultiplier. The excitation wavelength was 490 nm, and the fluorescence polarization signal (in ΔP) was measured at 525 nm. Each titration point recorded was an average of 15 measurements. Data were analyzed using the equation, P = {(P _bound − P _free)[protein]/(K _D + [protein])} + P _free, where P is the polarization measured at a given total protein concentration, P _free is the initial polarization of free fluorescein‐labeled DNA, P _bound is the maximum polarization of specifically bound DNA, and [protein] is the protein concentration. The titration experiments were repeated three times to obtain the average K _D value. Curve fitting was accomplished using the program ORIGIN (OriginLab, Northampton, MA).

Gel filtration

A protein liquid chromatography Superdex 200 16/60 column (GE Healthcare Biosciences, Pittsburgh, PA) with a mobile phase containing 20 mM Na‐phosphate (pH 7.2) and 100 mM NaCl was used in the gel filtration experiments. Blue dextran (Sigma‐Aldrich, St. Louis, MO) was used to determine the column void volume, and proteins for use as gel filtration molecular weight standards were cytochrome C (M _r 12,400), carbonic anhydrase (M _r 29,000), albumin bovine serum (M _r 66,000), alcohol dehydrogenase (M _r 150,000), and β‐Amylase (M _r 200,000). All these standards were purchased from Sigma‐Aldrich (St. Louis, MO). The molecular weights of the experimental samples were determined following the protocols supplied by the manufacturers.

Electrophoretic mobility shift assay

Probes were amplified from the H37Rv genome using the primers listed in Table 3. All probes were labeled with Digoxigenin using the Roche DIG Gel Shift kit. For EMSA analysis, 12 nM Dig‐labeled probe and the indicated micromolar concentrations of protein were incubated for 45 min at room temperature in the Roche binding buffer modified by the addition of 0.25 mg/mL herring sperm DNA, and 0.75 mg/mL poly(d[I‐C]). For ligand competition assays, the stock solution of palmitic acid was made in dimethyl sulfoxide (DMSO) and a solvent control reaction included at the highest concentration of DMSO. All reactions were resolved on a 6% native polyacrylamide gel in TBE buffer, transferred to nylon membrane and Dig‐labeled DNA–protein complexes detected following the manufacturer's recommendations. Chemiluminescent signals were acquired using an ImageQuant LAS 4000 (GE).

Table 3.

Primers used to Amplify EMSA Probes

Primer	Sequence
Rv0302F.0302	5′‐CGGTACTGCACGTCGACAA‐3′
Rv0302R.0302	5′‐GTTCGGTCGCGTCGAGAATC‐3′
mmpL11F.0302	5′‐CCGAGATGGCAGGATGACGG‐3′
mmpL11R.0302	5′‐TCGCTGATGGTTCGGCCAG‐3′
mmpL2F.0302	5′‐TTATCTGGCATGGCACGCTT‐3′
mmpL2R.0302	5′‐TTGCCGTCCGGAGACAAAAA‐3′

Protein data bank accession code

Coordinates and structural factors for the structures of Rv0302 have been deposited in the RCSB Protein Data Bank with accession codes 5D18 and 5D19 for the form I and form II conformations, respectively.