Skip to main content
NCBI home page
Molecular Therapy logoLink to Molecular Therapy
. 2015 Jun 30;23(8):1358–1367. doi: 10.1038/mt.2015.102

HIV-specific Immunity Derived From Chimeric Antigen Receptor-engineered Stem Cells

Anjie Zhen 1,2, Masakazu Kamata 1,2, Valerie Rezek 1,2, Jonathan Rick 1,2, Bernard Levin 1,2, Saro Kasparian 1,2, Irvin SY Chen 1,2,3, Otto O Yang 2,3, Jerome A Zack 1,2,3, Scott G Kitchen 1,2,*
PMCID: PMC4817874  PMID: 26050990

Abstract

The human immunodeficiency virus (HIV)-specific cytotoxic T lymphocyte (CTL) response is critical in controlling HIV infection. Since the immune response does not eliminate HIV, it would be beneficial to develop ways to enhance the HIV-specific CTL response to allow long-term viral suppression or clearance. Here, we report the use of a protective chimeric antigen receptor (CAR) in a hematopoietic stem/progenitor cell (HSPC)-based approach to engineer HIV immunity. We determined that CAR-modified HSPCs differentiate into functional T cells as well as natural killer (NK) cells in vivo in humanized mice and these cells are resistant to HIV infection and suppress HIV replication. These results strongly suggest that stem cell-based gene therapy with a CAR may be feasible and effective in treating chronic HIV infection and other morbidities.

Introduction

Immune-based therapies have emerged as a potentially powerful approach toward the treatment of a variety of human diseases, particularly chronic illnesses such as cancer or HIV. The genetic modification of T cells or other immune cells to target a malignancy or viral infection holds significant promise over current therapeutic strategies. Namely, these therapies potentially boost better long-term disease control, lower toxicities, lower long-term cost, and greater clinical efficacy. Recently, the use of chimeric antigen receptors (CARs) to redirect T cells toward malignancies has become a high-profile method of treatment1 and represents a broad-based approach of engineered immunity that can be used in a wide range of individuals, independent of transplantation antigen restriction. CAR-based approaches have involved the redirection of peripheral T cells, particularly CD8+ T cells, to target and kill cells expressing a tumor antigen.2,3 There are important limitations associated with the ex vivo genetic manipulation of peripheral human cells that include the development of premorbid, dysfunctional cells that lack the ability to mount a sustained response following the extensive modification procedure and engraftment.3,4,5 One prototype chimeric antigen receptor for treating HIV infection is the CD4ζ chimeric antigen receptor. The CD4ζ CAR molecule is a hybrid molecule consisting of the extracellular and transmembrane domains of the human CD4 molecule fused to the signaling domain of the CD3 complex ζ-chain.4,5,6,7,8 Thus when CD4 recognizes and engages HIV gp120 envelope protein on virally infected cells, the CAR-modified cell is triggered and activated via ζ-chain signaling. CD4ζ CAR-modified T cells were reported to inhibit viral replication and kill HIV-infected cells in vitro.2,9 Clinical trials with CD4ζ CAR-modified T cells showed that it is safe and that the transduced cells have prolonged survival in vivo.3,7,8 However, the clinical efficacy of this approach was hampered by lack of functional HIV responses in vivo following the modification of peripheral cells due to extensive and damaging cell handling and genetic modification procedures. In addition, expression of CD4 on gene modified T cells also rendered them susceptible to HIV-1 infection and elimination. Thus, an approach that provides sustained production of functional antigen-specific cells that are protected from infection could be of significant benefit in the development of this type of therapy.

The use of human hematopoietic stem/progenitor cells (HSPCs) instead of manipulated peripheral immune cells would bypass many of these issues and provide long-term maintenance of antigen-specific cells of multiple hematopoietic lineages. We and others have previously demonstrated that HSPCs can be engineered with molecularly cloned T-cell receptors (TCRs) and can further undergo development into functional, mature T cells following thymopoiesis.4,5,10,11,12,13 These modifications were assayed in vivo using a humanized mouse model and resulted in a decrease of HIV viral loads13 and reduced MART1 tumor size.11,12 However, TCRs are restricted to individual human leukocyte antigens (HLAs)(or “transplant antigens”), limiting their utility. The use of a CAR would expand the breadth of this therapeutic approach by bypassing the HLA restriction of cloned TCRs and overcoming the virus ability to escape CTL responses, thus the CAR approach could be employed in essentially any individual. However, it is largely unknown if the expression of chimeric antigen receptor would allow differentiation of multiple hematopoietic lineages. Early studies done in mice using retroviral transduction of mouse progenitor cells suggest that CD4ζ CAR expression may have adverse effects on T-cell development.14,15 To date, only one study tested the feasibility of modifying human HSPCs with an anti-CD19 CAR16 and it remains unknown how CAR affects human hematopoietic differentiation and thymopoiesis and if CAR bearing cells generated in this fashion are functional in vivo.

In the present study, we explored the ability of CD4ζ CAR to allow genetically modified HSPCs to produce multilineage immune cells that target HIV infection in vivo using the humanized bone marrow-thymus-liver (BLT) mouse model. The BLT humanized mouse model has the capability of generating the broadest and most functional immune system of all current humanized mouse models; and, cellular immune responses that are generated to HIV infection closely mirror those in human.17,18,19 This allows us to assess the development and functionality of the CD4ζ CAR-modified cells in vivo during HIV-1 infection. Additionally, to protect engineered cells from HIV infection, we combined CD4ζ CAR with efficient anti-HIV reagents20,21 to confer protection from HIV infection. Herein, we demonstrate the feasibility and efficacy of utilizing a HSPC-based approach to develop universally protective, multilineage HIV-specific cells in vivo targeted toward the eradication HIV infection.

Results

Construction and characterization of a protective HIV-specific CAR

We constructed a lentiviral vector containing the CD4ζ CAR (Figure 1a) as well as two antiviral genes, a small hairpin (sh)RNA molecule specific to human CCR520 and a shRNA targeting specific HIV long terminal repeat (LTR) sequences (termed sh516)21 (Figure 1b). The rationale for this is that CCR5 shRNA would downregulate HIV coreceptor expression and the sh516 would target HIV RNA for degradation inhibiting productive infection of the vector expressing cell. These additional measures would likely protect the cells that express the CD4ζ CAR from productive infection with HIV.20,21,22,23

Figure 1.

Figure 1

Open in a new tab

CD4 ζ chimeric antigen receptor. (a) Schematic presentation of CD4 ζ chimeric antigen receptor detailing the extracellular CD4 domains D1-D4, the CD4 transmembrane portion (CD4 TM), and the T-cell receptor (TCR) CD3ζ signaling domain. (b) Schematic presentation of the triple chimeric antigen receptor (CAR) vector showing the CCR5-specific shRNA (termed CCR5 sh1005), the HIV long terminal repeat-specific shRNA (termed sh516), and the enhanced green fluorescent protein, the 2A peptide sequence, and the CD4ζ CAR genes.

We assessed the transduction and expression of the CD4ζ CAR containing vector in sorted CD8+ T cells isolated from fresh peripheral blood mononuclear cells. We compared cells transduced with the CCR5shRNA/sh516/CD4ζ CAR (Triple CAR) containing vector to cells transduced with a vector containing only the CD4ζ CAR or an empty vector (all expressing enhanced green fluorescent protein (eGFP)) (Figure 2). Transduction and expression of the vector(s) resulted in extracellular CD4 expression and we observed CCR5 knockdown in cells expressing the Triple CAR vector (Figure 2a,b). As expected with CD4 expression on CD8+ T cells,24 we found that the expression of the CD4ζ CAR on CD8+ cells rendered them more susceptible to HIV infection compared to a control vector lacking the CD4ζ CAR (Figure 2c). The presence of the antiviral shRNA in the triple CAR protected them from infection (Figure 2c). In addition, we found that coincubation of these cells with HIV-infected T1 cells resulted in the induction of IL-2 and interferon-γ (IFN-γ) compared to cells coincubated with uninfected T1 cells, indicating that the CD4ζ CAR is functionally capable of inducing antiviral responses when expressed on CD8+ T cells (Figure 2d). Thus, we successfully developed a new vector that protects transduced cells from HIV infection as well as expresses the CD4ζ CAR.

Figure 2.

Figure 2

Open in a new tab

In vitro validation assays of the protective TRIPLE CD4ζ chimeric antigen receptor (CAR) vector. (a) CD8 cells were purified from healthy donors and transduced with either a GFP-only control vector, or CD4ζ CAR (no shRNAs), or the protective TRIPLE CAR vector (cells shown were gated on eGFP expression). (b) CCR5 expression is down regulated by the protective CD4ζ CAR compared to the GFP-only or CD4ζ CAR (no shRNAs) controls. (c) HIV infection rates (gag+%) comparing HIV-1-exposed control CD8 cells to CD8 cells transduced with CD4ζ CAR (no shRNA) vector and the TRIPLE CAR vector. Summary of fold decrease in gag+% cells comparing CD4ζ CAR CD8 cells and triple CAR CD8 cells from three healthy donors is shown. (d) Cytokine production of the TRIPLE CAR vector transduced CD8 cells after coincubation with uninfected or HIV-infected T1 cells.

Hematopoietic development of triple CAR-modified HSPCs in vivo

To determine if a CAR can be utilized in a stem cell-based approach to produce immune cells capable of recognizing HIV, we utilized a humanized mouse model in which multilineage human hematopoiesis is recapitulated in an immunodeficient mouse.17 In this system, mature, fully functional immune cells are capable of developing from genetically manipulated human HSPCs.11,13 Human HSPCs were transduced with the triple CAR vector and were transplanted into immunodeficient nonobese diabetic, severe combined immunodeficient, common γ-chain knockout (γc−/−) (NSG) mice containing human fetal liver and thymus tissue (Figure 3a). Following development of the transplanted tissue and genetically modified cells, we initially assessed vector-expressing cells in different organs. We found that the triple CAR was expressed on a significant number of cells in the blood, spleen, thymus, and bone marrow of animals receiving vector modified HSPC's, indicating that these cells undergo hematopoiesis in the transplanted animals (Figure 3b). Additionally, we observed knockdown of CCR5 expression in vector-expressing cells in these animals, indicating that the shRNA specific to CCR5 is functioning in vivo. We observed expression of the triple CAR vector on T cells (CD45+CD19-CD5+), natural killer (NK) cells (CD3-CD56+CD337+TCRαβ-), B cells (CD3-CD19+), and myeloid cells (CD45+CD14+) in transplanted animals, indicating that the genetically modified HSPCs are capable of multilineage hematopoiesis in vivo (Figure 3c).

Figure 3.

Figure 3

Open in a new tab

Construction and multilineage reconstitution of protective CD4ζ CAR hu-BLT mice. (a) Schematic illustrating the construction of triple chimeric antigen receptor (CAR) hu-BLT mice: CD34+ cells were purified from liver and transduced with lentiviruses containing the protective CD4ζ CAR and then transplanted into NSG mice with fetal liver stromal element and fetal thymus in matrigel. Three weeks after transplantation, the transplant mice were sublethally irradiated (3Gy), previously frozen CD34+ cells were thawed and transduced and injected into the mice where the cells engrafted in the bone marrow. Six to twelve weeks later, peripheral blood was collected and analyzed for human cell reconstitution and the mice were infected with HIV-1. (b) Reconstitution of triple CAR hu-BLT mice expressing CD4ζ CAR. Cells were isolated from the indicated organs and analyzed for their expression of human CD45 (leukocyte common antigen), vector expressing GFP, CD4, and CCR5 by flow cytometry. (c) Multilineage hematopoietic reconstitution of triple CAR hu-BLT mice. Spenocytes from the triple CAR hu-BLT mice were analyzed by flow cytometry and gated on human CD45+ and CD4+GFP+ triple CAR expressing cells. These cells were assessed for surface marker expression identifying T cells (CD5+), B cells (CD3−CD19+), macrophages/monocytes (CD14+), and NK cells (CD56+TCRab−CD337).

Expression of the CD4 ζ CAR suppresses endogenous T-cell receptor recombination

Interestingly, while many of cells that express the triple CAR vector that develop in vivo are T cells (47% ± 11.28%, see Supplementary Figure S1), as determined by expression of CD5, CD7, or CD2, there is a significant population of cells expressing these markers that lack cell surface CD3ɛ. Further phenotypic analysis of this population indicates that these cells have lower levels of endogenous TCRαβ receptor expression (Figure 4a), which is necessary for cell surface expression of CD3ɛ.25 Cell surface expression of CD3ɛ is dependent on functional TCR expression in developing T cells and we were interested if the CD4ζ CAR substituted for this TCR during development and shut off the expression of the endogenous TCR. We more closely examined these cells from animals transplanted with human HSPC modified with the triple CAR containing vector or a vector containing a deletion of the triple CAR solely expressing the eGFP marker protein. We observed a decrease in cell surface CD3ɛ expression in cells expressing the CD4ζ CAR/eGFP compared to cells expressing the eGFP control vector in the thymus of transplanted animals (Figure 4b). When these thymocytes were sorted and examined for the levels of T-cell receptor excision circles (TRECs), which indicate endogenous TCR rearrangement, we observed a significant decrease in TREC levels, of approximately 50%, in triple CAR vector-expressing cells compared to cells expressing the control vector (Figure 4c). This indicates that endogenous T-cell receptor rearrangement is at least partially shut down when the CD4ζ CAR is expressed. These results are similar to the results observed when a molecularly cloned, human MART-specific T-cell receptor is introduced to human HSPCs.12 This suggests that the CD4ζ CAR is mimicking a normal T-cell receptor on these newly produced cells. We also observed a reduction of CD3 expression on those cells expressing the greatest levels of the vector, suggesting that higher levels of the CD4ζ CAR on the surface of these developing cells more effectively turns off endogenous TCR rearrangement, presumably by providing a higher level of TCR ζ chain signal to the developing cell (Figure 4d). In summary, these data indicate that genetic modification of human HSPCs with a triple CAR vector can result in multilineage hematopoiesis and the production of HIV-specific T cells; a significant population of which that have their endogenous T-cell receptor down regulated and solely express the CD4ζ CAR molecule.

Figure 4.

Figure 4

Open in a new tab

Expression of triple chimeric antigen receptor (CAR) downregulates endogenous T-cell receptor (TCR) expression. (a) Splenocytes from the CD4 ζ mice were assessed by flow cytometry and gated on triple CAR (CD4+GFP+) expressing cells. Expression of CD3, CD5, CD7, and TCR αβ were assessed and analyzed by flow cytometry. (b) Thymocytes from the triple CAR-modified mice and control GFP mice were assessed for their expression of T-cell markers CD5 and CD3 by flow cytometry. (c) Thymocytes from triple CAR-modified mice and control mice were sorted based on CD5 and GFP expression. DNA was purified from the sorted cells and TCR rearrangement excision circle (TREC) was measured by real-time PCR. (d) Levels of CD3 expression on triple CAR expressing cells (right panel) was analyzed separately by high (GFPhigh) or low GFP (GFPlow) expression, as indicated by the respective gates (left panel).

Triple CAR-modified cells differentiate into effector cells in response to HIV infection in vivo

In order to assess the functionality of the new cells expressing triple CAR, humanized mice transplanted with triple CAR cells were then infected with HIV for 5 weeks. After this infection time, virologic parameters and immune responses were assessed. HIV infection resulted in the appearance of cells expressing triple CAR that possessed an effector phenotype (CD4+ eGFP+CD27−CD45RA+/−) that is not represented in the cells not expressing the CAR (Figure 5a,b). This was similar to the types of responses that we have observed in studies examining HIV-specific T-cell responses utilizing a molecularly cloned TCR against HIV.13 In addition, these triple CAR expressing cells have greater levels of the CD38 activation molecule (Figure 5c,d), indicating the functional recruitment of these cells in antigen-specific T-cell responses to HIV. Cells were then assessed for virus-specific activation of antiviral responses during HIV infection. Splenocytes were removed from infected animals and were then cocultured with a virally infected cell line or with uninfected cells. Shortly following exposure, cells expressing triple CAR produced IFN-γ and tumor necrosis factor (TNF)-α in response to HIV-infected cells and did not respond to uninfected cells (Figure 5e–g). Interestingly, we found cells that express high levels of eGFP and CD4ζ CAR expression responded more robustly to infected cells in vitro and produced higher level of IFN-γ than cells with lower level of CD4ζ CAR expression (Figure 5h), despite their lack of endogenous TCR and CD3 expression (Figure 4d). These results indicate that cells carrying the triple CAR were primed in vivo to elicit HIV-specific T-cell responses following antigen encounter.

Figure 5.

Figure 5

Open in a new tab

Triple chimeric antigen receptor (CAR)-modified cells develop into effector phenotype and are activated after HIV infection. (a) Splenocytes from HIV-1 infected triple CAR mice were assessed for naive (CD45RA+CD62L+), effector memory (EM) (CD45RA−CD62L−), central memory (CM) (CD45RA−CD62L+), and effector memory RA (EMRA) (CD45RA+CD62L−) development. (b) Summary of % the EM and CM ratio among CD45+ and CD45+GFP+ triple CAR cells from infected triple CAR mice. (c) Splenocytes from HIV-1-infected triple CAR mice were assessed for expression of activation marker CD38+. (d) Summary of CD38 mean fluorescence intensity (MFI) comparing CD45+ and CD45+GFP+ triple CAR cells from infected triple CAR mice. (e) Splenocytes from HIV-1-infected triple CAR mice were accessed for their response to infected T1 target cells. Intracellular production of IFNγ and TNFα from triple CAR were measured. (f) Summary of MFI of IFNγ from triple CAR cells cocultured with uninfected or infected T1 target cells. (g) Summary of the TNFα MFI from triple CAR cells cocultured with uninfected or infected T1 target cells. (h) IFNγ production from triple CAR cells coincubated with infected T1 target cells based on the level of GFP expression.

Triple CAR-modified cells are protected from HIV infection and suppress HIV replication in vivo

Triple CAR expressing cells were then examined for evidence of HIV infection in vivo by intracellular staining for HIV p24 Gag antigen. Significantly reduced levels of p24 Gag expression were observed in cells expressing the triple CAR than in cells not expressing the CAR (Supplementary Figure S2). This indicates that these cells are protected from infection through the expression of the antiviral genes in the vector, allowing them to persist and respond against HIV. Interestingly, we found that some mice had significant expansion of triple CAR cells (high expansion, >2.5-fold expansion of triple CAR expressing cells following infection) after HIV challenge (Figure 6a,b), while some did not (low expansion, <2.5-fold expansion of triple CAR expressing cells following infection). We then assessed HIV serum viral load (Figure 6c) as well as HIV DNA burden in peripheral blood mononuclear cells (Figure 6d). We found that those mice that had a greater expansion of cells expressing the triple CAR vector had almost full suppression of HIV, while those animals whose cells had lower levels of expansion did not have significant suppression of the virus (Figure 6c,d). This suggests that there is a minimal response threshold by genetically modified, virus-specific cells necessary to suppress HIV replication. In addition to lower viral loads, a better preservation of CD4/CD8 T-cell ratios was observed in animals that had greater levels of cellular expansion of peripheral blood mononuclear cells expressing the triple CAR vector (Figure 6e). The levels of cellular expansion correlated with suppression of the virus (Figure 6f). We found that triple CAR-modified mice that had poor responses to HIV infection had correspondingly lower level of CD14+ antigen-presenting cells in the blood (<2%) (Figure 6g), which may be due to suboptimal development of the myeloid lineage in the humanized BLT mice model.19 On the contrary, mice that had successful suppression of HIV and greater expansion of triple CAR expressing cells also had a higher percentage of CD14+ antigen-presenting cells in the blood (5–9%). This is similar to the percentages of CD14+ cells in normal human peripheral blood (2–10%).26 Thus, the genetic modification of HSPCs with a lentiviral vector containing the CD4ζ CAR and protective antiviral genes can result in the multilineage reconstitution of HIV-specific cells that are protected from infection and can lower viral loads in vivo following virus challenge.

Figure 6.

Figure 6

Open in a new tab

Triple chimeric antigen receptor (CAR) cells can successfully suppress HIV replication in vivo. (a) Representative figure of triple CAR cells expansion upon HIV infection. (b) Fold expansion of GFP+CD4+ triple CAR expressing cells in peripheral blood 5 weeks after infection as assessed by flow cytometry. (c) HIV viral load in serum 2 and 4 weeks postinfection. (d and e) Blood HIV DNA burden and CD4/CD8 ratio comparing control and triple CAR mice that are infected with HIV-1. (f) Correlation of triple CAR expression cell expansion with viral burden in the peripheral blood. (g) Percentage of human CD14+ cells among total human lymphocytes (CD45+) in the humanized mouse blood.

Discussion

We have demonstrated that the modification of human HSPCs with an HIV-specific CD4ζ CAR can allow the differentiation of HIV specific T cells and cells of other lineages capable of lowering viral loads in vivo. The current study demonstrates that the modification of HSPCs with a CAR, particularly one that contains a molecule such as CD4 that is directly involved in the hematopoietic differentiation and selection process, allows the functional development of these cells. This has implications in the use of other CAR molecules in HSPC-based approaches toward the treatment of a variety of diseases.

Although redirecting anti-HIV immunity using a molecularly cloned TCR is promising, its application is restricted by HLA type and many identified highly effective HIV CTL utilize uncommon HLA alleles.27 In addition, recent research by Deng et al.28 demonstrated that unless antiretroviral therapy is initiated early, the vast majority of latent viruses carry CTL escape mutations that render these infected cells insensitive to naturally derived CTLs directed at common epitopes. Engineering more effective CTL responses through the use of a HSPC-based CD4ζ CAR therapy bypasses many of the problems associated with viral immune escape and HLA restriction by providing a broad-based and effective surveillance and suppression of virally-expressing and latently-reactivated cells. The HSPC-based therapy would also allow for long-lived and renewable immunity that is capable of continuously generating anti-HIV cells which offers several advantages over current modalities, including those involving the redirection of peripheral blood T cells that are more commonly being utilized to treat a variety of malignancies.1 First, as it involves long-lived stem cells, the approach described herein should require only a single or limited number of administrations. The risk of undesirable T-cell reactivity would be minimized, as stem cell-derived T-cells will pass through thymic selection. As both CD4 and CD8 cells arise from CAR-transduced stem cells, there will be both anti-HIV CD4- (helper) and CD8- (CTL) T-cell function. Finally, as a relatively high number of new, naive HIV-specific cells will be constantly renewed from stem cells, HIV production from activated and infected reservoir cells would be more effectively contained and prevented from systemic spread, in part due to a potentially less “exhausted” phenotype of these naive cells.

While we demonstrate the feasibility in the use of CARs in a HSPC-based approach to target HIV disease in the humanized mouse, the overall approach utilizing autologous, genetically modified HSPCs in humans has been demonstrated to be, thus far, a safe strategy.29 Based on this safety success, there are multiple HSPC-based gene therapy clinical trails currently ongoing, primarily aimed at protecting cells from HIV infection (ClinicalTrials.gov Identifiers: NCT01961063, NCT00569985, NCT01177059, NCT01734850). Even though potential toxicities related to the use of the CD4ζ CAR, including autoreactivity, cellular transformation, cytokine storms, or any other gross cellular dysfunction or illness-inducing events, were not observed in our studies, future studies directed toward the preclinical development of this approach should be focused on ascertaining these potentially adverse events.

In the development and selection of CD4ζ CAR expressing T cells that we observed, it is likely that the extracellular CD4 portion is interacting with HLA class II expressed by the thymic stroma, which triggers positive selection of these cells. The observation that the cells that express the highest levels of the CD4ζ CAR have the lowest level of CD3 and lower levels of TRECs suggests these cells have the ability to ligate HLA II and send the strongest signal to turn off endogenous TCR rearrangement (Figure 2c). CD3 expression is dependent on the expression of a functional TCR, and the signal generated through the CD4ζ CAR molecule appears to turn off endogenous TCR rearrangement and expression. This may explain the lack of T-cell development observed in previous mouse-based studies using CD4ζ CAR-modified progenitor cells as T cells were assessed by CD3 expression.14,15 Shut down of endogenous TCR rearrangement could be functionally beneficial in that a single TCR, the CD4ζ CAR, is on the surface of approximately 50% of the cells and the theoretical cross-reactivity of these cells toward another antigen is therefore reduced. In addition, CAR bearing T cells developed from HSPCs go through natural thymopoiesis, which eliminates self-reactive T cells and would further limit the off-target adverse effects, and potentially the cytokine storms, observed in other CAR adoptive T-cell transfer therapies.30 Interestingly, the levels of the reduction in endogenous TCR rearrangement observed with the CD4ζ CAR were similar to those observed with a transgenic TCR to the MART1 antigen.12

The development of NK cells bearing the CAR is also of potentially important benefit in this type of stem cell-based approach (see Figure 2c). NK cells, in addition to T cells, express the intracellular machinery to allow functional signaling through the TCR ζ chain component of the CAR and have been previously shown to direct CD4ζ CAR-modified mature NK cells to kill HIV-infected target cells.31 The hematopoietic development of CD4ζ CAR-expressing NK cells from genetically modified HSPCs can provide a constant, innate immune response targeted to virus infection capable of rapid cellular responses. These responses would further augment HIV immunity through the long-term production of these HIV-specific cells and could contribute to NK-mediated immunity and viral suppression at different anatomical sites.

The CD4ζ CAR has been found to be a safe reagent in multiple, long-term clinical trials with over 500 patient years of clinical safety data.7 Previous usage of CD4ζ CAR in adoptive transferred T-cell therapy have had limited effects, potentially due to poor survival and functionality of the transduced cells.32 Treatment was well-tolerated and safe, but these studies were all confounded by the concurrent administration of combination antiretroviral therapy; although, it appeared in one trial that tissue viral replication was reduced.7 A significant problem was that the reinfused gene-modified T-cells were premorbid and dysfunctional due to HIV infection in the individual as well as massive ex vivo expansion. The net result was that they persisted only at low levels following reinfusion. In addition, these CD4ζ CAR expressing cells were susceptible to HIV infection due to expression of the CD4ζ CAR itself in the absence of anything to protect the cell from infection. Treatment through the redirection of peripheral T cells in HIV-infected individuals inherently has a different set of issues than the, thus far promising, use of CARs in treating malignancies, which are not confounded by the immune dysfunction created by HIV infection.1 It is highly likely that a approach such as a HSPC-based strategy involving the CD4ζ CAR would be most successful as a HIV cure strategy in combination with ART and/or strategies that are designed to stimulate persistently infected cells, allowing the newly produced CAR-containing cells to kill virally expressing populations in different reservoirs.

Herein, we demonstrate the potential to generate HIV-specific cells by redirecting T cells via stem cell gene therapy in a humanized mouse model. The triple CD4ζ CAR T cells undergo successful thymopoiesis and are protected from HIV infection. Most importantly, these triple CD4ζ CAR expressing T cells could differentiate from a naive phenotype into an effector phenotype, produce multifunctional T-cell responses, expand upon infection, and effectively suppress HIV replication in vivo. This suggests that the effector function of the triple CD4ζ CAR T cells plays important role in suppressing HIV infection. For mice that had weak expansion of CD4ζ CAR T cells, our data suggest that this is likely due to lower reconstitution of antigen-presenting cells, which provide crucial costimulatory signals for T-cell activation, in these mice. A current line of investigation is aimed at enhancing CAR-triggered response through the enhancement of APC development/function in this system. In sum, our results demonstrate the feasibility of modifying human HSPCs with protective CD4ζ CAR as a therapeutic approach against HIV infection.

Materials and Methods

Construction of triple CAR BLT mice. Triple CAR BLT mice were constructed similarly to previously reported HIV TCR-modified humanized mice.13 In short, CD34+ cells were purified via magnetic activated cell sorting with CD34-specific beads (Miltenyi, Auburn, CA) from freshly obtained fetal liver tissue. Cells were then transduced overnight with lentiviruses containing the control vector or the protective triple CAR utilizing a retronectin-based procedure.13 Cells were then transplanted into NSG mice with fetal liver stromal and fetal thymus in derived from the same tissue placed in matrigel. Three weeks after transplantation, the transplant mice were sublethally irradiated (3Gy), previously frozen CD34+ cells were thawed and transduced with the appropriate vector and 0.5 million transduced CD34+ cell were injected into each mouse. Transduction of the CD34+ cells was assessed by culturing 50,000 vector-treated CD34+ cells in liquid culture for 3 weeks. We typically obtained ~30% transduction with the triple CAR or control lentivirus vectors. Six to twelve weeks later, peripheral blood was collected and analyzed for human cell reconstitution; and, following confirmation of reconstitution, the mice were then infected with HIV-1NL4-3 (300ng p24, as determined by enzyme-linked immunosorbent assay).

Human fetal tissue was purchased from Advanced Biosciences Resources (Alameda, CA) or from Novogenix Laboratories (Los Angeles, CA) and was obtained without identifying information and did not require Institutional Review Board approval for its use. Animal research described in this manuscript was performed under the written approval of the UCLA Animal Research Committee (ARC) in accordance to all federal, state, and local guidelines. Specifically, these studies were carried out under strict accordance to the guidelines in The Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and the accreditation and guidelines of the Association for the Assessment and Accreditation of Laboratory Animal Care International under UCLA ARC Protocol Number 2010-038-02B. All surgeries were performed under ketamine/xylazine and isofluorane anesthesia and all efforts were made to minimize animal pain and discomfort.

Antibodies and flow cytometry. The following antibodies were used in flow cytometry: CD45, CD2, CD7, CD5, CD3, CD4, CD8, CD45RA, CD62L, CD38, CD19, CD14, CD337, CD56, TCRαβ (eBiosciences, San Diego, CA), and anti-HIV-1 core antigen clone KC57 (Beckman Coulter, Brea, CA). Cell surface markers are conjugated to either FITC, PE, PerCP-Cy5.5, PE-Cy5, PE-Cy7, EVD, APC, APC-eflou780, alexa700, eflour405, Pacific orange or pacific blue in appropriate combination. The cells were acquired using LSRFortessa flow cytometer (BD biosciences, San Jose, CA) and FACSDiva software. Data were analyzed using FlowJo software (Ashland, OR).

Lentiviral vector production. The lentivirus-based GFP control vector and triple CD4ζ CAR vector were produced in 293FT cells using the Invitrogen (Grand Island, NY) ViraPower Lentiviral Expression system with pCMV.ΔR8.2.Δvpr packaging plasmid and the pCMV-VSV-G envelope protein plasmid as previously described.10

Purification of viral RNA and reverse transcription in mouse plasma. Mouse peripheral blood was drawn by retro-orbital bleeding into glass capillary tubes coated with 330 mmol/l ethylenediaminetetraacetic acid (EDTA) (Gibco, Grand Island, NY), and 3% sterile human serum albumin (Baxter Healthcare, Deerfield, IL). Plasma was obtained by centrifuging the blood at 6,000 rpm for 3 minutes. Viral RNA was extracted from plasma with the QIAAmp Viral RNA extraction Kit (Qiagen Venlo, The Netherlands). Afterwards, cDNA were generated from viral RNA using high capacity reverse transcription kit (Life Technologies, Grand Island, NY).

DNA extraction of peripheral blood. Mouse peripheral blood was drawn by retro-orbital bleeding into glass capillary tubes coated with 330 mmol/l EDTA (Gibco), and 3% sterile human serum albumin (Baxter Healthcare). After red blood cell (RBC) lysis, DNA were extracted by phenol–chloroform extraction as previously described.33

Real-time polymerase chain reaction (PCR) of viral cDNA and DNA. Real-time PCR was performed with TaqMan Real time PCR Master Mix (Life Technologies) with the following primers and probe was used for real-time PCR of viral cDNA and DNA. FL-2 forward primer: 5′-CAATGGCAGCAATTTCACCA-3′; FL-2 Rev primer: 5′-GAATGCCAAATTCCTGCTTGA-3′; Probe: 5′-(6-FAM)CCCACCAACAGGCGGCCTTAACTG(Tamra-Q)-3′. These primers anneal in the pol region of the genome (4,577–4,653), within the first intron. HIV standards were made by linearizing pNL4.3 with EcoRI and quantitated by spectrophotometry.

Quantitation of TCR-rearrangment excision circles. Thymocytes from triple CAR or GFP vector-modified mice were sorted on a FACSAria (BD Biosciences) based on their expression of GFP and CD5. DNA was then extracted from sorted cells using phenol/chloroform. Real-time PCR was used to quantify TREC levels normalized to β-globin as described previously.34

Cytokine assay. CD8+ cells transduced with the control vector or the triple CD4ζ CAR vector, or splenocytes from HIV-1-infected triple CAR-containing mice were coincubated with uninfected or HIV-1-infected T1 target cells overnight and treated with GolgiPlug (BD Biosciences) for an additional 6 hours. Intracellular production of IFN-γ and TNF-α from CD4ζ CAR expressing cells were measured by intracellular staining and flow cytometry13

SUPPLEMENTARY MATERIAL Figure S1. In vivo T cell differentiation of TRIPLE CD4ζ CAR cells in humanized mice. Figure S2. TRIPLE CD4ζ CAR cells are protected from in vivo HIV-1 infection.

Acknowledgments

This work was funded by grants from the NIAID/NIH, grant no. RO1AI078806, the UCLA Center for AIDS Research (CFAR), grant no. P30AI28697, the California Institute for Regenerative Medicine, grant no. TR4-06845, and the UC Multi-campus Research Program and Initiatives, California Center BD Biosciences for Antiviral Drug discovery (CCADD) and California HIV/AIDS research Program F12-LA-215 (to AZ).

Supplementary Material

Supplementary Figures
Click here for additional data file. (377.9KB, pdf)

References

  1. Gill, S and June, CH (2015). Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunol Rev 263: 68–89. [DOI] [PubMed] [Google Scholar]
  2. Maus, MV, Grupp, SA, Porter, DL and June, CH (2014). Antibody-modified T cells: CARs take the front seat for hematologic malignancies. Blood 123: 2625–2635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Sadelain, M, Brentjens, R and Rivière, I (2013). The basic principles of chimeric antigen receptor design. Cancer Discov 3: 388–398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Kitchen, SG, Shimizu, S and An, DS (2011). Stem cell-based anti-HIV gene therapy. Virology 411: 260–272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Kiem, HP, Jerome, KR, Deeks, SG and McCune, JM (2012). Hematopoietic-stem-cell-based gene therapy for HIV disease. Cell Stem Cell 10: 137–147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Yang, OO, Tran, AC, Kalams, SA, Johnson, RP, Roberts, MR, Walker, BD (1997). Lysis of HIV-1-infected cells and inhibition of viral replication by universal receptor T cells. Proc Natl Acad Sci USA 94: 11478–22483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Scholler, JJ, Brady, TLT, Binder-Scholl, GG, Hwang, W-TW, Plesa, GG, Hege, KMK et al. (2012). Decade-long safety and function of retroviral-modified chimeric antigen receptor T cells. Sci Translat Med 4: 132ra53–132ra53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. van den Bent, MJ, Afra, D, de Witte, O, Ben Hassel, M, Schraub, S, Hoang-Xuan, K et al.; EORTC Radiotherapy and Brain Tumor Groups and the UK Medical Research Council. (2005). Long-term efficacy of early versus delayed radiotherapy for low-grade astrocytoma and oligodendroglioma in adults: the EORTC 22845 randomised trial. Lancet 366: 985–990. [DOI] [PubMed] [Google Scholar]
  9. Yang, OO, Tran, AC, Kalams, SA, Johnson, RP, Roberts, MR and Walker, BD (1997). Lysis of HIV-1-infected cells and inhibition of viral replication by universal receptor T cells. Proc Natl Acad Sci USA 94: 11478–11483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kitchen, SG, Bennett, M, Galić, Z, Kim, J, Xu, Q, Young, A et al. (2009). Engineering antigen-specific T cells from genetically modified human hematopoietic stem cells in immunodeficient mice. PLoS One 4: e8208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Vatakis, DN, Koya, RC, Nixon, CC, Wei, L, Kim, SG, Avancena, P et al. (2011). Antitumor activity from antigen-specific CD8 T cells generated in vivo from genetically engineered human hematopoietic stem cells. Proc Natl Acad Sci USA 108: E1408–E1416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Vatakis, DN, Arumugam, B, Kim, SG, Bristol, G, Yang, O and Zack, JA (2013). Introduction of exogenous T-cell receptors into human hematopoietic progenitors results in exclusion of endogenous T-cell receptor expression. Mol Ther 21: 1055–1063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kitchen, SG, Levin, BR, Bristol, G, Rezek, V, Kim, S, Aguilera-Sandoval, C et al. (2012). In vivo suppression of HIV by antigen specific T cells derived from engineered hematopoietic stem cells. PLoS Pathog 8: e1002649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lin, WY and Roberts, MR (2002). Developmental dissociation of T cells from B, NK, and myeloid cells revealed by MHC class II-specific chimeric immune receptors bearing TCR-zeta or FcR-gamma chain signaling domains. Blood 100: 3045–3048. [DOI] [PubMed] [Google Scholar]
  15. Hege, KM, Cooke, KS, Finer, MH, Zsebo, KM and Roberts, MR (1996). Systemic T cell-independent tumor immunity after transplantation of universal receptor-modified bone marrow into SCID mice. J Exp Med 184: 2261–2269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gill, S and Porter, DL (2014). CAR-modified anti-CD19 T cells for the treatment of B-cell malignancies: rules of the road. Expert Opin Biol Ther 14: 37–49. [DOI] [PubMed] [Google Scholar]
  17. Dudek, TE, No, DC, Seung, E, Vrbanac, VD, Fadda, L, Bhoumik, P et al. (2012). Rapid evolution of HIV-1 to functional CD8+ T cell responses in humanized BLT mice. Sci Transl Med 4: 143ra98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Brainard, DM, Seung, E, Frahm, N, Cariappa, A, Bailey, CC, Hart, WK et al. (2009). Induction of robust cellular and humoral virus-specific adaptive immune responses in human immunodeficiency virus-infected humanized BLT mice. J Virol 83: 7305–7321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ito, R, Takahashi, T, Katano, I and Ito, M (2012). Current advances in humanized mouse models. Cell Mol Immunol 9: 208–214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Shimizu, S, Hong, P, Arumugam, B, Pokomo, L, Boyer, J, Koizumi, N et al. (2010). A highly efficient short hairpin RNA potently down-regulates CCR5 expression in systemic lymphoid organs in the hu-BLT mouse model. Blood 115: 1534–1544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ringpis, GE, Shimizu, S, Arokium, H, Camba-Colón, J, Carroll, MV, Cortado, R et al. (2012). Engineering HIV-1-resistant T-cells from short-hairpin RNA-expressing hematopoietic stem/progenitor cells in humanized BLT mice. PLoS One 7: e53492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Qin, XF, An, DS, Chen, IS and Baltimore, D (2003). Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci USA 100: 183–188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Holt, N, Wang, J, Kim, K, Friedman, G, Wang, X, Taupin, V et al. (2010). Human hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5 control HIV-1 in vivo. Nat Biotechnol 28: 839–847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kitchen, SG, LaForge, S, Patel, VP, Kitchen, CM, Miceli, MC and Zack, JA (2002). Activation of CD8 T cells induces expression of CD4, which functions as a chemotactic receptor. Blood 99: 207–212. [DOI] [PubMed] [Google Scholar]
  25. Hall, C, Berkhout, B, Alarcon, B, Sancho, J, Wileman, T and Terhorst, C (1991). Requirements for cell surface expression of the human TCR/CD3 complex in non-T cells. Int Immunol 3: 359–368. [DOI] [PubMed] [Google Scholar]
  26. Verschoor, CP, Johnstone, J, Millar, J, Parsons, R, Lelic, A, Loeb, M et al. (2014). Alterations to the frequency and function of peripheral blood monocytes and associations with chronic disease in the advanced-age, frail elderly. PLoS One 9: e104522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Zhen, A and Kitchen, S (2014). Stem-cell-based gene therapy for HIV infection. Viruses 6: 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Deng, K, Pertea, M, Rongvaux, A, Wang, L, Durand, CM, Ghiaur, G et al. (2015). Broad CTL response is required to clear latent HIV-1 due to dominance of escape mutations. Nature 517: 381–385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mitsuyasu, RT, Merigan, TC, Carr, A, Zack, JA, Winters, MA, Workman, C et al. (2009). Phase 2 gene therapy trial of an anti-HIV ribozyme in autologous CD34+ cells. Nat Med 15: 285–292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Tey, SK (2014). Adoptive T-cell therapy: adverse events and safety switches. Clin Transl Immunology 3: e17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Tran, AC, Zhang, D, Byrn, R and Roberts, MR (1995). Chimeric zeta-receptors direct human natural killer (NK) effector function to permit killing of NK-resistant tumor cells and HIV-infected T lymphocytes. J Immunol 155: 1000–1009. [PubMed] [Google Scholar]
  32. Mitsuyasu, RT, Anton, PA, Deeks, SG, Scadden, DT, Connick, E, Downs, MT et al. (2000). Prolonged survival and tissue trafficking following adoptive transfer of CD4zeta gene-modified autologous CD4(+) and CD8(+) T cells in human immunodeficiency virus-infected subjects. Blood 96: 785–793. [PubMed] [Google Scholar]
  33. Bernstein, HB, Plasterer, MC, Schiff, SE, Kitchen, CM, Kitchen, S and Zack, JA (2006). CD4 expression on activated NK cells: ligation of CD4 induces cytokine expression and cell migration. J Immunol 177: 3669–3676. [DOI] [PubMed] [Google Scholar]
  34. Douek, DC, Vescio, RA, Betts, MR, Brenchley, JM, Hill, BJ, Zhang, L et al. (2000). Assessment of thymic output in adults after haematopoietic stem-cell transplantation and prediction of T-cell reconstitution. Lancet 355: 1875–1881. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures
Click here for additional data file. (377.9KB, pdf)

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES