Genetic engineering of AtAOX1a in Saccharomyces cerevisiae prevents oxidative damage and maintains redox homeostasis

Abstract

This study aimed to validate the physiological importance of Arabidopsis thaliana alternative oxidase 1a (AtAOX1a) in alleviating oxidative stress using Saccharomyces cerevisiae as a model organism. The AOX1a transformant (pYES2AtAOX1a) showed cyanide resistant and salicylhydroxamic acid (SHAM)‐sensitive respiration, indicating functional expression of AtAOX1a in S. cerevisiae. After exposure to oxidative stress, pYES2AtAOX1a showed better survival and a decrease in reactive oxygen species (ROS) when compared to S. cerevisiae with empty vector (pYES2). Furthermore, pYES2AtAOX1a sustained growth by regulating GPX2 and/or TSA2, and cellular NAD ⁺/NADH ratio. Thus, the expression of AtAOX1a in S. cerevisiae enhances its respiratory tolerance which, in turn, maintains cellular redox homeostasis and protects from oxidative damage.

Abbreviations

ADH

alcohol dehydrogenase

AOX

alternative oxidase

AtAOX1a

Arabidopsis thaliana alternative oxidase 1a

COX

cytochrome c oxidase

DCPIP

dichlorophenolindophenol

IPTG

isopropyl‐β‐d‐thiogalactopyranoside

PCD

programmed cell death

PG

propyl gallate

PMS

phenazine methosulfate

PVDF

polyvinylidene difluoride

ROS

reactive oxygen species

SHAM

salicylhydroxamic acid

SOD

superoxide dismutase

t‐BOOH

tert‐butyl hydroperoxide

TCA

tricarboxylic acid

UQ

ubiquinone

Alternative oxidase (AOX) is a nonproton pumping ubiquinol oxidase localized in the inner mitochondrial membrane of higher plants, fungi, some protists and was recently identified in 28 animal species 1. In contrast to cytochrome c oxidase (COX), it is cyanide resistant and branches from the ‘standard’ mitochondrial respiratory chain at the level of ubiquinone (UQ). It is considered as a sink for excess electrons as it reduces the molecular oxygen to water, bypassing the oxidative phosphorylation at both complex III and IV. Thus, AOX plays an important role in maintaining the cellular energy balance 2, 3, 4. A crystal structure of AOX from Trypanosome brucei revealed that it is a homodimer, which exists as an integral interfacial membrane protein with a nonhaem diiron carboxylate active site buried within a four helix bundle. The active site is ligated by four glutamate residues and a highly conserved Tyr220, which mediates its catalytic activity. Furthermore, the two hydrophobic cavities occur per monomer which bind to ubiquinol and Tyr220 for catalytic cycle and O₂ reduction 5, 6, 7.

AOX was first identified in thermogenic plants to provide favorable temperature during floral development to attract pollinators 8, 9, 10, 11. In nonthermogenic plants, AOX is known to prevent over‐reduction of UQ and generation of reactive oxygen species (ROS) while allowing continued operation of the tricarboxylic acid (TCA) cycle 12, 13, 14. On exposure to abiotic stress, AOX‐deficient plants showed an increase in intracellular ROS and a decrease in photosynthetic performance as compared to wild‐type plants 15, 16, 17, 18, 19. On the other hand, AOX overexpression lines showed an enhanced photosynthetic efficiency with lower levels of cellular ROS when compared with wild‐type plants during abiotic stress conditions 20, 21, 22. In Arabidopsis, overexpression of AOX1a alleviated the Al‐induced programmed cell death (PCD) by decreasing the ROS production due to efficient mitochondrial electron flux and caspase‐3‐like activation 23. Also, the role of AOX has been studied extensively in lower organisms since last two decades. Kumar and Söll 24 reported for the first time heterologous expression of Arabidopsis thaliana AOX into hemA‐deficient strains of Escherichia coli, which acquired resistance to cyanide and exhibited aerobic respiration. Later, several other studies also demonstrated the expression of AOX in many yeast, fungal, and bacterial species, which resulted in the successful operation of cyanide‐insensitive respiration 25, 26, 27, 28, 29, 30. Recently, Honda et al. 29 demonstrated the visual expression of AOX in Aspergillus niger transformants (harboring fusion gene aox1‐egfp) upon exposure to heat shock, oxidative, and osmotic stress. Furthermore, expression of AOX from Hansenula anomala in Saccharomyces cerevisiae resulted in up‐regulation of several proteins related to major metabolic pathways such as Krebs cycle and amino acid biosynthesis suggesting the physiological role of AOX in mitoproteome plasticity 31. The role of AOX is also revealed in the survival of pathogenic fungi such as Aspergillus fumigatus and Histoplasma capsulatum inside the host under stress conditions 32, 33. Similar to plants, the AOX mutant of pathogenic yeast Cryptococcus neoformans showed susceptibility to oxidative stress 34.

Yeast cells have become one of the most preferred experimental models to study the PCD and aging under oxidative stress, owing to special characteristics such as short life cycle and ease for genetic manipulation along with presence of core cellular processes similar to eukaryotes 35. In most of the aerobic cells, respiration is the major source for generation of superoxide radical (O₂ ⁻) as electrons leak out from the mitochondrial electron transport chain at Complex I and Complex III. Furthermore, dismutation of O₂ ⁻ by superoxide dismutase (SOD) generates H₂O₂, a quite stable toxic product which creates oxidative environment inside the cell 36. To detoxify the cellular H₂O₂, mitochondria have evolved an efficient antioxidant defense system such as catalase and peroxiredoxins, which include glutathione peroxidase/glutathione reductase and thioredoxin peroxidase/thioredoxin reductase 37. In spite of the existence of such a strong antioxidant defense system, several pet mutants (impaired in mitochondrial electron transport chain) of S. cerevisiae showed accumulation of H₂O₂. However, the addition of exogenous cytochrome c to isolated mitoplasts significantly decreased the H₂O₂ levels 38. In Candida albicans and Aspergillus niger, AOX was also induced along with cytochrome c under oxidizing conditions 30, 39. Thus, AOX pathway is known to play an important role in the alleviation of ROS and thereby oxidative stress, either independently or in association with the COX pathway and/or antioxidant defense system. Furthermore, a direct or an indirect role of AOX has also been demonstrated in maintaining redox homeostasis in higher plants in response to several abiotic stresses 18, 19, 40, 41, 42. However, such type of significance for AOX is yet to be elucidated in lower organisms.

In Arabidopsis, AOX1a is known to be induced under various oxidative stresses (imposed by biotic and abiotic stresses) and developmental stages 15, 16, 18, 43, 44, 45, which indicate that genetic engineering of AOX1a might be a promising tool to combat oxidative stress in AOX deficient strains or organisms. In the present study, AtAOX1a was heterologously expressed in S. cerevisiae (an eukaryotic organism devoid of AOX) to characterize its role in response to oxidative stress. To create an oxidative environment inside the cells, S. cerevisiae were incubated with H₂O₂ and tertiary‐butyl hydroperoxide (t‐BOOH). The functional expression of AtAOX1a and its characterization have been studied by monitoring the changes in respiration, growth, viability, ROS, antioxidant system, and redox state of S. cerevisiae under oxidizing conditions.

Materials and methods

Strains and culture conditions

Escherichia coli (E. coli) DH5α or BL21(DE3)pLysS (Invitrogen^™, Waltham, MA, USA) were grown at 37 °C in Luria–Bertani medium. Saccharomyces cerevisiae strain INVSc1 (Invitrogen^™) was grown at 30 °C either in YPD medium (1% w/v yeast extract, 2% w/v peptone and 2% w/v dextrose) or SC‐URA¯ minimal medium (0.67% w/v yeast nitrogen base without amino acids, 2% w/v glucose as carbon source) and amino acids.

Cloning of AtAOX1a and plasmid construction

Total RNA was isolated from A. thaliana wild‐type leaves using TRI reagent (Sigma‐Aldrich, St. Louis, MO, USA). One microgram of total RNA was used for the first‐strand cDNA synthesis using iScript^™ cDNA synthesis kit (Bio‐Rad, Hercules, CA, USA). AtAOX1a encoding a mature protein was amplified by Phusion DNA polymerase (Clontech, CA, USA) using the following primers: F‐GAGAATTCGCTAGCACGATCACTCTGG and R‐GGCTCGAGTCAATGATACCCAATTGGAG, and cloned into a pET28a(+)^™ expression vector. In contrast, AtAOX1a encoding a mature protein along with its leader sequence was amplified by using the primers: F‐GGGAATTCTGATGATGATAACTCGCGGTGG and R‐GGCTCGAGTCAATGATACCCAATTGGAG, and cloned into a pYES2/NT expression vector. Clones were confirmed by DNA sequencing. The recombinant plasmids were transformed into their respective host strains, i.e., BL21(DE3)pLysS and INVSc1.

Protein expression, purification, and antibody generation

The expression of AtAOX1a in E. coli BL21(DE3)pLysS was induced by 0.1 mm isopropyl‐β‐d‐thiogalactopyranoside (IPTG) at 28 °C for 4 h. The recombinant protein was purified under denaturing conditions with Ni‐NTA agarose column using standard protocols and the purified protein from the gel slice was subjected to a matrix‐assisted laser desorption ionization time‐of‐flight mass spectrometry (MALDI‐TOF/TOF) analysis as described in ref. 46 for confirmation as AtAOX1a. The purified protein was used to generate a polyclonal antibody in rabbit using standard protocols (Animal ethics approval number is UH/IAEC/KPMS/2014‐1/24).

AtAOX1a protein expression in Saccharomyces cerevisiae

For heterologous protein expression, S. cerevisiae with empty vector (pYES2) or transformed with AtAOX1a (pYES2AtAOX1a) were grown overnight in SC‐URA¯ minimal media containing 2% galactose as a carbon source. Protein was extracted using trichloroacetic acid (TCA) method 47 and separated on a 12.5% SDS/PAGE. For immunodetection, protein gel was electroblotted onto polyvinylidene difluoride (PVDF) membrane and treated with a polyclonal AOX1a antibody (generated as mentioned in section ‘Protein expression, purification, and antibody generation’) at 1 : 1000 dilutions followed by a goat anti‐rabbit IgG‐alkaline phosphate conjugate (Sigma, USA) at 1 : 5000 dilutions. The blot was developed using 5‐bromo‐4‐chloro‐3‐indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) system.

Oxidative stress

Oxidative stress analyses were performed as described earlier 48. Treatment duration was different for each set of experiments depending on their feasibility. The duration of oxidative stress treatment was fixed at 10 min for ROS estimation, 4 h for survival rate and growth recovery assay, and 75 min for pyridine nucleotides and transcript level analyses.

Measurement of O₂ uptake and cell survival rate

The respiratory O₂ uptake measurements (10 min) were performed using Clark‐type O₂ electrode 49, 50. The viability of cells was examined with fluctuation assay as reported by Dalal et al. 50.

Measurement of ROS

The intracellular ROS level was measured following Jang et al. 51. The cells were incubated with 100 μm 2′,7′‐ dichlorodihydrofluorescein diacetate (H₂DCF‐DA; Sigma) for 5 min in the dark at 25 °C, and the change in DCF fluorescence was imaged under a laser‐scanning confocal fluorescence microscope (LSM 710 NLO ConfoCor 3; Carl Zeiss, Jena, Germany).

Measurement of pyridine nucleotide content

The extraction and estimation of NAD⁺ and NADH were done as per Queval and Noctor 52. The assay involves phenazine methosulfate (PMS) catalyzed reduction of dichlorophenolindophenol (DCPIP) in the presence of alcohol dehydrogenase (ADH) and ethanol. The NAD⁺ and NADH content were calculated using the relevant standard (0–40 pmole).

RNA isolation and expression analysis

Total RNA was isolated using the acid‐phenol method 53. First strand cDNA was synthesized with 2 μg of total RNA using SuperScript^® III (Invitrogen) according to manufacturer's instructions. Primers used for real‐time PCR analysis are listed in Table 1 42. Comparative C _T method was used to analyze the relative gene expression levels 54.

Table 1.

List of primers used in real‐time PCR study. ACT1 was used as housekeeping gene

Gene	Accession no.	Primer sequence (5′ to 3′)	Amplicon length (bp)
SOD1	YJR104C	R‐TAACGACGCTTCTGCCTACA	191
SOD2	YHR008C		191
GPX2	YBR244W		172
TSA2	YDR453C		159
ACT1	YFL039C		184

Statistical analysis

All values are presented as means ± standard errors of the means (SEM). The statistical evaluation of the data was performed with one‐way analysis of variance (ANOVA), Tukey test of multiple comparison analysis using sigma plot 11.0 software (Systat, San Jose, CA, USA). P values of < 0.05 were considered as statistically significant.

Results

Expression of AtAOX1a in Escherichia coli and mass analysis

The expression of AtAOX1a protein induced in the presence of 0.1 mm IPTG in E. coli was visualized on SDS/PAGE as a ~ 36 kDa band as it includes AtAOX1a sequence encoding a mature protein (32.34 kDa) and pET28a(+) vector sequence (3.83 kDa) (Fig. 1A). Four major peptide fragments obtained during MALDI‐TOF‐TOF analysis of a trypsin‐digested protein showed the following sequences in Biotools: WPTDLFFQR (1209.81 Da), DVNHFASDIHYQGR (1658.04 Da), GNIENVPAPAIAIDYWR (1898.27 Da), and ELDKGNIENVPAPAIAIDYWR (2383.58 Da). As the sequences from these peptides showed 100% matching with Arabidopsis AOX1a (Fig. 1B, and Figs S1, S2A–D), the purified protein was injected into a rabbit and the polyclonal antibody was obtained.

Figure 1.

Purification profile and molecular mass analysis of a polyhistidine tagged pET28a‐AtAOX1a recombinant protein: (A) 12.5% SDS/PAGE depicting a ~ 36 kDa AtAOX1a protein in different fractions of the purification protocol. Abbreviations used are as follows: M‐marker, P‐pellet (insoluble protein), S‐supernatant (soluble protein), FT‐flow through (supernatant passed through Ni‐NTA column), W‐washing fractions, E‐elute (purified protein). (B) The sequences corresponding to peptide fragments with molecular masses of 1209.819, 1659.057, 1899.286, and 2384.592 Da, respectively, obtained from MALDI‐TOF‐TOF analysis of trypsin digested purified protein showed 100% matching to internal sequences (indicated in red font) of Arabidopsis thaliana AOX1a (AT3G22370), retrieved from NCBI database.

Functional characterization of AtAOX1a in Saccharomyces cerevisiae

The protein expression of AtAOX1a in S. cerevisiae was confirmed through western blot analysis (Fig. 2A). To ascertain the function of AtAOX1a, cyanide‐sensitive respiration was monitored using 1 mm KCN, an inhibitor of complex IV in COX pathway, while cyanide‐insensitive respiration was monitored in the presence of 2 mm salicylhydroxamic acid (SHAM) or 100 μm propyl gallate (PG), inhibitors of AOX in the alternative pathway. In the absence of metabolic inhibitors, the respiratory rates of pYES2AtAOX1a (8.6 ± 0.11 nmol O₂ s⁻¹) were similar to pYES2 (8.45 ± 0.09 nmol O₂ s⁻¹). But, in the presence of KCN, pYES2 showed a pronounced decrease in respiratory rates when compared with pYES2AtAOX1a. In contrast, addition of SHAM or PG significantly decreased the respiratory rates of pYES2AtAOX1a but not of pYES2 (Fig. 2B).

Figure 2.

Functional expression of AtAOX1a in Saccharomyces cerevisiae. (A) Western blot showing the AtAOX1a protein (44 kDa) expression in pYES2AtAOX1a (right side) but not in PYES2 (left side); (B) Rates of oxygen uptake by pYES2 and pYES2AtAOX1a in the absence or presence of KCN (1 mm), SHAM (2 mm), and PG (100 μm); (C) Time‐dependent growth curve of pYES2 and pYES2AtAOX1a in the absence or presence of KCN (1 mm) and (D) Growth recovery in pYES2 and pYES2AtAOX1a after KCN (1 mm) treatment for 4 h. Different lowercase alphabetical letters indicate statistically significant difference (P < 0.05).

The exponential growth pattern of both pYES2 and pYES2AtAOX1a were found to be similar (OD₆₀₀ = 2.1) up to 6 h. But, treatment with KCN remarkably decreased the exponential growth in yeast cells (Fig. 2C). However, the decrease in exponential growth of pYES2 was more significant when compared with pYES2AtAOX1a. Furthermore, in the presence of KCN, growth recovery was found to be higher in pYES2AtAOX1a than pYES2 (Fig. 2D). Taken together, these results indicate that AtAOX1a was successfully expressed and functional in S. cerevisiae.

Changes in cellular ROS during oxidative stress

Under control conditions, the cellular ROS was minimal in both pYES2 and pYES2AtAOX1a as indicated by DCF fluorescence. However, upon treatment with KCN, H₂O₂, or t‐BOOH, the fluorescence increased significantly in pYES2. In contrast, pYES2AtAOX1a restricted the increase in fluorescence during oxidative stress indicating the importance of AOX1a in preventing and/or regulating the ROS generation (Fig. 3).

Figure 3.

Effect of H₂O₂ (2 mm) or t‐BOOH (0.25 mm) on the intracellular ROS generation. ROS were monitored in pYES2 and pYES2AtAOX1a at 488 nm (excitation) and 525 nm (emission) wavelengths under a confocal fluorescence microscope as DCF fluorescence produced by the action of esterases on H₂ DCFDA. Sample treated with KCN (1 mm) was used as a positive control.

Changes in cell survival rate and growth recovery during oxidative stress

Among the two oxidants, H₂O₂ was found to be more lethal than t‐BOOH. Upon treatment with these oxidants, the survival rate of pYES2 decreased drastically as compared to pYES2AtAOX1a (Fig. 4A). Also, recovery assays clearly indicated an enhanced colony number in pYES2AtAOX1a than in pYES2 under oxidizing conditions with a clear visible difference at 1 × 10^−2.5 and 1 × 10⁻³ dilutions (Fig. 4B). It appears that AOX1a plays a critical role in decreasing the rates of cell death and improving their growth recovery under oxidizing conditions.

Figure 4.

Effect of H₂O₂ (2 mm) or t‐BOOH (0.25 mm) on (A) the cell survival rate and (B) return to growth assay in pYES2 and pYES2AtAOX1a. Different lowercase alphabetical letters indicate statistically significant difference (P < 0.05).

Differential antioxidant gene expression profile during oxidative stress

The ROS scavenging efficiency of pYES2 and pYES2AtAOX1a was measured by monitoring the changes in transcript levels of antioxidant genes viz., Superoxide dismutase 1 (SOD1), Superoxide dismutase 2 (SOD2), Glutathione peroxidase 2 (GPX2), and Thioredoxin peroxidase 2 (TSA2) during oxidative stress (Fig. 5A–D). Under control conditions, the expression of these antioxidant genes was approximately similar in both pYES2 and pYES2AtAOX1a. Upon treatment with H₂O₂ or t‐BOOH, the expression of SOD1 (> 8‐fold), SOD2 (> 6‐fold), GPX2 (> 52‐fold), and TSA2 (> 157‐fold) increased significantly by several fold in both pYES2 and pYES2AtAOX1a (Fig. 5A–D). But, the expression of GPX2 was down‐regulated significantly in pYES2AtAOX1a when compared with pYES2 in the presence of both H₂O₂ and t‐BOOH (Fig. 5C). In contrast, the expression of TSA2 was down‐regulated significantly in pYES2AtAOX1a when treated with t‐BOOH, while remained unchanged in the presence of H₂O₂ (Fig. 5D).

Figure 5.

Relative mRNA profile of the antioxidant genes (A) SOD1, (B) SOD2, (C) GPX2, and (D) TSA2 in pYES2 and pYES2AtAOX1a after exposure to H₂O₂ (2 mm) or t‐BOOH (0.25 mm). ACT1 was used as housekeeping gene. Different lowercase alphabetical letters indicate statistically significant difference (P < 0.05).

Changes in cellular redox during oxidative stress

The role of AtAOX1a in maintaining the cellular redox balance during oxidative stress was revealed by monitoring the changes in pyridine nucleotide (NAD⁺ and NADH) redox couple. In control, the cellular levels of NAD⁺, NADH, and the redox ratio of NAD⁺/NADH were similar in both pYES2 and pYES2AtAOX1a. Upon treatment with H₂O₂, the cellular NAD⁺ levels decreased significantly in both pYES2 and pYES2AtAOX1a (Fig. 6A). In contrast, the decrease in cellular NADH levels was significant in pYES2AtAOX1a alone (Fig. 6B). Consequently, the cellular redox ratio of NAD⁺/NADH was maintained at much higher levels in pYES2AtAOX1a when compared with pYES2 in the presence of H₂O₂ (Fig. 6C).

Figure 6.

Changes in the total cellular pyridine nucleotides (A) NAD ⁺; (B) NADH; and (C) ratio of NAD ⁺ to NADH in pYES2 and pYES2AtAOX1a upon treatment with H₂O₂ (2 mm) or t‐BOOH (0.25 mm). Different lowercase alphabetical letters indicate statistically significant difference (P < 0.05).

The responses of NAD⁺, NADH, and consequently NAD⁺/NADH were quite different in t‐BOOH‐treated samples as compared to H₂O₂ treatment. In the presence of t‐BOOH, both NAD⁺ and NADH levels increased significantly, while the redox ratio of NAD⁺/NADH decreased drastically in pYES2AtAOX1a when compared with pYES2 (Fig. 6A–C).

Discussion

In higher plants, AOX is known to perform several mitochondrial and extramitochondrial functions, viz: (a) alleviation of reactive oxygen and nitrogen species, and cell death 16, 55, 56, 57, (b) preventing over‐reduction of chloroplastic/mitochondrial electron transport carriers, particularly plastoquinone or UQ 13, (c) maintenance of cellular redox and carbon balance 18, 19, 58, (d) modulation of cellular energy level 59, and (e) optimization of photosynthesis during a wide range of biotic and abiotic stresses 18, 19, 60, 61. The role of AOX in alleviating ROS levels and oxidative stress is not only confined to plants but was also revealed in several nonphotosynthetic organisms including fungi, protists, bacteria, and human cells 29, 39, 62, 63. These observations suggest that engineering of AOX into such species which are deficient in AOX may help them to cope up against various biotic and abiotic stresses.

Saccharomyces cerevisiae lacks an AOX homolog 64. Therefore, AtAOX1a was expressed in S. cerevisiae to validate its physiological function during oxidative stress (Fig. 2A). It is well known that any restriction of electron flow through the COX pathway or exposure to oxidative stress leads to an induction of AOX in plants and fungi 21, 27, 60, 65. Corroborating with these studies, restriction of electron transport through the COX pathway by KCN caused a significant reduction in the total respiratory rates of pYES2 and pYES2AtAOX1a. However, due to an AOX catalyzed respiration, pYES2AtAOX1a showed higher respiratory rates compared to pYES2. While the SHAM‐insensitive respiration in pYES2 indicates the absence of AOX‐catalyzed respiration, SHAM or PG‐sensitive respiration in pYES2AtAOX1a confirms the functional expression of AtAOX1a in yeast (Fig. 2B) 29, 39. Any increase in the respiratory activity is known to increase the chronological and replicative lifespan of yeast 66. Also, the recovery in the growth curve assays and a rise in the total respiratory rates of pYES2AtAOX1a in the presence of KCN reveal the significance of AOX‐catalyzed respiration in the maintenance of yeast cell growth (Fig. 2B–D).

ROS production is a common phenomenon in cells, which occurs during aerobic respiration or in response to several biotic or abiotic stresses. But, excessive ROS production leads to oxidative stress 67, 68, 69. Yeast cells show a range of responses depending on the concentration of cellular ROS. At very low levels of ROS, the cells try to adapt themselves, while at higher levels of ROS, the cells activate their antioxidant defense system mediated by Yap1p and Msn2,4p transcription factors 70. Beyond this, ROS might arrest the cell cycle leading to apoptosis 71, 72. In the present study, the higher levels of cellular ROS induced by KCN, H₂O₂, or t‐BOOH in pYES2 were positively correlated with cell death and negatively correlated with growth recovery. In contrast, the lower levels of ROS, better survival rate, and growth recovery recorded under oxidizing environment in pYES2AtAOX1a indicate the importance of AOX catalyzed respiration in mitigating the cellular ROS production (Figs 3 and 4A,B).

Redox homeostasis is a basic requirement to maintain the cellular metabolism and ROS, particularly during aging 72, 73. Accumulation of NADH decreases the Sir2 activity, which is essential for chromatin silencing and extension of life span. Thus, any increase in the redox ratio of NAD⁺/NADH extended the chronological as well as replicating life span of yeast cells 74, 75. The pYES2AtAOX1a showed an increase in the NAD⁺/NADH ratio when compared with pYES2 upon treatment with H₂O₂. In contrast, pYES2AtAOX1a maintained the cellular redox homeostasis by minimizing the redox ratio of NAD⁺/NADH raised by t‐BOOH. These results elucidate the importance of AtAOX1a in the maintenance of cellular redox homeostasis to increase the life span as evident by cell survival rate of yeast (Figs 4A,B and 6C).

Furthermore, the sulphydryl (‒SH) group plays a critical role in proper functioning of several of the enzymes, transcription factors, and membrane proteins, which in turn play a significant role in maintaining the cellular redox homeostasis 73. During oxidative stress, cysteine sulfhydryl residues are oxidized to disulfide bonds, thereby leading to a loss in protein activity. Small heat‐stable oxidoreductases, glutaredoxins, and thioredoxins catalyze the reduction of disulfides to thiols using thiolated cysteine residues present in the active sites 73, 76, 77. A few studies reported the role of glutaredoxins and thioredoxins in supplying reducing equivalents to the regulatory sulfhydryl/disulfide system of AOX to activate it, which in turn play a role in preventing the over‐reduction of mitochondrial electron transport carriers and thereby ROS generation 78, 79, 80. In the present study, a several fold increase in the transcript levels of GPX2 and TSA2 in pYES2 and their down‐regulation in pYES2AtAOX1a in the presence of t‐BOOH and/or H₂O₂ suggests the role of AOX1a in regulating the expression of these antioxidant enzymes, which play an important role in the detoxification of ROS and the maintenance of cellular redox balance (Figs 3, 5C,D and 6C).

The results from the present study suggest that transformation of AtAOX1a introduced AOX‐catalyzed respiration in S. cerevisiae, which in turn mitigated ROS generation by regulating GPX2 and TSA2 to maintain cellular redox homeostasis and better cell survival rate during oxidative stress.

Author contributions

KP conceived and supervised the study; KP, SDT and AV designed the experiments; AV and AD acquired the data; KP, SDT, PBK and AV analyzed and interpreted the data; AV wrote the paper; KP edited the paper; SDT and PBK contributed important intellectual content.

Supporting information

Fig. S1 MALDI‐TOF‐TOF mass spectrum of trypsin digested purified AtAOX1a protein between 500 and 5000 m/z.

Fig. S2 Lift spectrum and Biotools display of four major peaks from trypsin digested AtAOX1a protein: (A) m/z 1209.819, (B) 1659.057, (C) 1899.286, and (D) 2384.592.