Skip to main content
Acta Crystallographica Section F: Structural Biology Communications logoLink to Acta Crystallographica Section F: Structural Biology Communications
. 2016 Mar 16;72(Pt 4):288–293. doi: 10.1107/S2053230X16003617

Crystal structure of a putative exo-β-1,3-galactanase from Bifidobacterium bifidum S17

Andre S Godoy a, Mariana Z T de Lima a, Cesar M Camilo b, Igor Polikarpov a,*
PMCID: PMC4822985  PMID: 27050262

The production, crystallization and X-ray structure of a putative exo-β-1,3-galactanase from B. bifidum S17 (BbGal43A) are reported. BbGal43A is a putative single-domain enzyme from glycoside hydrolase family 43, which possibly acts as a dimer.

Keywords: galactanase, Bifidobacterium, GH43, family 43, hydrolase

Abstract

Given the current interest in second-generation biofuels, carbohydrate-active enzymes have become the most important tool to overcome the structural recalcitrance of the plant cell wall. While some glycoside hydrolase families have been exhaustively described, others remain poorly characterized, especially with regard to structural information. The family 43 glycoside hydrolases are a diverse group of inverting enzymes; the available structure information on these enzymes is mainly from xylosidases and arabinofuranosidase. Currently, only one structure of an exo-β-1,3-galactanase is available. Here, the production, crystallization and structure determination of a putative exo-β-1,3-galactanase from Bifidobacterium bifidum S17 (BbGal43A) are described. BbGal43A was successfully produced and showed activity towards synthetic galactosides. BbGal43A was subsequently crystallized and data were collected to 1.4 Å resolution. The structure shows a single-domain molecule, differing from known homologues, and crystal contact analysis predicts the formation of a dimer in solution. Further biochemical studies are necessary to elucidate the differences between BbGal43A and its characterized homologues.

1. Introduction  

Growing insecurity about the availability and environmental impact of nonrenewable energy resources has promoted an intensive search for renewable alternatives (Mohanram et al., 2013 ▸). In such a scenario, the production of enzymes for the transformation of plant biomass into biofuels and green chemicals has become an important area of research and technological development in many industries and scientific institutions. Carbohydrate-active enzymes (CAZymes; Lombard et al., 2014 ▸) are the prime biological tool to overcome the structural recalcitrance of the plant cell wall and reduce its biochemical complexity to simple monosaccharides and oligosaccharides (Payne et al., 2015 ▸).

Glycoside hydrolase family 43 (GH43) is a complex group of inverting CAZymes with distinct functions, including β-xylosidases (EC 3.2.1.37), α-l-arabinofuranosidases (EC 3.2.1.55), arabinanases (EC 3.2.1.99), xylanases (EC 3.2.1.8) and galactan 1,3-β-galactosidases (EC 3.2.1.145), among others (Lombard et al., 2014 ▸). The family contains 31 structurally characterized members, which are mainly xylosidases and arabinofuranosidases. The exo-β-1,3-galactanase from Clostridium thermocellum (Ct1,3Gal43A; PDB entry 3vsf) presently remains the only structurally and biochemically characterized GH43 β-1,3-galactanase (Jiang et al., 2012 ▸).

Here, we describe the cloning, purification and crystal structure solution of a member of GH43 from Bifidobacterium bifidum S17 (BbGal43A) at 1.4 Å resolution. BbGal43A shares 29% sequence identity with the exo-β-1,3-galactanase Ct1,3Gal43A and also 30% sequence identity with domain I of the Bacteroides thetaiotaomicron glycosyl hydrolase from the GH43 family (BT2959; PDB entry 3nqh; Joint Center for Structural Genomics, unpublished work). BbGal43A is a single-domain molecule, while both of the available structural homologues are catalytic domains covalently linked to a carbohydrate-binding domain 13 (CBM13; Jiang et al., 2012 ▸). BbGal43A also shows activity towards synthetic galactosides and evidence of quaternary assembly. Clearly, further structural and biochemical studies are needed to understand the differences between the structural architectures and the enzymatic specificities of these homologues.

2. Materials and methods  

2.1. Cloning and purification of BbGal43A  

The gene encoding BbGal43A (GenBank EFR51240.1) from B. bifidum strain S17 (NCIMB 41171) was amplified from a genomic DNA library and cloned into the expression vector pET_TrxA by ligation-independent cloning (LIC; Aslanidis & de Jong, 1990 ▸) using Phusion High-Fidelity DNA Polymerase (NEB, USA). Both the 912 bp gene product and the linearized vector were treated with 0.33 units of T4 DNA Polymerase (Fermentas, Canada) in the presence of 1× T4 Polymerase Buffer, 4.0 mM DTT and 2.5 mM dATP (for the gene) or 2.5 mM dTTP (for the vector). The reactions were incubated for 30 min at 296 K and were subsequently heat-inactivated for 20 min at 348 K. A 1.0 µl volume of vector treated with T4 Polymerase was mixed with 3.0 µl PCR fragment treated with T4 Polymerase and incubated at 298 K for 30 min, followed by chemical transformation into Escherichia coli DH10B and Rosetta(DE3) cells. Positive colonies were selected by colony PCR. Details of primers and source information can be found in Table 1 ▸.

Table 1. Cloning information for BbGal43A.

Source organism B. bifidum S17
DNA source Genomic
Forward primer CAGGGCGCCATGGCTGATAGATTCGGAGC
Reverse primer GACCCGACGCGGTTAGCGGTGGGTGGTG
Expression vector pET_TrxA
Expression host E. coli Rosetta(DE3)
Complete amino-acid sequence of the construct produced MADRFGAFLPHDTSGDVAQLHGIGLQKFGDTWYAYGENKVNGNLFQGVCCYTTTDFIAWRSHGIVLDVQEDGSALAADRIGERPKVLHCPATGKYVMYIHAETPDYGYAHIGVAVADAPTGPFAFQTTITWRGYLSRDIGVFQDEDGSGYIMSEDRDHGTHIYRLADDYLTIVEDVACERATDYPYGLESPTIIKKDGLYYWFGSQLTSWDTNDNKYSTATDLHGPWSEWKLFAPEGAKTYDSQVDIVVPLDDDPYNSEHFLFIGDRWQEHDLGNSPIVQMPISIADGVASLTWSDTYEGTTHR

Rosetta(DE3) cells containing the recombinant vector were aerobically cultured at 310 K in auto-induction broth (3.3 g l−1 ammonium sulfate, 6.8 g l−1 KH2PO4, 7.1 g l−1 Na2HPO4, 5.0 g l−1 glycerol, 0.5 g l−1 glucose, 2.0 g l−1 lactose, 10 g l−1 tryptone and 5.0 g l−1 yeast extract) supplemented with 50 µg ml−1 kanamycin and 33 µg ml−1 chloramphenicol (final concentrations). The cells were induced with 1 mM IPTG at an OD of 0.7 and growth was continued at the decreased temperature of 274 K for 20 h at 200 rev min−1. The cells were harvested by centrifugation (4000g for 20 min at 277 K) and resuspended in 50 ml buffer A (50 mM Tris pH 7.5, 50 mM NaCl, 5.0 mM imidazole, 10% glycerol, 1.0 mM DTT, 0.1 mM PMSF, 200 µg ml−1 lysozyme) per litre of culture. The lysate was then sonicated in an ice bath using a Model 550 Sonic Dismembrator (Fisher Scientific). Cell debris was removed by centrifugation (22 000g for 20 min at 277 K) and the soluble fraction was loaded onto Ni–NTA Superflow Affinity Resin (GE Healthcare) equilibrated with 50 mM Tris pH 7.5, 500 mM NaCl, 10 mM imidazole and eluted using an imidazole gradient (30–500 mM). The fraction containing the purified protein was diluted four times using 50 mM Tris pH 7.5. The Trx-His tag fusion was cleaved with Tobacco etch virus (TEV) protease at 275 K overnight. The cleaved protein was loaded onto Ni–NTA Superflow Affinity Resin (GE Healthcare) equilibrated with 50 mM Tris pH 8.0, 10 mM imidazole and then eluted without imidazole.

Size-exclusion chromatography was then performed on a Superdex 200 HiLoad 16/60 column (GE Healthcare) attached to an ÄKTApurifier (GE Healthcare) chromatographic system with 20 mM HEPES pH 7.5, 150 mM NaCl at a flow rate of 0.8 ml min−1. The column was calibrated with a Gel Filtration HMW Calibration Kit (GE Healthcare) according to the manufacturer’s instructions. The elution volume and the theoretical mass of BbGal43A calculated with ProtParam (Wilkins et al., 1999 ▸) were compared to estimate the oligomerization state of the molecule in solution. The purity of all samples was estimated by 15% SDS–PAGE.

2.2. Crystallization and X-ray diffraction data collection  

The protein was concentrated to 80 mg ml−1 using 10 000 molecular-weight cutoff centrifugal filter concentrators (Millipore, USA) at 4000g and its concentration was determined using a NanoDrop 000 (Thermo Scientific, USA) with a theoretical extinction coefficient of 78 060 M −1 cm−1 at 280 nm (Wilkins et al., 1999 ▸). Initial crystallization screening was performed at 291 K using a HoneyBee system (Digilab) and commercial crystallization kits. Details of crystallization can be found in Table 2 ▸.

Table 2. Crystallization.

Method Vapour diffusion
Plate type Intelli-Plate 96 (Hampton Research)
Temperature (K) 290
Protein concentration (mg ml−1) 80
Buffer composition of protein solution 0.02 M HEPES pH 7.5, 0.15 M NaCl
Composition of reservoir solution 0.05 M calcium chloride dihydrate, 0.1 M bis-tris pH 6.5, 30%(v/v) polyethylene glycol monomethyl ether 550
Volume and ratio of drop 1.0 µl, 1:1
Volume of reservoir (µl) 80

2.3. Data collection and processing  

Crystals were harvested, cryoprotected by adding 10%(v/v) ethylene glycol and data were collected on beamline X4C at the National Synchrotron Light Source (NSLS), USA equipped with a MAR 165 CCD detector. The diffraction data were integrated with XDS (Kabsch, 2010 ▸) and scaled with AIMLESS (Evans & Murshudov, 2013 ▸). Details of data-collection and processing statistics can be found in Table 3 ▸.

Table 3. Data collection and processing.

Values in parentheses are for the highest resolution shell.

Diffraction source Beamline X4C, NSLS
Wavelength (Å) 1.1
Temperature (K) 100
Detector MAR CCD
Space group P212121
a, b, c (Å) 64.93, 67.34, 202.13
α, β, γ (°) 90, 90, 90
Resolution range (Å) 47.60–1.40 (1.42–1.40)
Total No. of reflections 1396640 (66108)
No. of unique reflections 174550 (8500)
Mosaicity (°) 0.23
Completeness (%) 99.9 (99.8)
Multiplicity 8.0 (7.8)
〈I/σ(I)〉 16.6 (1.9)
R p.i.m. 0.036 (0.59)
CC1/2 0.99 (0.62)
Overall B factor from Wilson plot (Å2) 14.67

2.4. Structure solution and refinement  

The solvent content was estimated using the Matthews coefficient (Matthews, 1968 ▸) as determined in phenix.xtriage (Adams et al., 2010 ▸). The protein structure was solved by molecular replacement with Phaser (McCoy et al., 2007 ▸) using domain I of the B. thetaiotaomicron glycosyl hydrolase as the search model (BT2959; PDB entry 3nqh, 30% sequence identity; Joint Center for Structural Genomics, unpublished work). The model was refined with phenix.refine and validated with MolProbity and Coot (Emsley et al., 2010 ▸; Chen et al., 2010 ▸). PyMOL was used to produce the figures (Schrödinger). Details of the refinement statistics are given in Table 4 ▸. Alignment and sequence analyses were performed with ClustalW v.2.0 and ESPript v.3.0 (Robert & Gouet, 2014 ▸).

Table 4. Structure-refinement statistics.

Values in parentheses are for the highest resolution shell.

Resolution range (Å) 19.9–1.42 (1.42–1.40)
Completeness (%) 100.0 (99.8)
No. of reflections, working set 174374
No. of reflections, test set 1698
Estimated twinning fraction 0.060 for k, h, −l
Final R cryst 0.162
Final R free 0.183
No. of non-H atoms
 Protein 4869
 Ligand 14
 Water 1261
 Total 6144
R.m.s. deviations
 Bonds (Å) 0.011
 Angles (°) 1.088
Average B factors (Å2)
 Protein 17.7
 Ligand 52.4
 Water 39.3
Ramachandran plot
 Favoured regions (%) 97.3
 Additionally allowed (%) 2.5

3. Results and discussion  

3.1. Production and crystallization of BbGal43A  

BbGal43A was successfully purified using the protocol described above, with a total protein yield of 40 mg per litre of culture. SDS–PAGE shows that protein is highly pure and its molecular weight is close to the 33 kDa marker (data not shown). The theoretical mass of the sequence, as computed with ProtParam, is approximately 34 kDa. Analytical gel filtration was used to estimate the molecular weight of BbGal43A in solution. The protein peak eluted at 80.7 ml, suggesting a molecular weight of approximately 67.3 kDa (Fig. 1 ▸ a). This result suggests that the protein is a dimer in solution.

Figure 1.

Figure 1

General features of BbGal43A. (a) Chromatogram of BbGal43A purification on a HiLoad Superdex 200 16/60 column and linear regression of its calibration with molecular standards. (b) The putative catalytic residues Asp138 and Glu189. (c) An amino-acid sequence alignment shows conservation of the catalytic residues between the homologous structures BbGal43A, Ct1,3Gal43A and BT2959 (3NQH). Conserved residues are shown in red boxes (conserved in all) and blue boxes (conserved in at least two of the three). β-Strands are denoted as arrows and β-turns are denoted TT. Alignment was performed with ClustalW2 and the figures were produced with OriginPro v.9.0, PyMOL and ESPript v.3.0.

Precipitation assays with 30%(w/v) PEG 4000 and 2.4 M ammonium sulfate indicated that protein is highly soluble, since precipitation only took place when the protein concentration was increased to about 100 mg ml−1. Because of this, we used a concentration of 80 mg ml−1 in crystallization trials. Crystals of BbGal43A appeared in many conditions from the Index HT screen (Hampton Research), and crystals of 1.0 × 0.4 × 0.4 mm in size grew using 0.05 M calcium chloride dehydrate, 0.1 M bis-tris pH 6.5, 30%(v/v) polyethylene glycol monomethyl ether 550.

3.2. Structure determination and refinement of BbGal43A  

BbGal43A crystallized in space group P212121, with unit-cell parameters a = 64.9, b = 67.3, c = 202.1 Å. The data set was integrated from 20 to 1.4 Å resolution, with 99.8% completeness in the highest resolution shell. The scaled data resulted in a total of 174 550 unique reflections, 1% (1698) of which were set aside as the R free set. The data-collection statistics are presented in Table 3 ▸. The Matthews coefficient indicated the presence of between two (solvent content 0.62, p = 0.38) and three (solvent content 0.43, p = 0.57) molecules in the asymmetric unit. Molecular replacement was performed with Phaser (McCoy et al., 2007 ▸) and two molecules were found in the asymmetric unit (TFZ = 18.4, LLG = 270.6). Initial model building was carried out with AutoBuild in PHENIX (Adams et al., 2010 ▸) and the final models were hand-built using Coot (Emsley et al., 2010 ▸). L-tests suggested pseudo-merohedral twinning with a twin fraction of 0.06 and operator k, h, −l, and this operator was applied in the subsequent refinement steps. The electron density allowed us to model a total of 6144 non-H atoms, of which 6130 were refined against isotropic B factors, as suggested by phenix.refine (Afonine et al., 2012 ▸) and PDB_REDO (Joosten et al., 2014 ▸). All refinement was carried out with phenix.refine and the model was validated in MolProbity (Chen et al., 2010 ▸). Translation/libration/screw (TLS) restraints improved the electron density remarkably in the final refinement cycles. At the end of the refinement, 98.5% of the rotamers were in favoured positions, while none were in found in a poor position. Also, no residues were found in disallowed regions of the Ramachandran plot, while 97.5% of residues were in favoured regions. A total of 20 residues were assigned in multiple conformations and were refined with split occupancy in both forms. The final model has R work and R free values of 0.16 and 0.18, respectively, and full refinement and validation statistics are given in Table 4 ▸.

3.3. Overall structure and quaternary assembly of BbGal43A  

BbGal43A has a typical fivefold β-propeller fold, with the propellers formed by four β-sheets (Fig. 2 ▸ a). BbGal43A has 304 residues, and is significantly smaller than the homologous Ct1,3Gal43A (571 residues). BbGal43A is remarkably similar to the catalytic domain of the homologous Ct1,3Gal43A and BT2959, with r.m.s.d.s of 1.04 and 0.95 Å (both for 302 Cα atoms), respectively. The main structural difference between BbGal43A and Ct1,3Gal43A is the lack of the CBM13 domain (Fig. 2 ▸ b), which was proposed to have a fundamental region for delivery of the substrate from this domain to the active site (Jiang et al., 2012 ▸). BbGal43A is a single-domain active putative enzyme and may utilize a different, as yet unknown mechanism for substrate allocation.

Figure 2.

Figure 2

(a) Asymmetric unit assembly of the BbGal43A crystal structure. This dimer assembly was also suggested by PISA to be the quaternary conformation of BbGal43A in solution. (b) Superposition of BbGal43A (green) and Ct1,3Gal43A (red)

Structural and sequence homology between BbGal43A, Ct1,3Gal43A and BT2959 indicate that all three enzymes might be different types of exo-β-1,3-galactanase, although further biochemical characterization needs to be conducted to confirm this. GH43 family members are inverting hydrolases, in which the main proton donor and acceptor residues are supposed to be an aspartate and a glutamic acid, respectively (Lombard et al., 2014 ▸). By comparing the structure with the characterized and homologous Ct1,3Gal43A, we suggested the catalytic residues to be Glu112 (auxiliary), Asp138 (nucleophile) and Glu189 (proton donor). The corresponding residues are conserved in putative exo-β-1,3-galactanases homologous to Ct1,3Gal43A (Fig. 1 ▸ c).

PISA (Krissinel & Henrick, 2007 ▸) analysis suggests that the dimer observed in the asymmetric unit of the determined crystal structure (with a total of two salt bridges and 22 hydrogen bonds between the two molecules) may be similar to its quaternary assembly in solution, and the main inter­actions are formed between the β9 strands of each chain (Fig. 3 ▸ a). According to PISA, 9.3% of the total surface of the protein (928 Å) is involved in interactions with the neighbouring chain, where 28 residues forms strong and weak interactions between chains. The most notable are residues 125–132, contained in strand β9, which contribute 17 hydrogen bonds and one salt bridge to the neighbouring β9 strand or the loop comprised of residues 69–73 (Fig. 3 ▸ a). As mentioned above, analytical gel filtration also suggests a dimeric configuration of BbGal43A in solution (Fig. 1 ▸ a). The formation of a dimer was not observed in homologues of BbGal43A such as Ct1,3Gal43A (Jiang et al., 2012 ▸), and appears to be a unique characteristic of this single-domain group of GH43s. A more complete characterization is required in order to understand the role of dimerization in the activity of BbGal43A.

Figure 3.

Figure 3

(a) Dimerization interface from asymmetric unit and PISA analysis, with the main residues highlighted as sticks. Chain A is coloured red and chain B is coloured blue. Residues are only marked for chain B. (b) View of the bis-tris ligand at the active site of chain B of BbGal43A. The F o − F c map (green, 1.0σ) suggested the presence of a ligand, which was identified as a bis-tris molecule.

3.4. A bis-tris molecule is bound to the putative active site  

The F o − F c electron density suggests the presence of a ligand in the putative active site (Fig. 3 ▸ b), which we identified as a molecule of 2-[bis(2-hydroxyethyl)amino]-2-(hydroxy­methyl)propane-1,3-diol (BTB) originating from the crystallization conditions (Fig. 3 ▸ b). The electron density was observed in both chains, but we were only able to model BTB in chain B. The electron density of the BTB molecule in chain A is poor and appears to accept multiple superposed conformations of the molecule. The modelled molecule forms hydrogen bonds to the putative catalytic residue Asp138 (2.7 Å, OD2–O1) and other residues from the putative active site, such as Glu189 (2.6 Å, OE2–O4). It has been proposed that GH43 enzymes require a third catalytic glutamic acid (Ichinose et al., 2005 ▸), but the corresponding position is occupied by a glycine in BbGal43A (Gly22) and Ct1,3Gal43A (Gly54) (Jiang et al., 2012 ▸). Furthermore, it was demonstrated that mutation of Glu112 in Ct1,3Gal43A completely eliminated the enzyme activity (Jiang et al., 2012 ▸). BbGal43A, on the other hand, contains Glu82, which could be the third catalytic residue of the enzyme (Fig. 1 ▸ b). More detailed studies using natural enzyme ligands need to be performed in order to understand the architecture of the active site.

4. Conclusions  

BbGal43A was successfully cloned, produced, purified and crystallized. The well shaped crystals allowed us to collect X-ray diffraction data to 1.4 Å resolution at the synchrotron source. The structure was successfully solved by molecular replacement and contains two molecules in the asymmetric unit, which might correspond to a quaternary assembly of BbGal43A in solution. BbGal43A has a typical fivefold β-propeller fold, but lacks the CBM13 domain found in homologous enzymes. A more detailed enzymatic characterization is required to fully understand the biochemical properties of BbGal43A.

Supplementary Material

PDB reference: exo-β-1,3-galactanase, 5flw

Acknowledgments

We would like to thank Professor Professor Christian Riedel from Ulm University, Germany for donating B. bifidum S17, as well as the RapiData 2013 organization committee. We would also like to acknowledge the grants from the Brazilian funding agencies Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP; Nos. 2008/56255-9, 2009/52840-7, 2009/05328-9, 2011/05712-3 and 2011/20505-4) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq; Nos. 490022/2009-0, 301981/2011-6 and 400045/2012-5), CAPES and Universidade de São Paulo ‘Centro de Instrumentação para Estudos Avançados de Materiais Nanoestruturados e Biossistemas’ and ‘Núcleo de Apoio à Pesquisa em Bioenergia e Sustentabilidade (NAPBS)’ .

References

  1. Adams, P. D. et al. (2010). Acta Cryst. D66, 213–221.
  2. Afonine, P. V., Grosse-Kunstleve, R. W., Echols, N., Headd, J. J., Moriarty, N. W., Mustyakimov, M., Terwilliger, T. C., Urzhumtsev, A., Zwart, P. H. & Adams, P. D. (2012). Acta Cryst. D68, 352–367. [DOI] [PMC free article] [PubMed]
  3. Aslanidis, C. & de Jong, P. J. (1990). Nucleic Acids Res. 18, 6069–6074. [DOI] [PMC free article] [PubMed]
  4. Chen, V. B., Arendall, W. B., Headd, J. J., Keedy, D. A., Immormino, R. M., Kapral, G. J., Murray, L. W., Richardson, J. S. & Richardson, D. C. (2010). Acta Cryst. D66, 12–21. [DOI] [PMC free article] [PubMed]
  5. Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. (2010). Acta Cryst. D66, 486–501. [DOI] [PMC free article] [PubMed]
  6. Evans, P. R. & Murshudov, G. N. (2013). Acta Cryst. D69, 1204–1214. [DOI] [PMC free article] [PubMed]
  7. Ichinose, H., Yoshida, M., Kotake, T., Kuno, A., Igarashi, K., Tsumuraya, Y., Samejima, M., Hirabayashi, J., Kobayashi, H. & Kaneko, S. (2005). J. Biol. Chem. 280, 25820–25829. [DOI] [PubMed]
  8. Jiang, D., Fan, J., Wang, X., Zhao, Y., Huang, B., Liu, J. & Zhang, X. C. (2012). J. Struct. Biol. 180, 447–457. [DOI] [PubMed]
  9. Joosten, R. P., Long, F., Murshudov, G. N. & Perrakis, A. (2014). IUCrJ, 1, 213–220. [DOI] [PMC free article] [PubMed]
  10. Kabsch, W. (2010). Acta Cryst. D66, 125–132. [DOI] [PMC free article] [PubMed]
  11. Krissinel, E. & Henrick, K. (2007). J. Mol. Biol. 372, 774–797. [DOI] [PubMed]
  12. Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M. & Henrissat, B. (2014). Nucleic Acids Res. 42, D490–D495. [DOI] [PMC free article] [PubMed]
  13. Matthews, B. W. (1968). J. Mol. Biol. 33, 491–497. [DOI] [PubMed]
  14. McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L. C. & Read, R. J. (2007). J. Appl. Cryst. 40, 658–674. [DOI] [PMC free article] [PubMed]
  15. Mohanram, S., Amat, D., Choudhary, J., Arora, A. & Nain, L. (2013). Sustain. Chem. Process. 1, 15.
  16. Payne, C. M., Knott, B. C., Mayes, H. B., Hansson, H., Himmel, M. E., Sandgren, M., Ståhlberg, J. & Beckham, G. T. (2015). Chem. Rev. 115, 1308–1448. [DOI] [PubMed]
  17. Robert, X. & Gouet, P. (2014). Nucleic Acids Res. 42, W320–W324. [DOI] [PMC free article] [PubMed]
  18. Wilkins, M. R., Gasteiger, E., Bairoch, A., Sanchez, J. C., Williams, K. L., Appel, R. D. & Hochstrasser, D. F. (1999). Methods Mol. Biol. 112, 531–552. [DOI] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

PDB reference: exo-β-1,3-galactanase, 5flw


Articles from Acta Crystallographica. Section F, Structural Biology Communications are provided here courtesy of International Union of Crystallography

RESOURCES