Abstract
The complexity of eukaryotic translation allows fine-tuned regulation of protein synthesis. Viruses use internal ribosome entry sites (IRESes) to minimize or, like the CrPV IRES, eliminate the need for initiation factors. Here, by exploiting the CrPV IRES, we observed the entire process of initiation and transition to elongation in real-time. We directly tracked the CrPV IRES, 40S and 60S ribosomal subunits, and tRNA using single-molecule fluorescence spectroscopy and identified multiple parallel initiation pathways within the system. Our results distinguished two pathways of 80S:CrPV IRES complex assembly that produce elongation-competent complexes. Following 80S assembly, the requisite eEF2-mediated translocation results in an unstable intermediate that is captured by binding of the elongator tRNA. Whereas initiation can occur in the 0 and +1 frames, the arrival of the first tRNA defines the reading frame, and strongly favors 0-frame initiation. Overall, even in the simplest system, an intricate reaction network regulates translation initiation.
Graphical abstract

Introduction
Translation initiation is a key point in the regulation of gene expression. The purpose of initiation is to form an elongation-competent 80S ribosome, establish an open reading frame, and allow peptide chain elongation. Canonical m7G cap-mediated initiation on cellular mRNAs is a multistep process, whereby numerous initiation factors guide formation of the 80S ribosome:mRNA complex. The reading frame is established by interactions between the start codon on the mRNA and initiator tRNA in the P site (peptidyl-tRNA site) of the ribosome, which leaves the A site (aminoacyl-tRNA site) ready to accept elongator tRNA. Processes during initiation such as mRNA selection, ribosome recruitment, and start codon recognition, are dynamic and involve a number of unstable or metastable intermediates. Whereas the structural and compositional complexity of translation allows for precise and fine-tuned temporal and spatial regulation of protein synthesis, this complexity hinders experimental attempts to elucidate the molecular mechanisms of initiation.
Cellular regulatory mechanisms also pose an obstacle for pathogens such as viruses, which must co-opt the host translation system to facilitate translation of their own proteins. To circumvent the endogenous regulation of translation initiation, many viruses employ Internal Ribosome Entry Sites (IRESes) – structured mRNA segments that require a reduced complement of factors to promote efficient initiation. In addition to enabling the translation of viral proteins, the reduced bio-molecular complexity of IRES-mediated translation creates an attractive system for studying the fundamental mechanisms of translation initiation.
The viral intergenomic region IRES of the Dicistroviridae family is an extreme example of an IRES that drives translation initiation in the absence of all initiation factors, and is consequently, the simplest eukaryotic translation initiation system known. It is universally active in all eukaryotes, able to promote translation in insect (Lancaster et al., 2006), rabbit, human (Pestova et al., 2004) and yeasts (Thompson et al., 2001), indicating that it employs a ubiquitous mechanism involving conserved ribosomal regions to capture eukaryotic host ribosomes. Dicistroviridae IRESes are also active in prokaryotes, but the mechanism of initiation is different, as evidenced by the distinct translation start site and structure of the ribosome:IRES complex (Colussi et al., 2014). The notable members of Dicistroviridae IRESes include Plautia stali intestine virus (PSIV) IRES (Sasaki and Nakashima, 1999), Taura syndrome virus (TSV) IRES (Cevallos and Sarnow, 2005; Hatakeyama et al., 2004) and most well-studied Cricket Paralysis Virus (CrPV) IRES (Hertz and Thompson, 2011; Wilson et al., 2000a). The CrPV IRES is a highly structured mRNA that binds with high affinity to the small (40S) ribosomal subunit (Jan and Sarnow, 2002). The 40S:CrPV IRES complex recruits the large (60S) ribosomal subunit, resulting in 80S ribosome assembly on the IRES (herein referred to the sequential pathway). Initiation factors eIF1, eIF1A and eIF3 inhibit, but do not completely abrogate, 60S subunit joining on the 40S:CrPV IRES complex (Pestova et al., 2004). This led to the hypothesis that the CrPV IRES can directly recruit 80S ribosomes (the simultaneous pathway) to prevent negative regulation of IRES-driven initiation (Pestova et al., 2004).
Translation initiation by the CrPV IRES occurs without the use of an initiator tRNA. Polypeptide synthesis begins with binding of the first elongator tRNA (Thompson et al., 2001; Wilson et al., 2000b), which is recruited to the ribosome as a part of the ternary complex (TC) with eukaryotic elongation factor eEF1A and GTP. Early experiments demonstrated the co-requirement of eEF1A and eukaryotic elongation factor 2 (eEF2) for tRNA incorporation as shown by toeprinting (Jan et al., 2003; Pestova and Hellen, 2003) and by radiolabeled tRNA binding assays with CrPV and PSIV IRES ribosomal complexes (Fernández et al., 2014; Yamamoto et al., 2007). However, these experiments did not delineate the role of eEF2, as translocation might precede tRNA binding, or could follow tRNA binding and stabilize bound tRNA.
The Cryo-EM structures of 80S:CrPV IRES (Fernández et al., 2014) and 80S:TSV IRES complexes (Koh et al., 2014), showed that pseudoknot I (domain III; Figure S1) of the IRES occupies the ribosomal aminoacyl-tRNA acceptor site (A site) where decoding normally occurs, thus blocking A-site tRNA binding. During canonical elongation, eEF2 harnesses energy from GTP hydrolysis to catalyze translocation – movement of the mRNA and P- and A-site tRNAs by one codon, thus freeing the A site for the arrival of the next tRNA. This led to the hypothesis that eEF2 translocates 80S:CRPV IRES complexes, moving the CrPV IRES from the ribosomal A site to the P site to facilitate binding of the first tRNA (Fernández et al., 2014). However, the toeprint analysis of the initiation complexes failed to detect the presence of a translocated 80S:IRES intermediate (Cevallos and Sarnow, 2005; Jan et al., 2003; Muhs et al., 2015; Pestova and Hellen, 2003), suggesting that the translocated state might be unstable and can spontaneously undergo back translocation (Fernández et al., 2014; Muhs et al., 2015). The first tRNA can arrive at initiation complexes formed over Dicistroviridae IRESes in either in 0 or +1 frame (Ren et al., 2014; Wang and Jan, 2014). The molecular mechanisms of how the CrPV IRES single-handedly assembles the 80S ribosome, defines frame, and begins elongation remain unclear.
Here, we employ the CrPV IRES to follow eukaryotic translation initiation in real time, from the free mRNA to the elongating ribosome, using single-molecule fluorescence microscopy. By directly tracking individual ribosomal subunits, the CrPV IRES and tRNA, we distinguish and sort multiple initiation pathways. We find that parallel pathways of CrPV IRES-driven initiation result in the formation of elongation-competent 80S ribosomes, and demonstrate how particular reactions along such pathways define reading frame and govern the overall efficiency of initiation.
Results
First, we recapitulated the early steps of CrPV IRES-driven initiation with dye-labeled components. Previously, we developed a robust purification and fluorescent labeling protocol for 40S ribosomal subunits from S. cerevisiae (Petrov and Puglisi, 2010). Here, a gel shift assay was used to verify that dye-labeled 40S subunits have the same binding affinity for the fluorescently-labeled CrPV IRES as previously determined for wild-type 40S ribosomes and CrPV IRES. 40S ribosomal subunits were labeled by annealing a Cy3-labeled DNA oligonucleotide to a metastable hairpin inserted into h39 of 18S rRNA. The CrPV IRES was labeled by annealing a Cy5-labeled DNA oligonucleotide to the 3′ end of mRNA, placing the dye at the base complimentary to A6232, downstream of the ribosome interacting region, (Material and Methods, Figure S1). 40S:CrPV IRES complexes were formed in bulk and then separated on a composite acrylamide-agarose gel. The formation of 40S:CrPV IRES complexes was detected as a shift in the electrophoretic mobility of fluorescently labeled CrPV IRES (Figure S2). The apparent equilibrium dissociation constant was 26 nM, which is in agreement with previous measurements (KD = 22 nM) (Jack et al., 2011; Jan and Sarnow, 2002). At near saturating concentrations (200 nM) of CrPV IRES, 87% of the 40S subunits formed complexes with the CrPV IRES indicating that a majority of the 40S subunits are active for IRES binding.
To follow small subunit recruitment in real time, we immobilized fluorescently-labeled, 3′-biotinylated CrPV IRES-Cy5 on the surface of a Zero-Mode Waveguide (ZMW) chip and delivered 100 nM 40S-Cy3 ribosomal subunits. 40S:IRES complex formation was detected by the appearance of a green fluorescent pulse. Arrival of the 40S subunit was slow, with an apparent association rate constant of 0.07 (0.06 – 0.08 with a 95% confidence interval) μM−1 s−1 (Figure 1A, C). The 40S:CrPV IRES complex lifetime observation was limited by Cy3 photobleaching (lifetime 32 ± 2 s). To measure 40S:CrPV IRES complex stability, we used single-molecule total internal reflection fluorescence (TIRF) microscopy where illumination power can be decreased thus prolonging fluorophore lifetime before photobleaching. The lower limit of 40S:IRES complex lifetime was found to be 462 ± 6 s, which is equivalent to a 40S-CrPV IRES dissociation rate of 0.002 s−1. Thus, 40S:CrPV IRES complex formation is irreversible on the time scale of initiation, which is 30 seconds or less in the cell (Acker et al., 2009; Palmiter, 1975).
Figure 1. Subunit recruitment and 80S formation.
A. Experimental schematics and example trace of 40S ribosome binding to the CrPV IRES. CrPV IRES-Cy5-biotin (red) was immobilized on the surface of a ZMW slide and 40S-Cy3 (green) subunits were delivered to it. The colors in the schematics match the dye pseudocolors in the example trace. The text below the x-axis denotes complex evolution over time. In the example trace, 40S binding is identified as a burst of green fluorescence at ~ 40 s. n = 142, where n is the number of molecules used to build the distribution. B. 40S:CrPV IRES complexes were immobilized on the surface. In this and all subsequent experiments, the complexes were immobilized via 3′-biotinylated CrPV IRES. 60S-Cy5 (red) subunits were delivered to 40S-Cy3:CrPV IRES-biotin complexes (green) immobilized on the surface of a ZMW chip. 60S joining is identified as a burst of red fluorescence at ~ 60 s in the example trace. n = 302. C. The 40S arrival time distribution (blue dots) was fit to a single exponential model (red line). D. The 60S arrival time distribution (blue dots) was fit to a double exponential model (red line) E. The kobs for 60S arrival at 200 nM and 20 nM (left bar plot), was determined by fitting the data to a double exponential model. Error bars are 95 % confidence interval of the fit. The effect of 60S concentration on 60S joining efficiency is shown in the bar plot on the right. 60S joining efficiency is the ratio of 80S:IRES complexes to 40S:IRES complexes.
The high stability of 40S:CrPV IRES complexes allowed observation of 60S subunit recruitment to 40S:CrPV IRES ribosomes and the resulting 80S:CrPV IRES complexes. We immobilized 40S:CrPV IRES ribosomes and delivered fluorescently labeled 60S ribosomal subunits (Figure 1B, D, E). Arrival-time distributions were best described by a double exponential model, with a major fast phase and minor slow phase. The apparent rate constant of the fast phase for arrival of the 60S subunit was 0.68 (0.6 – 0.77) μM−1 s−1, which is approximately 10-fold faster than the rate of 40S subunit arrival. Similar to 40S:IRES complexes, 80S:IRES complexes were stable with lifetime observation being limited by dye photobleaching (τ = 11.4 ± 1 s). These results indicate that the rate of CrPV IRES-driven initiation in the sequential subunit recruitment pathway is limited by the rate of 40S subunit recruitment.
Can the 80S ribosome be directly recruited to the CrPV IRES? Initiation pathways were directly observed by co-delivering fluorescently labeled 40S and 60S ribosomal subunits to immobilized CrPV IRES mRNA. Spontaneous, transient subunit association in solution leads to a mixture of 40S, 60S and 80S ribosomes (Goss and Harrigan, 1986) allowing all ribosomal species to interact with the IRES. We observed that ribosomes were recruited to the CrPV IRES either sequentially, or simultaneously as an 80S complex (Figure 2A, 2B). The sequential subunit assembly pathway was predominant at all examined conditions (Figure 2C). The proportion of direct 80S recruitment was inversely dependent on magnesium concentration, being 31% at 3 mM, 17% at 6 mM and 6% at 10 mM Mg2+. Thus, the simultaneous arrival pathway is substantially more common at low Mg2+ concentrations. Arrival rates for sequential 40S and 60S subunit joining in co-delivery experiments were found to be 50% slower than the rates of 40S subunit recruitment to the CrPV IRES and 60S subunit recruitment to 40S:CrPV IRES complexes suggesting that ~50% of the ribosomal subunits are forming 80S complexes and unavailable for sequential recruitment to the CrPV IRES (Figure S4). False positive simultaneous arrival events i.e. when subunits arrive sequentially but 60S subunit arrival occurs so fast that subunit arrival appears to be simultaneous due to signal averaging within the movie frame (100 ms exposure) represent less than 0.7% of all arrival events (Supplemental Experimental Procedure). Thus, direct 80S ribosome recruitment to the CrPV IRES occurs.
Figure 2. 80S:CrPV IRES assembly pathways.
40S-Cy3.5 (yellow) and 60S-647 (red) subunits were co-delivered to CrPV IRES-Cy3-biotin (green) immobilized on the surface of a ZMW chip. A. Example trace showing sequential arrival of the 40S subunit (burst of yellow fluorescence at ~90 s) followed by arrival of the 60S subunit (burst of red fluorescence at 105 s) to the CrPV IRES B. In the example trace, the 80S ribosome is directly recruited to the CrPV IRES. Co-arrival of the 40S and 60S ribosomes to the CrPV IRES is indicated by the simultaneous burst of yellow and red fluorescence at ~40 s. Red fluorescence photobleaching occurs at ~300 s, whereas, green and yellow fluorescence persist for the length of the movie. A yellow fluorescence blink occurs at ~160 s. C. The Mg2+ dependence of simultaneous subunit recruitment by the CrPV IRES is shown as the percentage of 80S arrivals that occurred through the co-arrival of the 40S and 60S subunits. n = 68, 283, and 57 correspondingly. D. Model of 40S (yellow) and 60S (blue) ribosome recruitment by the CrPV IRES (red). Arrow width indicates pathway flux.
The 80S complex recruitment times were approximated equally well by both linear and exponential regression analysis. As a result, the rate constant for 80S ribosome binding could not be quantified, however 80S arrival is clearly slower than 40S subunit binding to the CrPV IRES. A faster 40S subunit arrival is consistent with the sequential pathway being predominant (83% vs 17%) and with pathway selection being determined by kinetic partitioning defined by rates of 40S and 80S complex arrival to the CrPV IRES.
We investigated whether 80S:IRES complexes assembled through two pathways are distinct in their ability to initiate protein synthesis. The functionality of 80S complexes formed via each pathway was tested by their ability to bind the first elongator tRNA. To perform this experiment, elongation factors eEF1A, eEF1Bα - a nucleotide exchange protein for eEF1A, eEF2, and eEF3 - a yeast specific factor that guides E site (exit site) tRNA release, were purified and their activities were confirmed biochemically (Supplemental Experimental Procedures, Figure S5). To detect the first tRNA binding, we used CrPV IRES mRNA in which the first four nucleotides of the open reading frame (-GCUA-) were replaced with -UUUG-, which encodes phenylalanine in the 0 frame (Fernández et al., 2014), thus allowing binding of dye-labeled tRNAPhe. Fluorescently-labeled ribosomal subunits, tRNAPhe-Cy3-Phe, and dark elongation factors were co-delivered to surface-immobilized CrPV IRES. This allowed direct observation of 40S and 60S subunit recruitment followed by elongator tRNA binding to score for functional initiation. 80S ribosomes assembled via both pathways had similar tRNA binding ability (Figure 3). Thus, initiation on CrPV IRES can occur via the sequential pathway and by direct 80S ribosome recruitment, with both pathways resulting in elongation-competent ribosomes.
Figure 3. Following initiation and elongation in real time.
40S-Cy3.5 (yellow) and 60S-Cy5 (red) ribosomes, and ternary complex (tRNAPhe-Phe-Cy3 (green), eEF1A, and eEF1Bα) were co-delivered to CrPV IRES-Cy5.5 (magenta) -biotin immobilized on the surface of a ZMW chip. A. Binding of tRNA (burst of green fluorescence at 185 s) following the sequential arrival of the 40S (burst of yellow fluorescence at 45 s) and 60S (burst of red fluorescence at 120 s) ribosomal subunits to the CrPV IRES is shown in the example trace. B. In the example trace, simultaneous arrival of the 40S and 60S subunits (burst of red and yellow fluorescence at 110 s) to the immobilized IRES is rapidly followed by tRNA binding to the 80S-CrPV IRES complex (burst of green fluorescence at 130 s. C. tRNA recruitment efficiencies; n = 673.
Next, we probed the mechanisms of tRNA recruitment and the transition of 80S:CrPV IRES complexes into elongation. As discussed above, multiple lines of evidence suggest that 80S:CrPV IRES complexes must be translocated by eEF2 to expose the first codon in the A site with perhaps an ambiguous reading frame. To reveal these mechanisms, we defined the role of elongation factors for initiation in both the 0 and +1 frames. To that end, two CrPV IRES mRNA constructs were used: the 0-frame mRNA described above and a +1 frame mRNA where the first four nucleotides of the open reading frame were replaced with -GUUU-, encoding phenylalanine in the +1 frame and valine in the 0 frame. We examined each mRNA individually and used fluorescent tRNAPhe-Cy3-Phe binding to score initiation in the 0 and +1 frame. 40S:60S-647:CrPV IRES-biotin 0 frame or +1 frame complexes were immobilized, non-immobilized complexes were washed off, and Phe-tRNAPhe and elongation factors were co-delivered. In contrast to bulk experiments, where the reaction commonly contains a mixture of empty 80S ribosomes and 80S:CrPV complexes due to the less than 100% efficiency of 80S:CrPV complex formation, immobilization via the biotin moiety on the CrPV IRES excludes empty 80S ribosomes from observation, as empty 80S ribosomes do not immobilize on the surface.
In the absence of elongation factors, no tRNA binding events were observed. Delivery of a pre-formed ternary complex (TC) of eEF1A:tRNA:GTP in the presence of eEF1Bα led to a slight increase in tRNA binding efficiency (10%, with efficiency being defined as the percentage of 80S:CrPV IRES ribosomes that bound tRNA within the observation time frame - 10 min) (Figure 4B). Delivery of eEF2 together with TC resulted in a robust tRNA binding efficiency of 53%. tRNA arrival times were best approximated by a double exponential model with a major fast phase with an apparent arrival rate of 0.90 (0.87 – 0.93) μM-1s-1, and at least an order-of-magnitude slower minor phase. tRNA binding was stable, with tRNA-bound state lifetimes defined by a single exponential, with a 112 ± 2 s lifetime limited by photobleaching. tRNA arrival to the +1 frame followed the same pattern with two distinctions. First, tRNA arrival to the +1 frame was less efficient than arrival to the 0 frame (24% versus 53%). Second, tRNA arrival was best fit by a single-exponential model and had an apparent arrival rate of 0.050 (0.049 – 0.051) μM-1 s-1, which is an order of magnitude slower than tRNA arrival to the 0 frame (Figure S6). Thus, in agreement with the previous results, both eEF1A and eEF2 are required for stable tRNA binding in both reading frames (Figure 4B). Addition of the antibiotic cycloheximide (Schneider-Poetsch et al., 2010) had no effect on tRNA arrival efficiency supporting a lack of E site effects on CrPV IRES-driven initiation (Figure S7).
Figure 4. eEF2 is required for efficient elongator tRNA binding by 80S-CrPV IRES complexes.
A. Testing eEF2 requirement; the experiment schematics. 40S:60S-Cy5:CrPV IRES-biotin complexes were preassembled in bulk. Complexes were surface immobilized and washed with reaction buffer. tRNAPhe-Phe-Cy3 ternary complex was delivered with or without eEF2. Binding efficiency was measured as the percentage of 80S:CrPV IRES complexes that bound tRNA. B. tRNA binding efficiency of 80S:CrPV complexes. n = 200, 860, 233, 746 and 617. C. Testing the role of eEF2 in stabilization of translocated state. 80S:CrPV IRES complexes were assembled in the presence or absence of eEF2 and then surface immobilized. The unbound complexes were washed off. tRNAPhe-Phe-Cy3 ternary complex was delivered with or without eEF2. D. tRNA binding efficiencies in 0 and +1 frames, n = 179, 573, 388, 567 and 1200. The legend below the x-axes denotes eEF2 presence during the reaction. eEF1A and GTP were ubiquitously present unless otherwise noted above the corresponding column.
To delineate how eEF2 promotes tRNA binding to 80S:CrPV IRES complexes, we modified the experimental setup above to separate translocation and tRNA binding (Figure 4C). Pre-formed 80S:CrPV IRES complexes were pre-incubated with eEF2 and GTP to allow translocation to occur. eEF2 and GTP were removed upon surface immobilization, and then tRNA, as a TC (eEF1A:tRNAPhe-Cy3-Phe:GTP in presence of eEF1Bα), was delivered either with or without eEF2. When 80S:CrPV complexes were pre-incubated with eEF2 and eEF2 was present in the delivery mix, robust tRNA binding was observed, with 58% of 80S:CrPV ribosomes binding tRNA. However, when 80S:CrPV IRES complexes were pre-incubated with eEF2 and ternary complex was subsequently delivered to the ribosomes without eEF2, the tRNA binding efficiency dropped 3 fold to 19% (Figure 4D). Thus, a continuous presence of eEF2 is required for efficient CrPV IRES initiation.
When eEF2 is continuously present, the reaction occurs as follows: upon 80S:IRES complex formation, eEF2 catalyzes a first round of translocation. This allows binding of the first tRNA, which is followed by a second round of translocation. There are two scenarios explaining the need for the continuous presence of eEF2 for efficient tRNA binding. First, the translocated state of the 80S ribosome could be unstable and the ribosome spontaneously reverse translocates. In this case, eEF2 is needed to shift the equilibrium toward the translocated state, thus increasing the fraction of ribosomes that are able to bind tRNA. Alternatively, tRNA could bind to the ribosome transiently, and an eEF2-catalyzed second round of translocation upon tRNA binding might be needed to stabilize the ribosome-bound tRNA. To distinguish between these possibilities, we pre-incubated 80S:CrPV IRES complexes with eEF2 and GTP, removed eEF2 and GTP, and then delivered TC formed with the non-hydrolysable GTP analog GDPNP, which stabilizes the eEF1A:tRNA complex on the ribosome. If the first hypothesis is correct, the tRNA binding efficiency should be unaffected by GDPNP, and would be expected to be comparable to tRNA binding efficiency in the absence of eEF2 (19%). If the second hypothesis is correct, tRNA binding efficiency should increase to the levels observed with eEF2 present (58%), as tRNA would be stably bound due to GDPNP. With eEF1A:GDPNP, tRNA binding efficiency was 20%. This suggests that eEF2 facilitates tRNA binding, rather than stabilization of tRNA on the ribosome (Figure 4D). Thus, the propensity of the 80S ribosome:CrPV IRES complex to bind the first elongator tRNA stably is likely independent of a second round of translocation and is defined by the presence of an unstable translocated 80S:CrPV IRES intermediate. These results support the unstable translocated 80S:CrPV complex hypothesis (Muhs et al., 2015) and are consistent with the inability to detect translocated 80S:IRES ribosomes by toeprinting (Cevallos and Sarnow, 2005; Jan et al., 2003; Muhs et al., 2015; Pestova and Hellen, 2003).
The resulting 80S:CrPV IRES:tRNA complexes are dynamic. The first bound tRNA was characterized by the presence of two fluorescence intensity states, beginning in a high-intensity state and then oscillating between high- and low-intensity states (Figures 5, 6, and S7). Intensity fluctuations are independent of Cy dye and tRNA identity. Such fluctuations are characteristic of changes in dye environment, potentially reporting on conformational rearrangements of the 80S:CrPV IRES:tRNA complexes. Analysis of fluorescence intensity of 0-frame complexes with tRNAPhe-Cy3-Phe revealed that 98% of the traces begin in a high intensity state. Using a single exponential model, we calculated the dwell times for the high- and low-intensity states (Figure 5). The first high intensity state was significantly longer (7.3 ± 0.6 s) than subsequent high intensity states (1.60 ± 0.05 s), indicating that the first state is special and that a reaction we can not directly observe must occur before the 80S:CrPV IRES:tRNA complex starts oscillating. In contrast, the low intensity state dwell times were all similar regardless of the state position along the trace and equal to 3.25 ± 0.05 s.
Figure 5. tRNA fluctuations.
A. 98% of all tRNA traces began in a high intensity state. Measured state lifetimes were used to calculate the percentage of traces in which the first state is expected to be shorter than exposure time (0.1 s), thus being unobservable. This equals 1.4% of the traces. B. tRNA state dwell time dependence on state position. The tRNA trace schematic is shown in green. Bars depict dwell times. Error bars are 95 % confidence interval of the fit. C. Low intensity state dwell times (n = 1155) fit a single exponential model indicating a single step process. D. High intensity dwell times (n = 1136) are best described by a double exponential model, shown in blue. This indicates either multiple subpopulations in the high intensity state and/or a multistep process for high to low state transition. The single exponential model is shown in red for comparison. The first long state was excluded from the fit. A single exponential model was used to calculate the individual state lifetimes shown in panel B due to the poor robustness of the double exponential fit for the individual states.
Figure 6. Following frame selection in real time.
60S-Cy3 (green) ribosomes, elongation factors, and either 0-frame tRNA (tRNAVal-Cy5 (red)) or +1-frame tRNA (tRNAPhe-Cy3.5 (yellow)) were delivered to 40S-Cy5.5:CrPV IRES-biotin complexes (magenta) immobilized on the surface of a ZMW slide. A. Example trace of 0-frame tRNAVal-Cy5 (red) delivery. B. Arrival efficiency of 0-frame tRNA at various eEF2 concentrations. n = 772, 778, 874, and 776. C. Arrival rate of 0-frame tRNA at various eEF2 concentrations. n = 229, 287, and 198. D. Example trace of +1-frame tRNAPhe-Cy3.5 (yellow) delivery. E. Arrival efficiency of +1-frame tRNA at various eEF2 concentrations. n = 738, 673, 595, and 648. F. Arrival rate of +1-frame tRNA at various eEF2 concentrations. n = 105, 123, and 103. G. Zero-frame (tRNAVal-Cy5 (red)) and +1 frame tRNA (tRNAPhe-Cy3.5 (yellow)) were co-delivered along with 60S-Cy3 (green) subunits, and elongation factors to 40S-Cy5.5:CrPV IRES-biotin complexes (magenta) immobilized on the surface of a ZMW slide to follow frame selection in real time. The pathway selection, as it was observed, is represented by the flow chart; n = 312. Error bars are 95 % confidence interval of the fit.
Due to the dynamic nature of the 80S:CrPV IRES complexes prior to and post tRNA selection, both 80S formation and tRNA binding must be observed together in real time to determine the rules of frame selection. To that end, we started with 40S:IRES complexes and followed 60S subunit joining and tRNAPhe binding to both 0 and +1 frame. To establish the assay, factor requirements for tRNA binding, and tRNA binding rate were re-examined and found to be similar to results obtained for preformed 80S:CrPV IRES complexes (Figure S7). To follow frame selection, the -GUUU- CrPV mRNA construct described above, which encodes valine in the 0-frame and phenylalanine in the +1 frame was used. First, initiation in each frame was probed individually. 40S-Cy5.5:CrPV IRES complexes were immobilized on the surface of a ZMW chip and fluorescently labeled 60S-547 subunits were co-delivered with either tRNAVal-Cy5-Val or tRNAPhe-Cy3.5-Phe (Figure 6). Fluorescently-labeled tRNAVal-Cy5-Val and tRNAPhe-Cy3.5-Phe arrival rates to the 0- and +1-frames, respectively, differed by an order of magnitude, similar to what was observed for 0 frame and +1 frame tRNA arrival to the 80S:CrPV IRES ribosomes (Figure 6). The tRNA arrival efficiency and tRNA arrival rates were dependent on eEF2 concentration, with apparent reaction rates saturating at 200 nM eEF2 for 0 frame tRNA binding. For the +1 frame, the eEF2-saturating concentration was 20 nM, consistent with a fast translocation preceding slower tRNA selection. In both the 0 frame and +1 frame, translocation is not the rate-limiting step for tRNA binding.
Frame selection was followed directly by co-delivering labeled 60S and both 0 and +1 frame tRNAs to 40S:CrPV IRES complexes (Figure 6). Of the resulting 80S:CrPV IRES complexes that bound tRNA, 95% had only one tRNA binding event, or multiple events of the same color, indicating that the reading frame, once tRNA is bound, is irreversibly established. 93% of ribosomes bound 0-frame tRNA and 7% of the ribosomes bound the +1 frame tRNA (i.e 0-frame to +1-frame tRNA ratio of 13.4:1). The ratio of frame selection is the same as the ratio of the apparent tRNA association rates for the 0 to +1 frames (13.2:1). These results support a simple model of frame selection, whereby the apparent tRNA arrival rate dictates initiation efficiency in the particular frame. In the absence of competing tRNA, initiation efficiency in the +1 frame was 4 times greater at 25% (Figure S7), indicating that ribosomes oscillate between the 0 and +1 frames prior to tRNA arrival and that tRNA binding locks the frame.
Discussion
Translation initiation in the deceptively simple CrPV IRES system is a highly dynamic process. By following the full process of translation initiation directly, we determined the pathways and mechanisms of CrPV IRES initiation, and unified them in the context of previous structural and biochemical research. The assembly of 80S:CrPV IRES complexes can occur via two drastically different pathways, either by recruitment of the small subunit followed by large subunit joining, or via direct 80S ribosome recruitment. Both pathways result in elongation-competent ribosomes. The overall initiation rates are dictated by rate-limiting 40S and 80S ribosome recruitment to the CrPV IRES. In contrast to cap-dependent initiation, which occurs via a number of reversible steps, the ribosome-IRES interactions are irreversible on time scale of translation initiation (~30 s), which shifts the reaction outcome toward 80S:CrPV IRES complex formation. This explains how the CrPV IRES captures a host translation system and can promote initiation in the presence of competing mRNAs.
While the ribosomal subunits, IRES, and tRNA in the initiation complex do not show rapid ligand exchange, initiation complexes adopt a range of functionally distinct conformational states. 80S:CrPV IRES complexes require a translocation step to enable tRNA binding. The first round of translocation is catalyzed by eEF2. The translocated state is unstable and back-translocates. It is unclear how similar the pre-translocated and back-translocated states are, but both require eEF2 for robust tRNA binding. However, eEF2 is not strictly required, as some ribosomes (up to 10%, Figure 4) bound tRNA in the absence of eEF2, indicating that translocation might occur spontaneously. This is further supported by previously observed low, but statistically significant, levels of tRNA binding in the absence of eEF2 in bulk experiments with PSIV IRES (Yamamoto et al., 2007). Spontaneous translocation is likely slow, since in co-delivery experiments where 60S subunit recruitment, translocation, and tRNA binding must occur within the observation time frame (< 10 min), efficiency of tRNA binding in the absence of eEF2 is greatly diminished (Figure 6). Thus, 80S:CrPV IRES complexes exchange between two states that differ in their ability to bind tRNA. eEF2 and tRNA work in concert to push ribosomes toward elongation. eEF2 increases the relative abundance of the unstable translocated intermediate and tRNA binding is an essentially irreversible step that finalizes initiation.
Frame is not maintained in 80S:CrPV IRES complexes. Pseudoknot I in domain III of the CrPV IRES only partially mimics the tRNA, with the IRES mimicking the anticodon helix and anticodon stem of tRNA (Costantino et al., 2008; Fernández et al., 2014; Muhs et al., 2015). During the canonical translation elongation cycle, both the acceptor stem of A-site tRNA and peptidyl moiety are needed to maintain frame during translocation (Fredrick and Noller, 2002; Joseph and Noller, 1998). It is possible that incomplete molecular mimicry by the IRES results in sloppy translocation and that the shift between the 0 and +1 frames is linked to the cycles of forward and backward translocation. Notably, Cryo-EM structures of 80S ribosomes with the CrPV and TSV IRESes showed ribosomes in both classical (non-rotated) and rotated states (Fernández et al., 2014; Koh et al., 2014).
The classical 80S:IRES complexes are reminiscent of non-rotated ribosomes with peptidyl-tRNA in the A-site - unconventional translational intermediates that occur during translational recoding events (Chen et al., 2014a) that lead to frameshifting. It is plausible that translocation of the non-rotated 80S:IRES complexes, together with partial molecular mimicry result in frame ambiguity. As a consequence of the unlocked frame, ribosomes oscillate between the 0 and +1 frame. tRNA binding is the commitment step that locks the ribosome in frame. The CrPV IRES leverages an elegant mechanism where open reading frame selection is defined by the kinetics of the first tRNA binding event. Fast 0-frame tRNA binding favors initiation in 0-frame and biases against +1 frame selection. This mechanism of frame selection echoes +1 frameshifting in eukaryotes, where frameshifting efficiency is defined by the relative concentrations of 0 and +1 frame tRNAs, suggesting that both processes possibly share similar mechanisms.
When tRNA binding locks the frame, it unlocks a new set of molecular motions, as reported by tRNA dye intensity fluctuations. Intensity oscillations were seen in tRNA co-delivery experiments, regardless of the presence of eEF2 in delivery mix. In principle, having eEF2 present in the delivery mix would allow 80S:tRNA complexes to undergo a second translocation that will move A-site bound tRNA into the P-site. In the absence of eEF2, tRNA is expected to remain in the A site, with the P site being occupied by the CrPV IRES. Either tRNA dynamics are the same for A and P site bound complexes, or a second round of translocation occurs spontaneously. tRNA has a higher affinity for the P site than the A site, and the CrPV IRES does not fully mimic P-site tRNA-ribosome interactions (Costantino et al., 2008; Fernández et al., 2014; Muhs et al., 2015). Possibly, this allows spontaneous movement of the first tRNA from the A site to the P site and expulsion of the IRES. The first, long, high-intensity tRNA state might be indicative of the time that is required for translocation to occur. What is the nature of the tRNA intensity fluctuations? The observed changes might occur due to movement of the tRNA, ribosome, IRES or both. During regular translation, upon A-site tRNA binding, the ribosome rapidly catalyzes peptidyl transfer (kpep > 1s-1) (Johansson et al., 2008; Wohlgemuth et al., 2008), resulting in peptidyl tRNA in the A-site tRNA and deacylated tRNA in the P-site. Upon peptide bond formation tRNAs spontaneously shift between hybrid and classical states. These tRNA movements are fast in both prokaryotes and eukaryotes occurring on sub-second time scale (Blanchard et al., 2004; Budkevich et al., 2011; Munro et al., 2007). Upon translocation the ribosomal complexes remain dynamic, as demonstrated by FRET between tRNA and a ribosomal protein, as well as inner-ribosome FRET (Cornish et al., 2009; Fei et al., 2008, 2009). The conformational exchange is much slower at this step, taking seconds to occur. The fluctuations observed with CrPV IRES are special as they are occur on an intermediate time scale between pre and post- translocation movements.
By following individual molecular events, we unearthed striking complexity in the simplest initiation system. The presence of multiple parallel pathways increases the chances for a virus to capture host cellular translation machinery and allows viral translation to occur under a broad range of conditions. Translation initiation is commonly viewed as a linear process that proceeds through predefined steps with stable intermediates that yield an elongation-ready ribosome. In contrast, initiation on on the CrPV IRES is a dynamic process where many stages are kinetically controlled. The 80S assembly pathway is determined by subunit concentrations. eEF2 accelerates formation of an unstable translocated 80S:CrPV IRES intermediate that is captured by tRNA. Frame selection is determined by tRNA binding rates. This implies the need for real-time studies of translation initiation and careful characterization of reaction networks that are dependent on conditions.
This work on the CrPV IRES and the growing body of biochemical, and structural studies of various translation systems (O’Leary et al., 2013; Terenin et al., 2008; Tsai et al., 2012 and others) emphasize that initiation is a dynamic process that occurs via a number of alternative pathways. The kinetic control and presence of multiple initiation pathways could be a general feature of eukaryotic initiation that stems from the size and intrinsic flexibility of the ribosome, as well as the myriad of factors involved in the process. Thus, it is likely that cap-dependent initiation also occurs via a large number of parallel, reversible pathways. Regulation occurs then, by fine-tuning the reaction network, allowing for selective translation under broad range of conditions and responses.
Experimental Procedures
Ribosomes were purified and 40S ribosomal subunits were labeled at h39 with fluorescent DNA oligonucleotide (GGGAGATCAGGATAC-dye) as previously described (Petrov and Puglisi, 2010).
Labeling of 60S ribosomal subunits
60S ribosomal subunits were labeled with SNAP-tag (derivative of human O6-alkylguananie-DNA alkyltransferase, NEB) at ribosomal protein L5 (uL5 (Ban et al., 2014), YPL131W). SNAP-tag reacts with O6-benzylguanyl derivatives resulting in transfer of the modified benzyl group to the cysteine at position 145. RPL5 in an essential protein that was previously internally tagged with peptide HA-tag (Deshmukh et al., 1993). In these strains, endogenous RPL5 is deleted and RPL5 is expressed from the URA plasmid. Building on these results we placed SNAP between amino acids 8 and 9 of RPL5 using pRS315-RPL5 (plasmid described in (Deshmukh et al., 1993)) construct. The resulting plasmid was transformed into JWY3733 strain (MATα ura3-52 trp1Δ101 leu2Δ1 ade1 his3Δ200 rpl1::TRP1 + pRS316-RPL5) and screened for the loss of the pRS316-RPL5 by passaging cells of 5-FOA containing media. The resulting strain, MATα ura3-52 trp1Δ101 leu2Δ1 ade1 his3Δ200 rpl1::TRP1 + pRS315-RPL5-SNAP, expresses RPL5-SNAP as the only source of the protein. Reaction with fluorescent SNAP dye was specific, reaching saturation at 15 min, with > 90% labeled ribosomes. Fluorescently-labeled RPL5-SNAP sediments with 60S ribosomal subunits and 80S ribosomes on sucrose gradient indicating that RPL5-SNAP is incorporated large subunit.
CrPV IRES transcription and labeling
The intergenomic CrPV IRES was transcribed with T7 polymerase using runoff transcription. A plasmid containing T7-CrPV IRES-firefly luciferase (CrPV genomic coordinates 6025 – 6232 (Wilson et al., 2000a), where CrPV IRES genomic coordinates are 6030 – 6219) was linearized with Nar I. RNA was transcribed and purified by gel filtration on a Superdex200 26/60 column as described before (McKenna et al., 2007). The resulting mRNA has following sequence: GGGAGACCGGAAUUCAAAGCAAAAAUGUGAUCUUGCUUGUAAAUACAAUUUUGAGAGGUUAAUAAAUUACAAGUAGUGCUAUUUUUGUAUUUAGGUUAGCUAUUUAGCUUUACGUUCCAGGAUGCCUAGUGGCAGCCCCACAAUAUCCAGGAAGCCCUCUCUGCGGUUUUUCAGAUUAGGUAGUCGAAAAACCUAAGAAAUUUACCUGCUACAUUUCAAGAUACCAUGGAAGACGCCAAAAACAUAAAGAAAGGCCCGGCG
The CrPV portion is highlighted in bold. It is followed by 38 nucleotides of firefly luciferease (italics). This results in 53 nt long spacer between the CrPV IRES and 3′ end of the mRNA. The mRNA was labeled with biotin and a fluorescent dye by annealing corresponding modified DNA oligonucleotides (TTTTTGGCGTCTTCCATGGT-dye (Cy3, Cy5 or Cy5.5) and biotin-CTCTCTCGCCGGGCCTTTCTTTATG) to the 3′ portion of the mRNA, resulting in CrPV IRES mRNA dual labeled with a cyanine dye and biotin. This labeling scheme places biotin close to 3′ end of the mRNA and the dye close to A6232 – outside of the portion of mRNA that interacts with ribosome (Jan and Sarnow, 2002).
Purification and validation of eukaryotic translation elongation factors
eEF1A, eEF1Ba, eEF2 and eEF3 were purified as previously described (Andersen et al., 2004; Jorgensen et al., 2002; Pittman et al., 2009). Factor activity was validated using modified GTP binding (Janssen and Möller, 1988) and GTPase and ATPase assays (Baykov et al., 1988). For detailed description see Supplemental Experimental Procedures.
Single-molecule imaging
Total Internal refection fluorescence (TIRF) microscopy was done using a home-built instrument. ZMW imaging was done with a modified RS sequencing platform from Pacific Biosciences (Chen et al., 2014b). Surfaces (PEG-treated quartz slides or ZMW chips) were washed twice with 50 mM Tris-HCl, pH 7.5, 100 mM KCl, and treated with 1 μM neutravidin, 0.67 mg/ml BSA and 1.3 μM DNA oligonucleotide duplex oligonucleotide for 5 min. Surfaces were washed 5 times with 50 mM Tris-HCl, pH 7.5, 100 mM KCl, and then twice with 30 mM Hepes-KOH, pH 7.4, 100 mM KCl, 6 mM MgCl2. In TIRF experiments, wash volume was 200 μl and 40 μl in ZMW experiments. All complexes were immobilized via 3′ end biotinylated CrPV IRES. Biomolecules were flown over the surface and immobilized for 5 min. Concentration in the immobilization mix varied depending on the type of complex and immobilization surface. The CrPV IRES was immobilized at 100 pM on the TIRF slides and at 2 nM on the ZMW chips. Ribosome CrPV IRES complexes required higher immobilization concentrations to account for slower diffusion, and thus were immobilized at 1 nM and 20 nM on TIRF slides and in ZMW chips, respectively. Unbound material was removed by washing with 30 mM Hepes-KOH, pH 7.4, 100 mM KCl, 6mM MgCl2. Prior to TIRF imaging, the buffer was exchanged to 30 mM Hepes-KOH, pH 7.4, 100 mM KCl, 6 mM MgCl2, 2.5 mM TSQ, 2.5 mM protocatechuic acid and 0.06 U/μl protocatechuate dehydrogenase. An area of ~ 1000 μm2 was illuminated with 50 mW 532 nM laser beam and imaged for 5 min with 200 ms exposure. In ZMW imaging, buffer was exchanged to 30 mM Hepes-KOH, pH 7.4, 100 mM KCl, 6 mM MgCl2, 2.5 mM TSQ, 2.5 mM protocatechuic acid and 0.06 U/μl protocatechuate dehydrogenase, 2 μM casein. Then the chip was wetted with 20 μl of the reaction buffer. Imaging was done at 0.32 μW/μm2 532 nM and 0.14 μW/μm2 650 nM illumination, with a 100 ms exposure for 10 min. A 20-μl sample was delivered to the chip surface after the start of observation. The time between the observation start and the delivery was recorded and then subtracted during arrival time data analysis.
Gel shift activity assay
40S ribosomal subunits were labeled at h39 by annealing fluorescently labeled oligonucleotide. The 0.5 μM 40S subunits were incubated with 1 μM GGGAGATCAGGATACCy3 oligonucleotide in 30 mM HEPES-KOH, pH 7.4, 100 mM KCl, 5 mM MgCl2 for 2 min at 42°C, 15 min at 37°C and 15 min at 30°C. Labeled ribosomes were mixed with fluorescently labeled CrPV IRES. The CrPV IRES was labeled by incubating 4 μM CrPV IRES with a 4-fold molar excess of the TTTTTGGCGTCTTCCATGGT-Cy5 oligonucleotide for 1 min at 90°C and then slowly cooling the reaction to the room temperature. The final 10 μl reaction mix contained 50 nM ribosomes and 25–100 nM CrPV IRES in 30 mM HEPES-KOH, pH 7.4, 100 mM KCl, 5 mM MgCl2, buffer. Reactions were incubated at 30°C for 15 min and then separated on the composite agarose-acrylamide gel (Petrov and Puglisi, 2010). The Gel was scanned for fluorescence on a Typhoon scanner and quantified with ImageJ. The KD was estimated by using a ligand depletion model. The experimental results were fitted with the following equation:
Where RS:IRES is the observed amount of 40S:IRES complex, and A is a fitted quantification conversion factor. The ratio of bound 40S:IRES complex at 200 nM IRES was calculated as the ratio of bound IRES to the horizontal asymptote A × RS0, which gave 87% binding efficiency. Alternatively, the amount of bound 40S:IRES complex was calculated from the ratio of free to bound IRES, which gave 91% binding efficiency.
Supplementary Material
Figure 7. Multiple pathways of translation initiation by the CrPV IRES.
80S assembly on the CrPV IRES occurs via sequential recruitment of the 40S and 60S ribosomal subunits, and by direct recruitment of the 80S ribosome. Regardless of the assembly pathway, translocation is required for tRNA acceptance by 80S:IRES complexes. The translocation step can occur spontaneously in an eEF2-independent manner. The translocated complexes are unstable and undergo back-translocation, and lack a defined reading frame. The frame ambiguity during the first translocation results in 80S:CrPV IRES complexes that can accept 0 or +1 frame tRNA. The incoming tRNA captures and stabilizes the translocated state of the ribosome. The reading frame is transiently set by the step preceding tRNA binding and frame selection efficiency is depends on the relative rates of 0 and +1 frame tRNA arrival to the A site.
Highlights.
The CrPV IRES can recruit the 40S and 60S subunits sequentially or simultaneously.
Both ribosomal recruitment pathways form elongation-competent 80S:IRES complexes.
eEF2-mediated translocation results in an unstable intermediate captured by tRNA.
80S:CrPV IRES reading frame is selected by 0 and +1 frame tRNA arrival kinetics.
Acknowledgments
We thank Terry Kinzy for the eEF2 and eEF3 expression yeast strains. This work is supported by NIH grants GM09968701 and AI099245 to JDP.
Footnotes
Author Contributions
A.P. and R.G. performed all the experiments and the data analysis. A.P., R.G., J.C., S.E.O’L., and J.D.P. designed the project and wrote the manuscript. All authors discussed the results and commented on the manuscript.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- Acker MG, Shin B-S, Nanda JS, Saini AK, Dever TE, Lorsch JR. Kinetic analysis of late steps of eukaryotic translation initiation. J Mol Biol. 2009;385:491–506. doi: 10.1016/j.jmb.2008.10.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Andersen CF, Anand M, Boesen T, Van LB, Kinzy TG, Andersen GR. Purification and crystallization of the yeast translation elongation factor eEF3. Acta Crystallogr Sect D Biol Crystallogr. 2004;60:1304–1307. doi: 10.1107/S0907444904010716. [DOI] [PubMed] [Google Scholar]
- Ban N, Beckmann R, Cate JH, Dinman JD, Dragon F, Ellis SR, Lafontaine DL, Lindahl L, Liljas A, Lipton JM, et al. A new system for naming ribosomal proteins. Curr Opin Struct Biol. 2014;24:165–169. doi: 10.1016/j.sbi.2014.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baykov aa, Evtushenko Oa, Avaeva SM. A malachite green procedure for orthophosphate determination and its use in alkaline phosphatase-based enzyme immunoassay. Anal Biochem. 1988;171:266–270. doi: 10.1016/0003-2697(88)90484-8. [DOI] [PubMed] [Google Scholar]
- Blanchard SC, Kim HD, Gonzalez RL, Puglisi JD, Chu S. tRNA dynamics on the ribosome during translation. Proc Natl Acad Sci U S A. 2004;101:12893–12898. doi: 10.1073/pnas.0403884101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Budkevich T, Giesebrecht J, Altman RB, Munro JB, Mielke T, Nierhaus KH, Blanchard SC, Spahn CMT. Structure and dynamics of the mammalian ribosomal pretranslocation complex. Mol Cell. 2011;44:214–224. doi: 10.1016/j.molcel.2011.07.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cevallos RC, Sarnow P. Factor-independent assembly of elongation-competent ribosomes by an internal ribosome entry site located in an RNA virus that infects penaeid shrimp. J Virol. 2005;79:677–683. doi: 10.1128/JVI.79.2.677-683.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen J, Petrov A, Johansson M, Tsai A, O’Leary SE, Puglisi JD. Dynamic pathways of -1 translational frameshifting. Nature. 2014a;7 doi: 10.1038/nature13428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen J, Dalal RV, Petrov AN, Tsai A, O’Leary SE, Chapin K, Cheng J, Ewan M, Hsiung P-L, Lundquist P, et al. High-throughput platform for real-time monitoring of biological processes by multicolor single-molecule fluorescence. Proc Natl Acad Sci U S A. 2014b;111:664–669. doi: 10.1073/pnas.1315735111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Colussi TM, Costantino Da, Hammond Ja, Ruehle GM, Nix JC, Kieft JS. The structural basis of transfer RNA mimicry and conformational plasticity by a viral RNA. Nature. 2014;511:366–369. doi: 10.1038/nature13378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cornish PV, Ermolenko DN, Staple DW, Hoang L, Hickerson RP, Noller HF, Ha T. Following movement of the L1 stalk between three functional states in single ribosomes. Proc Natl Acad Sci U S A. 2009;106:2571–2576. doi: 10.1073/pnas.0813180106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Costantino DA, Pfingsten JS, Rambo RP, Kieft JS. tRNA-mRNA mimicry drives translation initiation from a viral IRES. Nat Struct Mol Biol. 2008;15:57–64. doi: 10.1038/nsmb1351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Deshmukh M, Tsay YF, Paulovich AG, Woolford JL. Yeast ribosomal protein L1 is required for the stability of newly synthesized 5S rRNA and the assembly of 60S ribosomal subunits. Mol Cell Biol. 1993;13:2835–2845. doi: 10.1128/mcb.13.5.2835-2845.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fei J, Kosuri P, MacDougall DD, Gonzalez RL. Coupling of Ribosomal L1 Stalk and tRNA Dynamics during Translation Elongation. Mol Cell. 2008;30:348–359. doi: 10.1016/j.molcel.2008.03.012. [DOI] [PubMed] [Google Scholar]
- Fei J, Bronson JE, Hofman JM, Srinivas RL, Wiggins CH, Gonzalez RL. Allosteric collaboration between elongation factor G and the ribosomal L1 stalk directs tRNA movements during translation. Proc Natl Acad Sci. 2009;106:15702–15707. doi: 10.1073/pnas.0908077106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fernández IS, Bai XC, Murshudov G, Scheres SHW, Ramakrishnan V. Initiation of Translation by Cricket Paralysis Virus IRES Requires Its Translocation in the Ribosome. Cell. 2014;157:823–831. doi: 10.1016/j.cell.2014.04.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fredrick K, Noller HF. Accurate translocation of mRNA by the ribosome requires a peptidyl group or its analog on the tRNA moving into the 30S P site. Mol Cell. 2002;9:1125–1131. doi: 10.1016/s1097-2765(02)00523-3. [DOI] [PubMed] [Google Scholar]
- Goss DJ, Harrigan T. Magnesium ion dependent equilibria, kinetics, and thermodynamic parameters of Artemia ribosome dissociation and subunit association. Biochemistry. 1986;25:3690–3695. doi: 10.1021/bi00360a032. [DOI] [PubMed] [Google Scholar]
- Hatakeyama Y, Shibuya N, Nishiyama T, Nakashima N. Structural variant of the intergenic internal ribosome entry site elements in dicistroviruses and computational search for their counterparts. RNA. 2004;10:779–786. doi: 10.1261/rna.5208104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hertz MI, Thompson SR. Mechanism of translation initiation by Dicistroviridae IGR IRESs. Virology. 2011;411:355–361. doi: 10.1016/j.virol.2011.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jack K, Bellodi C, Landry DM, Niederer RO, Meskauskas A, Musalgaonkar S, Kopmar N, Krasnykh O, Dean AM, Thompson SR, et al. RRNA Pseudouridylation Defects Affect Ribosomal Ligand Binding and Translational Fidelity from Yeast to Human Cells. Mol Cell. 2011;44:660–666. doi: 10.1016/j.molcel.2011.09.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jan E, Sarnow P. Factorless ribosome assembly on the internal ribosome entry site of cricket paralysis virus. J Mol Biol. 2002;324:889–902. doi: 10.1016/s0022-2836(02)01099-9. [DOI] [PubMed] [Google Scholar]
- Jan E, Kinzy TG, Sarnow P. Divergent tRNA-like element supports initiation, elongation, and termination of protein biosynthesis. Proc Natl Acad Sci U S A. 2003;100:15410–15415. doi: 10.1073/pnas.2535183100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Janssen GM, Möller W. Elongation factor 1 beta gamma from Artemia. Purification and properties of its subunits. Eur J Biochem. 1988;171:119–129. doi: 10.1111/j.1432-1033.1988.tb13766.x. [DOI] [PubMed] [Google Scholar]
- Johansson M, Bouakaz E, Lovmar M, Ehrenberg M. The Kinetics of Ribosomal Peptidyl Transfer Revisited. Mol Cell. 2008;30:589–598. doi: 10.1016/j.molcel.2008.04.010. [DOI] [PubMed] [Google Scholar]
- Jorgensen R, Carr-Schmid A, Ortiz Pa, Kinzy TG, Andersen GR. Purification and crystallization of the yeast elongation factor eEF2. Acta Crystallogr Sect D Biol Crystallogr. 2002;58:712–715. doi: 10.1107/s0907444902003001. [DOI] [PubMed] [Google Scholar]
- Joseph S, Noller HF. EF-G-catalyzed translocation of anticodon stem-loop analogs of transfer RNA in the ribosome. EMBO J. 1998;17:3478–3483. doi: 10.1093/emboj/17.12.3478. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koh CS, Brilot AF, Grigorieff N, Korostelev Aa. Taura syndrome virus IRES initiates translation by binding its tRNA-mRNA-like structural element in the ribosomal decoding center. Proc Natl Acad Sci U S A. 2014;111:9139–9144. doi: 10.1073/pnas.1406335111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lancaster AM, Jan E, Sarnow P. Initiation factor-independent translation mediated by the hepatitis C virus internal ribosome entry site. RNA. 2006;12:894–902. doi: 10.1261/rna.2342306. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McKenna SA, Kim I, Puglisi EV, Lindhout DA, Aitken CE, Marshall RA, Puglisi JD. Purification and characterization of transcribed RNAs using gel filtration chromatography. Nat Protoc. 2007;2:3270–3277. doi: 10.1038/nprot.2007.480. [DOI] [PubMed] [Google Scholar]
- Muhs M, Hilal T, Mielke T, Skabkin MA, Sanbonmatsu KY, Pestova TV, Spahn CMT. Cryo-EM of Ribosomal 80S Complexes with Termination Factors Reveals the Translocated Cricket Paralysis Virus IRES. Mol Cell. 2015;57:422–432. doi: 10.1016/j.molcel.2014.12.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Munro JB, Altman RB, O’Connor N, Blanchard SC. Identification of Two Distinct Hybrid State Intermediates on the Ribosome. Mol Cell. 2007;25:505–517. doi: 10.1016/j.molcel.2007.01.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- O’Leary SE, Petrov A, Chen J, Puglisi JD. Dynamic recognition of the mRNA cap by Saccharomyces cerevisiae eIF4E. Structure. 2013;21:2197–2207. doi: 10.1016/j.str.2013.09.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Palmiter RD. Quantitation of parameters that determine the rate of ovalbumin synthesis. Cell. 1975;4:189. doi: 10.1016/0092-8674(75)90167-1. [DOI] [PubMed] [Google Scholar]
- Pestova TV, Hellen CUT. Translation elongation after assembly of ribosomes on the Cricket paralysis virus internal ribosomal entry site without initiation factors or initiator tRNA. Genes Dev. 2003;17:181–186. doi: 10.1101/gad.1040803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pestova TV, Lomakin IB, Hellen CUT. Position of the CrPV IRES on the 40S subunit and factor dependence of IRES/80S ribosome assembly. EMBO Rep. 2004;5:906–913. doi: 10.1038/sj.embor.7400240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Petrov A, Puglisi JD. Site-specific labeling of Saccharomyces cerevisiae ribosomes for single-molecule manipulations. Nucleic Acids Res. 2010;38 doi: 10.1093/nar/gkq390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pittman YR, Kandl K, Lewis M, Valente L, Linzy TG. Coordination of eukaryotic translation elongation factor 1A (eEF1A) function in actin organization and translation elongation by the guanine nucleotide exchange factor eEF1Bα. J Biol Chem. 2009;284:4739–4747. doi: 10.1074/jbc.M807945200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ren Q, Au HHT, Wang QS, Lee S, Jan E. Structural determinants of an internal ribosome entry site that direct translational reading frame selection. Nucleic Acids Res. 2014;42:9366–9382. doi: 10.1093/nar/gku622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sasaki J, Nakashima N. Translation initiation at the CUU codon is mediated by the internal ribosome entry site of an insect picorna-like virus in vitro. J Virol. 1999;73:1219–1226. doi: 10.1128/jvi.73.2.1219-1226.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schneider-Poetsch T, Ju J, Eyler DE, Dang Y, Bhat S, Merrick WC, Green R, Shen B, Liu JO. Inhibition of eukaryotic translation elongation by cycloheximide and lactimidomycin. Nat Chem Biol. 2010;6:209–217. doi: 10.1038/nchembio.304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Terenin IM, Dmitriev SE, Andreev DE, Shatsky IN. Eukaryotic translation initiation machinery can operate in a bacterial-like mode without eIF2. Nat Struct Mol Biol. 2008;15:836–841. doi: 10.1038/nsmb.1445. [DOI] [PubMed] [Google Scholar]
- Thompson SR, Gulyas KD, Sarnow P. Internal initiation in Saccharomyces cerevisiae mediated by an initiator tRNA/eIF2-independent internal ribosome entry site element. Proc Natl Acad Sci U S A. 2001;98:12972–12977. doi: 10.1073/pnas.241286698. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tsai A, Petrov A, Marshall RA, Korlach J, Uemura S, Puglisi JD. Heterogeneous pathways and timing of factor departure during translation initiation. Nature. 2012 doi: 10.1038/nature11172. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang QS, Jan E. Switch from cap- to factorless IRES-dependent 0 and +1 frame translation during cellular stress and dicistrovirus infection. PLoS One. 2014;9:e103601. doi: 10.1371/journal.pone.0103601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilson JE, Powell MJ, Hoover SE, Sarnow P. Naturally occurring dicistronic cricket paralysis virus RNA is regulated by two internal ribosome entry sites. Mol Cell Biol. 2000a;20:4990–4999. doi: 10.1128/mcb.20.14.4990-4999.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wilson JE, Pestova TV, Hellen CU, Sarnow P. Initiation of protein synthesis from the A site of the ribosome. Cell. 2000b;102:511–520. doi: 10.1016/s0092-8674(00)00055-6. [DOI] [PubMed] [Google Scholar]
- Wohlgemuth I, Brenner S, Beringer M, Rodnina MV. Modulation of the rate of peptidyl transfer on the ribosome by the nature of substrates. J Biol Chem. 2008;283:32229–32235. doi: 10.1074/jbc.M805316200. [DOI] [PubMed] [Google Scholar]
- Yamamoto H, Nakashima N, Ikeda Y, Uchiumi T. Binding mode of the first aminoacyl-tRNA in translation initiation mediated by Plautia stali intestine virus internal ribosome entry site. J Biol Chem. 2007;282:7770–7776. doi: 10.1074/jbc.M610887200. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







