D-repeat in the XIST gene is required for X chromosome inactivation

ABSTRACT

XIST is a long non-coding RNA, which expressed exclusively from the inactive X chromosome. Although it has been revealed that the A-repeat contributes to the X chromosome inactivation (X-inactivation), the role of the longest D-repeat has not yet been investigated. Here, a sgRNA directed CRISPR/Cas9 system which have multiple target sites within repeat D of XIST, were used to generate D-repeat deletion and studied its roles on X-inactivation. The results showed that the deletion of D-repeat caused a significantly decreased expression of XIST, and up regulated expression of X-linked genes, suggesting that the D-repeat may play an important role in the regulation of XIST expression and silencing of the X-linked genes, which could provide a new idea in the molecular mechanisms of X-inactivation.

Introduction

XIST is one of the long non-coding RNA, which is located in X-inactivation center (Xic) and is required for the X-inactivation.¹ Human XIST encodes approximately 17 kb of transcripts, and several tandem repeats named A-F repeat are conserved among mammals.^2,3 It has been shown that the A-repeat, located in the proximal part of the XIST RNA, contributes to XIST RNA localization and X chromosomal silencing, while other repeats may play an alternative role in transcriptional localization.^4,5

Recently, the bacterial clustered regularly interspaced short palindromic repeats (CRISPR) - associated endonuclease 9 (CRISPR/Cas9) system has been utilized as a genome-editing tool for generating mutations specifically and efficiently in varieties of organisms.^6,7 While the undesirable off-target effect has been frequently reported in culture cells^8-10 and mouse zygotes ¹¹ caused by the mismatches sequence of the single guide RNA (sgRNA). However, the off-target mutation mediated by CRISPR/Cas9 could be used for the disruption of multi-homeologous and paralogous genes members in rice.¹²

Although it has been well-documented that the A-repeat is responsible for X chromosomal silencing, the role of the longest D-repeat within exon 1 of XIST has not yet been investigated. To investigate the role of the D-repeat in X-inactivation, we developed an efficient strategy to generate a D-repeat knockout by a sgRNA directed CRISPR/Cas9 system. In this study, we reported the novel findings regarding the D-repeat as one of the elements required for X-inactivation.

Materials and methods

Vector construction

The PX459 plasmid (Addgene ID 48139) described previously was used for the cloning of the sgRNA in this study.¹³ Briefly, the PX459 vector was digested with BbsI and gel purified using the Gel Extraction Kit (Tiangen, Beijing, China). A pair of complementary 20-nt oligonucleotides of guide sequences was annealed at 95°C for 5 min and ramp down to 25°C to generate the dsDNA fragment, and then the sgRNA for the targeting site was cloned into the linearized PX459 vector and sequence confirmed.

Cell culture and DNA transfection

Human embryonic kidney (HEK) 293FT and Hela cell line (ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (HyClone), 2mM GlutaMAX (Life Technologies), 100 U/ml penicillin and 100 mg/ml streptomycin and incubated at 37°C in an atmosphere of 5% CO2. The cells were seeded into 6-well plates at a density of 120,000 per-well and transfected using Turbofect™in vitro Transfection Rengent (Fermentas) according to the manufacturer's instructions. Transfected cells were diluted 1:32 and cultured in selective medium using 2.0 mg/mL puromycin (Sigma-Aldrich), then the cell clones were picked up and collected for further study

Mutation detection by PCR

The genomic DNA was extracted from sgRNA and empty vector transfected (Con) cell using the TIANamp Genomic DNA Kit (TIANGEN, Beijing, China) according to the manufacturer's instructions. The pair of primers used for the amplification of D-repeat as follows: XIST-F, 5′ TGACAATTACATCGTATCCTTCCT 3′, XIST-R, 5′ TGTCCAAGGGACATTGTTGT 3′. Then the PCR products were gel purified using the TIANgel Midi Purification Kit (TIANGEN, Beijing, China) and subjected to pGM-T vector cloning (Tiangen, Beijing, China). Ten positive plasmid clones were sequenced, and the Vector NTI (Invitrogen) and DNAman were used for sequence analysis.

Quantitative real-time PCR (q-PCR)

Total RNA was extracted from sgRNA transfected and control cells using TRNzol-A+ reagent (TIANGEN, Beijing, China) according to the manufacturer's instructions. The isolated RNA was treated with DNase I (Fermentas) to eliminate the residual DNA. The cDNA was then synthesized using the BioRT cDNA First Strand Synthesis Kit (Bioer Technology, Hangzhou, China).

q-PCR was carried out using the BioEasy SYBR Green I Real Time PCR Kit (Bioer Technology, Hangzhou, China) according to the manufacturer's instructions. The GAPDH was used as endogenous gene. The relative gene expression was presented as means ± standard deviation (SD) from 3 cell clones, and analyzed by 2^−ΔΔCT formula. Data was statistically analyzed by Graphpad prism software (T test) and a p value < 0.05 was considered statistically significant. The primers used for q-PCR are shown in supplementary table S1.

Off-target analysis

Potential off-target sites (POTS) of the sgRNAs were predicted using the CRISPR/Cas9 online design tool (http://tools.genomeengineering.org). The top 5 POTSs which were most likely to produce off-target mutations were selected and subjected to PCR and sequence analysis. The primers are listed in supplementary table S2.

Karyotype analysis

Metaphase slide preparation and G-banding were performed according to standard procedures. 100 well-spread metaphases cells were captured with Nikon microscope (ts100) and analyzed by Lucia computer analysis system for karyotyping.

Results and discussion

Selection of target sequence and the vector construction

X-inactivation is a chromosome-wide gene silencing regulated by long non-coding XIST RNA, which inactivates one of the 2 X chromosomes in female mammals.¹⁴ XIST transcript is composed of 6 tandem repeats defined A to F which are considered to be crucial factors in X-inactivation.⁵ Although previous study has reported that A-repeat is an essential motif responsible for chromosomal silencing, research on the role of the longest D-repeat within exon 1 is lacking.¹⁵ The D-repeat locates in +6086 to +8312, and contains 7.6 copies of 290 bp tandem repeat units in XIST RNA (Fig. 1A). To investigate the role of the D-repeat in X-inactivation, we chose 20bp in the consensus of D-repeat as a sgRNA sequence, which was cloned into PX459 backbone using BbsI site and confirmed by sequencing. The corresponding POTSs in each tandem repeat unit is shown in Fig. 1B. The schematic representation of the vector using in this study is shown in Fig. 1C.

Figure 1.

Schematic of CRISPR/Cas9-mediated D-repeat knockout and vector construction. (A) Target site of CRISPR/Cas9-mediated mutagenesis in D-repeat of XIST gene. Gene structure of the human XIST with 6 exons represented as blank boxes and the tandem repeat of A-F are shown with boxes of different colors. The sequence of the sgRNA is shown according to the consensus of 7.6 D tandem repeat (TR) units. The PAM sequence (NGG) is shown in purple and the target sequence is shown in green. The q-PCR primers for the XIST are represented with a pair of red arrows. (B) The alignment of the sgRNA in TR1-TR8 is shown; the red means the mismatches sequence compared to the sgRNA. (C) Vector used in this study. The vector contains sgRNA insertion sites (pink) and the human codon optimized S. pyogenes Cas9 (hSpCas9) (orange).

Knockout of D-repeat using one sgRNA

To determine the efficiency of long tandem repeat knockout of D-repeat using one sgRNA, the sgRNA and empty plasmid was transfected into 293FT cells, and then the PCR was performed to amplify the D-repeat using the isolated genomic DNA from sgRNA transfected and control cells. The agarose gel analysis showed a specificity and intact band of 2537 bp in control cells, while there were obscure bands and no PCR product of 2537 bp was detected in sgRNA targeting D-repeat samples, indicating that various types of mutations were occurred after the sgRNA transfection. The band of ˜500 bp suggested that the length of the fragment deletions mediated by the sgRNA was up to 2000 bp (Fig. 2A). To verify this finding, 10 T-vector subclones were sequenced for sgRNA transfected cell group. As shown in Fig. 2B, the deletion of D-repeat mediated by a sgRNA was varied from 1500 bp to 2000 bp, 5 to 7 repeat units, respectively.

Figure 2.

The expression of XIST and X-linked genes after the knockout of D-repeat. (A) The sgRNA- mediated D-repeat mutation were analyzed by PCR and agarose gel. Genomic DNA was extracted from sgRNA transfected and control cells, subjected to PCR and 2% agarose gel analysis. M, marker III. KO, knockout of D-repeat. Con, empty vector. (B) The mutation efficient of were analyzed by T-vector sequences analysis. WT represent the sequence of 7.6 tandem repeat units in D-repeat. The PAM sequence is marked in purple and the off-target sites marked in green. The sequence of region deletions is under gray background and the length of deletions is noted to the right of each sequence (- deletion). The sgRNA targeted TRs were demonstrated in red underlined.(C) The expression of XIST and X-linked genes were investigated by q-PCR. Data are shown as mean ±SEM (n = 3). Asterisks denote significant differences between Con and KO samples; *p < 0.05,**p < 0.001.

Off-target mutation is a critical issue in the application of CRISPR/Cas9 system. To test whether undesired off-target mutation occurred in the human genome in sgRNA transfected cells, 5 POTSs were predicted using the CRISPR design tool and chose to perform off-target analysis. The sequence analysis data revealed that none of the sequencing reads exhibited mutations, suggesting that no off-target occurred in the 5 POTSs (Fig. S1). In addition, to determine if the XIST locus is structurally intact, the primers specificity RT-PCR and Sanger sequence were performed on sgRNA transfected and control cells, which indicated there is no additional inversion or rearrangement in XIST (data not shown).

It has been suggested that the 20 bp sequence in the sgRNA and the 5′-NGG and 5′-NAG protospacer adjacent motif (PAM) play an important role in the specificity of CRISPR/Cas9-mediated DNA cleavage. The ‘seed region’ of sgRNA is approximately 12 bases proximal to the PAM, which is crucial for sgRNA pairing and DNA cleavage.^9,10 While in our study, off-target mutation also occurred at the POTS in TR1 which has a mismatch at 7 bp proximal to the PAM. Thus, we suspect that some of these cleavages are not the product of DSB activity but rather an unpredictable non-homologous end joining (NHEJ) ocurring in neighboring tandem repeats. In fact, off-target effects are not easily predicted, as they depend not only on the location but also on mismatch distribution and chromatin structure.^16,17 In addition, off-target mutations occurred in D-repeat while not in POTSs in the human genome, which is not surprising because there are more mismatches in these 5 top POTSs than in the sgRNA targeted D-repeat sequence. Moreover, the efficiency of long tandem repeats deletion can be improved by 2 or more sgRNAs according to the specific sequence of each repeat unit.

The gene expression analysis of XIST and X-linked genes after knockout of D-repeat

To investigate the role of the D-repeat in X-inactivation, the expression of XIST and X-linked genes were compared between sgRNA transfected and control cells by q-PCR. The result demonstrated that the XIST was down regulated in D-repeat knockout cell group, while the expression of 6 X-linked genes, HPRT, PGK1, PLAC1, RNF12, MECP2 and RPL13A were all increased significantly compared to the control cells (Fig. 2C). In all, the q-PCR results revealed that deletion of D-repeat induced the down-regulated expression of XIST and X-activation.

Previously studies have demonstrated that 5′ A-repeat in XIST gene contributes to both the localization of the RNA and the establishment of X-inactivation, while other repeats play a role in the RNA localization.⁵ In our study, the failure of X-inactivation resulted from the D-repeat deletion could be ascribed to a reduction either in the stability or the expression of XIST RNA. Therefore, we raised a hypothesis that the D-repeat in XIST is an essential element required for X-inactivation (Fig. 3). Although our study provided a new insight into the mechanisms of X chromosomal silencing, the further attempts to identify the mechanism of D-repeat regulation in XIST expression and X-inactivation are needed.

Figure 3.

Summary of the CRISPR/Cas9 mediated D-repeat knockout and its roles on X-inactivation (A) Schematic representation of D-repeat knockout in XIST using CRISPR/Cas9 system. The Cas9 protein binds to the sgRNA scaffold and in the presence of the postorspacer sequence and the PAM sequence it generates a cleavage. The cleavage triggers the endogenous cellular DNA repair machinery that catalyzes non-homologous end joining (NHEJ). The red segment indicated the misparing between sgRNA and genome site. The green part represents the OTS1, the blue represents the OTS2. (B) D-repeat regulated the expression of XIST (red) on the inactive X chromosome (Xi). Subsequently, the XIST RNA coats the whole X chromosome induced the X-inactivation.(C) CRISPR/Cas9 mediated D-repeat knockout resulted in the downregulated expression of XIST, which lead to the compromise of X-inactivation.

We chose 293FT cell in this study because of its high transfection efficiency, but the unstable karyotype and diversity of the mutation genotypes in transiently transfected cells is unavoidable. In order to strengthen the gene expression results, the stable 293FT cell lines with the homozygous genotype were generated by puromycin selection. As shown in Fig S2, significantly decreased expression of XIST while increased X-linked genes were observed in the D-repeat knockout cells, which confirmed that D-repeat is required for X chromosome inactivation (Fig S2). In addition, the unstable karyotype in 293FT cells could also affect the gene expression. So here we performed karyotype analysis in mutant and control cells, the data indicated the chromosome number of 293FT cells is mainly in 63–78, while there is no significantly different between the mutant and control cells (Fig S3). Based on the previously study have shown the 293FT cell could be used for the study of XCI (X-chromosome inactivity)^18-19 and the same result observed in Hela cells (Fig S2), we believe the downregulated expression of XIST and X-chromosome activation is not related to different chromosome numbers while induced by the D-repeat deletion in this study.

In conclusion, our study established an efficient way to generate D-repeat knockout in human XIST gene using a sgRNA directed CRISPR/Cas9 system, which provides a novel method for disruption of tandem repeat. Moreover, we proposed and preliminary demonstrated that D-repeat is one of the key elements in the process of X chromosomal silencing, which will provide further insight into the mechanism of X-inactivation.

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Acknowledgments

This project was gratefully funded from the National Natural Science Foundation of China (Grant No. 31201080 and 31272394). Agricultural science and technology research of Guangdong province (2011A020102003).