Skip to main content
Biomedical Reports logoLink to Biomedical Reports
. 2016 Mar 18;4(5):601–604. doi: 10.3892/br.2016.634

Helicobacter pylori hopQ alleles (type I and II) in gastric cancer

HAMED EBRAHIMZADEH LEYLABADLO 1, MINA YEKANI 2, REZA GHOTASLOU 1,2,
PMCID: PMC4840507  PMID: 27123254

Abstract

The Helicobacter pylori (H. pylori) outer membrane protein (HopQ) of is one of the proteins involved in bacterial adherence to gastric mucosa and has been suggested to have a role in the virulence of H. pylori. The aim of the present study was to determine the association between H. pylori virulence types I and II hopQ genotypes and patients with different gastrointestinal diseases. A polymerase chain reaction-based assay was used to determine the presence of type I and type II hopQ genes in 88 H. pylori strains isolated from H. pylori-infected patients. Of the total 88 H. pylori isolates, type I and type II hopQ alleles were detected in 52 (59.1%) and 36 (40.9%), respectively. A significant association was found between type I hopQ gene and gastric cancer [odds ratio, 2.3; 95% confidence interval (CI), 1.3–4.1] and gastric ulcers (odds ratio, 2.5; 95% CI, 1.4–4.3). A significant association was also identified between the type II hopQ gene and gastric cancer (odds ratio, 2.4; 95% CI, 1.1–3.0). The association between hopQ type I and hopQ type II genotypes and clinical status suggest that these genes may be helpful in the universal prediction of specific disease risks.

Keywords: Helicobacter pylori, virulence factor, outer membrane proteins

Introduction

Helicobacter pylori (H. pylori) is a Gram-negative bacterium that persistently colonizes in the stomachs of more than half the human population (1). Colonization of the stomach by H. pylori consistently induces gastric inflammation, known as superficial chronic gastritis, and is a risk factor for the development of peptic ulcer disease and gastric malignancies (2). H. pylori strains are thought to possess various virulence factors, which contribute to digestive disease complications (3). In 2005, it was reported that H. pylori hopQ genotypes are associated with an increased risk for peptic ulcer disease (4). H. pylori genomes contain ~30 paralogous hop genes, which encode outer membrane proteins (5). HopQ is localized at the surface of H. pylori (6). The H. pylori outer membrane protein (Hop) family is the largest and includes adhesions such as BabA (HopS) (7), SabA (HopP) (8), OipA (HopH) (9), AlpAB (HopB and HopC) (10) and HopQ (11). However, nothing is known regarding the functional properties of HopQ and this study did not provide further data regarding disease-specific virulence factor of hopQ. H. pylori hopQ alleles exhibit a high level of genetic diversity, and two families of hopQ alleles have been described (type I hopQ and type II hopQ) (12). Iran is a developing country with a high prevalence of H. pylori infections, among symptomatic and asymptomatic individuals, and the prevalence is ≤90% in the northwestern part of the country (13). The aim of the present study was to determine the association between H. pylori virulence type I and type II hopQ genotypes and patients with different gastrointestinal diseases.

Materials and methods

Patients

In the study, patients undergoing upper gastric endoscopy due to different digestive diseases that visited the hospitals in Tabriz (Iran) were included. The standard number of gastric biopsy samples for patients who were suspected of being infected with H. pylori was obtained for routine culture and histological investigations. Patient groups according to endoscopic and pathology findings were: Gastric ulcer (GU), duodenal ulcer (DU), gastritis and gastric carcinoma (GC). Written informed consent was obtained from all the patients prior to entering the study, and the study was approved by the Regional Ethics Committee, Tabriz University of Medical Sciences (Tabriz, Iran; no. 5/47/1375, April 4, 2015).

H. pylori isolates and bacterial culture. The presence of H. pylori was determined by cultures placed on Brucella agar (Merck KGaA, Darmstadt, Germany) containing 5% sheep blood and antibiotics such as amphotericin B (5 mg/ml), trimethoprim lactate (5 mg/l), vancomycin (10 mg/ml) and polymixin-B (2,500 U/ml). Plates were incubated at 37°C, in 10% CO2 conditions, and were subsequently identified as H. pylori, based on: Colony morphology, Gram-staining and positive oxidase, catalase and urease tests. In the present study, the H. pylori American Type Culture Collection (ATCC) 43504 strain (ATCC, Manassas, VA, USA) was used as a reference.

DNA extraction and polymerase chain reaction (PCR)

Bacterial DNA was extracted from single colonies of H. pylori and their DNA was extracted by sodium dodecyl sulphate, proteinase K and the cetyltrimethyl ammonium bromide method (14) and stored at −20°C. Initially, the PCR assay was used to detect the H. pylori-specific ureC (glmM) gene for confirmation of H. pylori strains (15). In this experiment, hopQ type I and type II genes were detected by the PCR method (16,17) (Table I), under the following conditions for both genes: 35 cycles at 94°C for 60 sec, at 54°C for 45 sec, and at 72°C for 65 sec, and a final extension at 72°C for 10 min. PCR products were analyzed on 1.5% agarose and the strains containing the hopQ type I and hopQ type II genes were used as a positive control.

Table I.

Amplification primers for amplification used in the study.

Study, year DNA region amplified Primers Primer sequence Refs.
Kidd et al, 1999 glmM HP-F AAGCTTTTAGGGGTGTTAGGGGTTT (16)
HP-R AAGCTTACTTTCTAACACTAACGC
Sicinschi et al, 2012 Type I hopQ HP-F CAACGATAATGGCACAAACT (17)
HP-R GTCGTATCAATAACAGAAGTTG
Sicinschi et al, 2012 Type II hopQ HP-F TCCAATCCAGAAGCGATTAA (17)
HP-R GTTTTAATGGTTACTTCCACC

Statistical analysis

The data obtained were analyzed by SPSS (version 19; IBM, Corp., Armonk, NY, USA) and the χ2 test and Fisher's exact test was used to compare the clinical outcomes and the presence of genes. P<0.05 was considered to indicate a statistically significant difference.

Results

H. pylori culture positive

From 286 gastric biopsies, 88 (30.76%) were positive for H. pylori. Of the patients (including 88 H. pylori-positive) that attended the endoscopy ward, 6 suffered from anemia (6.8%), 24 from epigastria pain (27.3%), 10 from gastro-esophageal reflux disease (11.4%), 46 from dyspepsia (52.3%), and 2 from gastrointestinal bleeding (2.3%). According to endoscopy and pathology findings, among the remaining 88 H. pylori culture-positive patients, 10 (11.4%) had GU, 16 (18.2%) had DU, 36 (41.0%) had gastritis and 26 (29.5%) had GC (Fig. 1).

Figure 1.

Figure 1.

Frequency of hopQ types among different diseases.

Using primers for the ureC (glmM) gene, the PCR product of 294-base pairs was obtained in all 88 strains. The mean age of patients was 40±15 years, ranging from 18 to 84 years and including 40 (45.5%) males and 48 (54.5%) females. The data showed that of 88 isolates, hopQ type I was present in 52 (59.1%) isolates and hopQ type II was found in 36 (40.9%) isolates. Table II depicts the prevalence of these genes in association with the different disease groups.

Table II.

Distribution of Helibacter pylori hopQ genes (type I and II) among the different groups.

Diseases (no.) Rate of type I hopQ, no. (%) Odd ratio (95% CI) Rate of type II hopQ, no. (%) Odds ratio (95% CI)
Gastric carcinoma (26) 18 (69.2) 2.3 (1.3–4.1) 16 (61.5) 2.4 (1.1–3.0)
Duodenal ulcer (16)   6 (37.5) 0.6 (0.3–1.0)   2 (12.5) 0.2 (0.1–0.4)
Gastric ulcer (10) 10 (100.0) 2.5 (1.4–4.3)   4 (40.0) 0.7 (0.4–1.2)
Gastritis (36) 18 (50.0) Control group 14 (38.9) Control group

HopQ, Helibacter pylori outer membrane protein; CI, confidence interval.

Associations between hopQ types and disease

There were no statistically significant associations between age and gender with hopQ types (P>0.05). Statistical analysis indicated significant associations between hopQ type I and GC [odds ratio, 2.3; 95% confidence interval (CI), 1.3–4.1] and GU (odds ratio, 2.5; 95% CI, 1.4–4.3). Type II hopQ was also found to be significantly predominant in patients with gastric cancer (odds ratio, 2.4; 95% CI, 1.1–3.0). A combination of hopQ type I/hopQ type II genotypes were observed in 36 (40.9%) patients and statistical analysis demonstrates that there is a significant association between the simultaneous presence of these two genes (P=0.004).

Discussion

H. pylori cause the most prevalent bacterial infections globally (18). The adherence of H. pylori to the gastric mucosa have important roles in the initial colonization and long-term persistence on the gastric mucosa as well as in the intensity of the resulting inflammatory response. Colonization of H. pylori usually does not result in clinical consequences but can increase the risk of developing peptic ulcer diseases, gastric adenocarcinoma and lymphoma (19). It has been suggested that specific genotyping-based analysis of H. pylori isolates can be useful for predicting post-infection disorders (20).

In the present study, the prevalence of H. pylori hopQ type I and type II genotypes was analyzed in patients with different gastrointestinal diseases. The predominant genotype In the Azerbaijan area was the hopQ type I genotype found in 52 (59%) cases and this high rate of hopQ type I was in contrast to a study, also performed in Iran, that considered the finding of 52% hopQ type II genotypes as being high (21). However, the present finding concerning the frequency of hopQ type I is consistent with a previous study conducted in the USA (11). Geographical differences in the distribution of type I and type II hopQ alleles have been noted. For example, the majority of H. pylori strains isolated in East Asia are cag PAI-positive and contain type I hopQ alleles. Type II alleles are commonly identified in H. pylori strains isolated in Western countries, but are uncommon among H. pylori strains from East Asia (4).

In the present study, the rate of the hopQ type II genotype was found most commonly in GC (61.5%). This finding is similar to results obtained in the North of Iran (21). The present findings showed that hopQ type I was most predominant in patients with GU, which is in disagreement with the study conducted in the North of Iran (21). To the best of our knowledge, this is the first study on the prevalence of H. pylori hopQ alleles, among patient with gastrointestinal disease in the Azerbaijan area, and this is the second study in Iran to determine the prevalence and association of these virulence genes with clinical outcomes. The present findings have shown that the hopQ type I and type II genotypes are associated with gastric cancer. The study by Cao and Cover (11) was conducted in the USA and reported that there was a significant association between the carriers of H. pylori hopQ type I among the peptic ulcer patients (11). However, Ohno et al (22) did not identify an association between the two hopQ alleles and clinical outcomes. Additionally, the combination of hopQ type I/hopQ type II genotypes were evaluated in the present study in association with the clinical outcomes and statistically significant correlation was identified between these alleles and disease conditions. It appears that these two genes are located in one place and may have a synergistic effect.

The prevalence and association between clinical outcome and the H. pylori virulence gene was reported to be different among various countries, regions, ethnicities and patient groups. The differences between studies may be due to geographical area, sample size, studied groups, ethnicity, primer sets, PCR conditions and the variety of bacterial strains. The weakness and limitations of the study firstly were low sample size and the small number of studies performed to obtain a whole evaluation on the prevalence of genes.

If additional studies showed similar results to the present findings, this may lead to improved diagnostic policies for clinicians to fight the present doctrine for gastric diseases. In conclusion, the association between hopQ types I and II, and gastric cancer outcomes, may suggest that these genes may be helpful for the prediction of specific-disease risk.

Acknowledgements

The authors are grateful to Dr H. Banazadeh Baghi for the English editing. The study was financially supported by Tabriz University of Medical Sciences.

References

  • 1.Cover TL, Blaser MJ. Helicobacter pylori in health and disease. Gastroenterology. 2009;136:1863–1873. doi: 10.1053/j.gastro.2009.01.073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Cover TL, Berg DE, Blaser MJ, Mobley H. Principles of bacterial pathogenesis. Academic Press; San Diego, CA: 2001. Helicobacter pylori pathogenesis; pp. 510–558. [Google Scholar]
  • 3.Costa AC, Figueiredo C, Touati E. Pathogenesis of Helicobacter pylori infection. Helicobacter. 2009;14(Suppl 1):15–20. doi: 10.1111/j.1523-5378.2009.00702.x. [DOI] [PubMed] [Google Scholar]
  • 4.Cao P, Lee KJ, Blaser MJ, Cover TL. Analysis of hopQ alleles in East Asian and Western strains of Helicobacter pylori. FEMS Microbiol Lett. 2005;251:37–43. doi: 10.1016/j.femsle.2005.07.023. [DOI] [PubMed] [Google Scholar]
  • 5.Alm RA, Bina J, Andrews BM, Doig P, Hancock RE, Trust TJ. Comparative genomics of Helicobacter pylori: Analysis of the outer membrane protein families. Infect Immun. 2000;68:4155–4168. doi: 10.1128/IAI.68.7.4155-4168.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sabarth N, Hurvitz R, Schmidt M, Zimny-Arndt U, Jungblut PR, Meyer TF, Bumann D. Identification of Helicobacter pylori surface proteins by selective proteinase K digestion and antibody phage display. J Microbiol Methods. 2005;62:345–349. doi: 10.1016/j.mimet.2005.04.030. [DOI] [PubMed] [Google Scholar]
  • 7.Ilver D, Arnqvist A, Ögren J, Frick IM, Kersulyte D, Incecik ET, Berg DE, Covacci A, Engstrand L, Borén T. Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science. 1998;279:373–377. doi: 10.1126/science.279.5349.373. [DOI] [PubMed] [Google Scholar]
  • 8.Mahdavi J, Sondén B, Hurtig M, Olfat FO, Forsberg L, Roche N, Angstrom J, Larsson T, Teneberg S, Karlsson KA, et al. Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science. 2002;297:573–578. doi: 10.1126/science.1069076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yamaoka Y, Kwon DH, Graham DY. A M(r) 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. Proc Natl Acad Sci USA. 2000;97:7533–7538. doi: 10.1073/pnas.130079797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Odenbreit S, Till M, Hofreuter D, Faller G, Haas R. Genetic and functional characterization of the alpAB gene locus essential for the adhesion of Helicobacter pylori to human gastric tissue. Mol Microbiol. 1999;31:1537–1548. doi: 10.1046/j.1365-2958.1999.01300.x. [DOI] [PubMed] [Google Scholar]
  • 11.Cao P, Cover TL. Two different families of hopQ alleles in Helicobacter pylori. J Clin Microbiol. 2002;40:4504–4511. doi: 10.1128/JCM.40.12.4504-4511.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Backert S, Selbach M. Role of type IV secretion in Helicobacter pylori pathogenesis. Cell Microbiol. 2008;10:1573–1581. doi: 10.1111/j.1462-5822.2008.01156.x. [DOI] [PubMed] [Google Scholar]
  • 13.Ghotaslou R, Milani M, Akhi MT, Nahaei MR, Hasani A, Hejazi MS, Meshkini M. Diversity of Helicobacter pylori caga and vaca genes and its relationship with clinical outcomes in Azerbaijan, Iran. Adv Pharm Bull. 2013;3:57–62. doi: 10.5681/apb.2013.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sambrook J, Russell DW. A laboratory manual. 3rd. Cold Spring Harbor Laboratory Press; New York, NY: 2001. Molecular cloning. [Google Scholar]
  • 15.Espinoza MGC, Vazquez RG, Mendez IM, Vargas CR, Cerezo SG. Detection of the glmM gene in Helicobacter pylori isolates with a novel primer by PCR. J Clin Microbiol. 2011;49:1650–1652. doi: 10.1128/JCM.00461-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kidd M, Louw JA, Marks IN. Helicobacter pylori in Africa: Observations on an ‘enigma within an enigma’. J Gastroenterol Hepatol. 1999;14:851–858. doi: 10.1046/j.1440-1746.1999.01975.x. [DOI] [PubMed] [Google Scholar]
  • 17.Sicinschi LA, Correa P, Bravo LE, Peek RM, Jr, Wilson KT, Loh JT, Yepez MC, Gold BD, Thompson DT, Cover TL, et al. Non-invasive genotyping of Helicobacter pylori cagA, vacA, and hopQ from asymptomatic children. Helicobacter. 2012;17:96–106. doi: 10.1111/j.1523-5378.2011.00919.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Rafeey M, Ghotaslou R, Nikvash S, Hafez AA. Primary resistance in Helicobacter pylori isolated in children from Iran. J Infect Chemother. 2007;13:291–295. doi: 10.1007/s10156-007-0543-6. [DOI] [PubMed] [Google Scholar]
  • 19.Ghotaslou R, Leylabadlo HE, Asl YM. Prevalence of antibiotic resistance in Helicobacter pylori: A recent literature review. World J Methodol. 2015;5:164–174. doi: 10.5662/wjm.v5.i3.164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Graham DY, Fischbach L. Helicobacter pylori infection. N Engl J Med. 2010;363:595–596. doi: 10.1056/NEJMc1006158. author reply 596. [DOI] [PubMed] [Google Scholar]
  • 21.Talebi Bezmin, Abadi A, Mohabbati Mobarez A. High prevalence of Helicobacter pylori hopQ II genotype Isolated from Iranian patients with gastroduodenal disorders. J Pathogens. 2014;2014:842469. doi: 10.1155/2014/842469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ohno T, Sugimoto M, Nagashima A, Ogiwara H, Vilaichone RK, Mahachai V, Graham DY, Yamaoka Y. Relationship between Helicobacter pylori hopQ genotype and clinical outcome in Asian and Western populations. J Gastroenterol Hepatol. 2009;24:462–468. doi: 10.1111/j.1440-1746.2008.05762.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Biomedical Reports are provided here courtesy of Spandidos Publications

RESOURCES