Abstract
Previous studies have demonstrated that promoter hypermethylation of tumor suppressor genes contributes to the occurrence and development of acute myeloid leukemia (AML). However, the association of DNA methylation with chemotherapeutic outcomes remains unknown. In the present study, 15 patients with AML were recruited, and the promoter methylation status of cyclin-dependent kinase inhibitor 2B (CDKN2B), solute carrier family 19 member 3 (SLC19A3) and deleted in lung and esophageal cancer 1 (DLEC1) genes was examined prior to and following various chemotherapeutic regimens in order to identify any alterations. The results suggested that chemotherapy-induced hypermethylation of CDKN2B and DLEC1 may be specific to males and females, respectively, and that there were no alterations in SLC19A3 methylation following chemotherapy. These results may provide an improved understanding of gene methylation to guide the development of an individualized chemotherapy for AML. Due to the complexity of AML and the wide range of treatment types, future studies with a larger sample size are required in order to verify the results of the present investigation.
Keywords: acute myeloid leukemia, chemotherapy, DNA methylation, cyclin-dependent kinase inhibitor 2B, solute carrier family 19 member 3, deleted in lung and esophageal cancer 1
Introduction
Acute myeloid leukemia (AML) is a heterogeneous hematologic malignancy, which is characterized by the clonal expansion of myeloblasts in the peripheral blood, bone marrow and other types of tissue (1,2). AML is a complex disease and various chemotherapeutic strategies may be useful for its treatment, including CAG [a combination of cytarabine (Ara-C), aclarubicin (Acl) and granulocyte colony-stimulating factor (G-CSF)], for relapsed and refractory AML (3); HAG [a combination of homoharringtonine (HHT), Ara-C and G-CSF], for relapsed or refractory AML and geriatric AML (4); HA (a mixture of HHT and Ara-C) for elderly patients with AML with relatively low toxicity and reasonable response rate (5); HAA (HHT, Ara-C and Acl) for young AML patients (6); IA [a combination of idarubicin (IDA) and Ara-C], for newly diagnosed AML (7); and all-trans retinoic acid/arsenic trioxide (ATRA/ATO) for acute promyelocytic leukemia (8).
AML pathogenesis is complex, involving an interaction between genetic and epigenetic aberrations (9–12). AML is caused by various factors, including the accumulated damaging effects of genetic mutations and aberrant epigenetic modifications (13). Aberrant promoter methylation is frequently found in human malignancies including AML (14–16). The Cancer Genome Atlas has determined that 44% of patients with AML exhibit gene mutations that regulate genomic DNA methylation (17). Although the molecular risk stratification of AML is largely based on genetic markers, DNA methylation may also have prognostic value (18).
Promoter hypermethylation of tumor suppressor genes has been recognized as a cause of oncogenesis (19). Identification of specific epigenetic modifications may explain the complexity and genomic instability of neoplastic diseases, and provide a basis for targeted therapy (20). Among these genes, the hypermethylation of cyclin-dependent kinase inhibitor 2B (CDKN2B) has been found to be associated with an increased risk of leukemia (P=0.001; odds ratio = 9.67; 95% confidence interval = 2.48–37.75) (13). Solute carrier family 19 member 3 (SLC19A3) has been observed to be epigenetically downregulated in gastric cancer (21). Furthermore, deleted in lung and esophageal cancer 1 (DLEC1), as a tumor suppressor gene, may contribute to tumorigenesis (22).
The present study examined whether chemotherapy induced alterations in the methylation of CDKN2B, SLC19A3 and DLEC1 genes, and whether there was a correlation between the methylation changes and the prognosis of patients with AML.
Materials and methods
Patients
Bone marrow genomic DNA was obtained from 15 patients with AML recruited from Yuyao People's Hospital (Yuyao, China) between November 2012 and June 2013. There were 7 male and 8 female patients with a mean age of 51.8±15.8 years (range, 19–76 years), including two M1, seven M2, five M3, and one M4 AML subtypes. The 2 patients with subtype M1 AML were treated with HAA and CAG regimens, respectively. The regimens of the 7 patients with subtype M2 AML included CAG, IA, HAA, AA (Ara-C plus Acla) and DA [daunorubicin (DNR) plus Ara-C]. Among the 5 patients with subtype M3 AML three were treated with ATRA accompanied by ATO, DNR, HA or AD (Ara-C plut dexamethasone), and the regimens of the other two were IA and HA, respectively. The regimen of the 1 patient with M4 subtype AML comprised a combination of IA, CAG and HHT. The clinical parameters of the patients with AML are summarized in Table I.
Table I.
Clinical parameters of the patients with AML.
| Patient number | Gender | Age (years) | AML subtype | Treatment regimen |
|---|---|---|---|---|
| 1 | Male | 23 | M3 | ATRA/ATO |
| 2 | Male | 40 | M3 | DNR + ATRA |
| 3 | Male | 67 | M4b | IA + CAG + HHT |
| 4 | Male | 59 | M3 | HA |
| 5 | Male | 55 | M1 | HAA |
| 6 | Male | 76 | M2a | CAG |
| 7 | Male | 66 | M2 | IA |
| 8 | Female | 48 | M2a | HAA |
| 9 | Female | 66 | M2a | CAG |
| 10 | Female | 56 | M2 | CAG + AA + DA |
| 11 | Female | 50 | M2a | IA |
| 12 | Female | 19 | M2a | HAA |
| 13 | Female | 51 | M3 | ATRA/ATO + HA + AD |
| 14 | Female | 40 | M3 | IA |
| 15 | Female | 59 | M1 | CAG |
AML, acute myeloid leukemia; ATRA, all-trans retinoic acid; ATO, arsenic trioxide; DNR, daunorubicin; IA, idarubicin and cytarabine (Ara-C); CAG, Ara-C, aclarubicin and granulocyte colony-stimulating factor; HHT, homoharringtonine; HA, HHT and Ara-C; HAA, HHT, Ara-C and aclarubicin; AA, Ara-C and aclarubicin; DA, daunorubicin and Ara-C; AD, Ara-C and dexamethasone.
The patients were classified for AML subtype according to World Health Organization guidelines (23), and were reevaluated in order to fulfill the diagnostic criteria published by Fasan et al (24). Specifically, the patients were checked for clinical parameters, cytogenetic abnormalities, molecular markers and abnormal hematopoiesis. The prognosis of the patients was determined according to the National Comprehensive Cancer Network (NCCN) Clinical Practice Guidelines in Oncology for acute myeloid leukemia (version 2.2013).
Patients were identified as being in complete remission (CR) if they were did not require transfusions, and had normal cytogenetics, absolute neutrophil count >1,000/µl, marrow blasts <5%, and no extramedullary disease. Patients were considered to be in partial remission (PR) if they had normal blood counts and a reduction in bone marrow blasts to 5–25% (≥50% reduction). Worse prognosis was defined when patients after chemotherapy showed none of the aforementioned remission symptoms, or had worse symptoms including worse cytogenetics, increased accumulation of myeloblasts, immature cells in bone marrow, extramedullary leukemic cell infiltration, or mortality.
Clinical pathological data and chemotherapy regimens were obtained from the patients' medical records and pathology files. The study protocol was approved by the Ethics Committee of Yuyao People's Hospital. All patients who participated in the study signed written informed consent forms.
DNA extraction and bisulphite DNA modification
DNA was extracted from bone marrow nucleated cells using a nucleic acid extraction analyzer (Lab-Aid 820; Xiamen Zeesan Biotech Co., Ltd., Xiamen, China). DNA concentrations were measured using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). Methylation of the DNA samples was then analyzed by the classic sodium bisulfite method (25), using an EZ DNA Methylation-Gold kit™ (Zymo Research Corporation, Irvine, CA, USA).
Methylation-specific polymerase chain reaction (MSP)
The methylation status of the three genes was determined by conventional MSP (26). Polymerase chain reaction (PCR) was conducted in a final volume of 20 µl containing 1.5 µl modified DNA, 0.5 µl forward and reverse primers, 10 µl Zymo Taq™ Premix (Zymo Research Corporation) and 7.5 µl DNAase/RNAase-free water. DNA amplification was performed on Veriti® PCR machine (Applied Biosystems; Thermo Fisher Scientific) under the following conditions: 10 min of denaturation at 95°C followed by 30 or 35 cycles of 30 sec at 94°C, 45 sec at the annealing (or melting) temperature (Table II), 1 min at 72°C, and 72°C for 7 min, prior to storage at 4°C. PCR products were subjected to analysis using a Qsep100 automated nucleic acid analysis system (BiOptic, Inc., La Cañada Flintridge, CA, USA). Samples were determined to be methylated or unmethylated on the basis of the visible peaks generated by the Q-Analyzer. The methylated and unmethylated primer sequences of CDKN2B (27), SLC19A3 (28) and DLEC1 (29) genes are presented in Table II. Some of the DNA samples were sequenced using an ABI 3730 DNA Analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc.), and the results indicated a successful bisulfite conversion and amplification (Fig. 1).
Table II.
MSP primers and reaction conditions in the PCR amplification.
| Gene | Primer | Sequence (5′ to 3′) | Product length (bp) | Tm (°C)/cycles | |
|---|---|---|---|---|---|
| CDKN2B | MF | GCGTTCGTATTTTGCGGTT | 148 | 55/30 | |
| MR | CGTACAATAACCGAACGACCGA | ||||
| UF | TGTGATGTGTTTGTATTTTGTGGTT | 154 | 57/30 | ||
| UR | CCATACATAACCAAACAACCAA | ||||
| SLC19A3 | MF | GTTTGGACGTTCGGATTC | 114 | 57/30 | |
| MR | CGCGACTATCGAATAAATCC | ||||
| UF | AAGGTTTGGATGTTTGGATTT | 114 | 55/30 | ||
| UR | ACCCACAACTATCAAATAAATCC | ||||
| DLEC1 | MF | GATTATAGCGATGACGGGATTC | 193 | 57/35 | |
| MR | ACCCGACTAATAACGAAATTAACG | ||||
| UF | TGATTATAGTGATGATGGGATTTGA | 193 | 55/30 | ||
| UR | CCCAACTAATAACAAAATTAACACC |
MSP, methylation-specific polymerase chain reaction; PCR, polymerase chain reaction; MF, methylated forward; MR, methylated reverse; UF, unmethylated forward; UR, unmethylated reverse; Tm, melting temperature; CDKN2B, cyclin-dependent kinase inhibitor 2B; SLC19A3, solute carrier family 19 member 3; DLEC1, deleted in lung and esophageal cancer 1.
Figure 1.
Representative results of sequencing validation and methylation-specific polymerase chain reaction. The top row of the sequence represents the original gene sequence, and the second row shows the converted sequences, both prior to and following chemotherapy. CDKN2B, cyclin-dependent kinase inhibitor 2B; SLC19A3, solute carrier family 19 member 3; DLEC1, deleted in lung and esophageal cancer 1; M, methylated; U, unmethylated.
Statistical analysis
Comparisons between CDKN2B, SLC19A3 and DLEC1 promoter methylation were performed using the correction formula of a χ2 test. Statistical analysis was performed using the SPSS statistical package version 16.0 (SPSS, Inc., Chicago, IL, USA) and GraphPad Prism 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA).
Results
Chemotherapy regimens of patients with AML
MSP was conducted on the pre- and post-chemotherapeutic tissue samples obtained from 15 patients with AML to determine whether chemotherapy induced promoter methylation changes in CDKN2B, SLC19A3 and DLEC1 genes. A total of 10 regimens were applied, including ATRA/ATO, DNR and ATRA, IA, CAG, HHT, HA, HAA, AA, DA, AD. These patients with AML consisted of two M1, seven M2, five M3, and one M4 subtypes (Table I). Among them, 4 patients (numbers 1, 4, 5 and 7) achieved remission and 2 patients (numbers 6 and 15) had a worse prognosis following chemotherapy, which was accompanied by changes in methylation (Table I).
Methylation and unmethylation primer sets were used to differentiate the methylation into full methylation (M/M), partial methylation (M/U) and unmethylation (U/U) statuses. In Table III, the methylation changes in different genes following chemotherapy, according to gender, are shown. For CDKN2B, 1 patient with subtype M2 AML (age 76 years, CAG regimen) changed from unmethylation to partial methylation; 1 patient with subtype M3 AML (age 23 years, treated with ATRA/ATO) changed from unmethylation to full methylation; 1 patient with subtype M1 AML (age 55 years, HAA regimen) and 1 patient with subtype M2 AML (age 66 years, IA regimen) changed from partial methylation to full methylation; and 1 patient with subtype M3 AML (age 59 years, HA regimen) changed from partial methylation to unmethylation. For DLEC1, one M1 patient (age 59 years, CAG regimen) changed from partial to full methylation.
Table III.
Alterations in the methylation status of various genes following chemotherapy by gender.
| Prior to primary chemotherapy | Following primary chemotherapy | ||||||
|---|---|---|---|---|---|---|---|
| Gene | Gender | M | U | M% | M | U | M% |
| CDKN2B | Females (n=8) | 8 | 0 | 100 | 8 | 0 | 100 |
| Males (n=7) | 5 | 2 | 71.43 | 6 | 1 | 85.71 | |
| SLC19A3 | Females (n=8) | 8 | 0 | 100 | 8 | 0 | 100 |
| Males (n=7) | 7 | 0 | 100 | 7 | 0 | 100 | |
| DLEC1 | Females (n=8) | 8 | 0 | 100 | 8 | 0 | 100 |
| Males (n=7) | 5 | 2 | 71.43 | 5 | 2 | 71.43 | |
M, methylated, including full (M/M) and partial (M/U) methylation; U, unmethylation; CDKN2B, cyclin-dependent kinase inhibitor 2B; SLC19A3, solute carrier family 19 member 3; DLEC1, deleted in lung and esophageal cancer 1.
Methylation changes of CDKN2B following chemotherapeutic treatments
Chemotherapy-induced changes in CDKN2B methylation status were only observed in males (Table IV). The patients with chemotherapy-induced CDKN2B methylation changes comprised two M3, two M2 and one M1 male cases. As shown in Table IV, the correlation between increased CDKN2B methylation and prognostic effect was inconsistent. Improved prognosis along with reduced CDKN2B methylation was observed in one M3 case (age 59 years, HA regimen). Conversely, improved prognostic effects along with increased CDKN2B methylation were also observed in one M3 patient (age 23 years, ATRA/ATO treatment regimen), one M2 patient (age, 66 years, IA treatment regimen) and one M1 patient (age 55 years, HAA treatment regimen). These results suggested a male-associated chemotherapy-induced hypermethylation of CDKN2B.
Table IV.
Association between gene hypermethylation and prognosis in patients with AML.
| Gene | Hypermethylation relieves AML | Hypermethylation accelerates AML or hypomethylation relieves AML | No association (n) |
|---|---|---|---|
| CDKN2B | |||
| Females (n=8) | 0 | 0 | 8 |
| Males (n=7) | No. 1: 23 years; M3; ATRA/ATO | No. 4: 59 years; M3; HA | |
| No. 5: 55 years; M1; HAA | No. 6: 76 years; M2a; CAG | 2 | |
| No. 7: 66 years; M2; IA | |||
| SLC19A3 | |||
| Females (n=8) | 0 | 0 | 8 |
| Males (n=7) | 0 | 0 | 7 |
| DLEC1 | |||
| Females (n=8) | 0 | No. 15: 59 years; M1; CAG | 7 |
| Males (n=7) | 0 | 0 | 7 |
Hypermethylation is a change from partial methylation to full methylation, or from unmethylation to partial or full methylation. Hypomethylation is a change from full methylation to partial methylation or unmethylation, or from partial methylation to unmethylation.
Patient number, age, AML subtype and chemotherapy regimen. AML, acute myeloid leukemia; CDKN2B, cyclin-dependent kinase inhibitor 2B; SLC19A3, solute carrier family 19 member 3; DLEC1, deleted in lung and esophageal cancer 1; ATRA, all-trans retinoic acid; ATO, arsenic trioxide; HA, homoharringtonine and cytarabine (Ara-C); HAA, homoharringtonine, Ara-C and aclarubicin; IA, idarubicin and Ara-C; CAG, Ara-C, aclarubicin and granulocyte colony-stimulating factor.
Methylation changes of SLC19A3 and DLEC1 following chemotherapeutic treatments
In addition, the present study identified a single female patient who presented adverse prognostic effects in addition to exhibiting DLEC1 hypermethylation (M1 patient, age 59 years, CAG treatment regimen; Table IV). Furthermore, the results demonstrated that the methylation status of SLC19A3 did not change in any patient following chemotherapy (Table IV).
Gene methylation changes and prognosis in AML patients
The present investigation demonstrated that CDKN2B hypermethylation may be specific to male patients with AML (Table III), and that DLEC1 hypermethylation in females with AML may result in a worse prognosis following primary chemotherapy (Table IV).
Discussion
The aim of the present study was to identify methylation biomarkers in order to guide individualized chemotherapy. The results of the present study revealed gender dimorphism in the chemotherapy-induced hypermethylation of CDKN2B and DLEC1. The chemotherapy-induced hypermethylation of DLEC1 may have resulted in the poor prognosis of AML in one of the female patients. Male-specific chemotherapy-induced hypermethylation of CDKN2B was also identified.
Resistance to drugs is one of the most pertinent aspects of treatment failure in cancers. Accumulating evidence suggests that aberrant DNA methylation is involved in the drug resistance of tumor cells and influences the prognosis of patients with AML (30,31). AML is complex and has numerous subtypes and differences among individuals, which makes it difficult to predict the therapeutic outcomes of treatments.
In the present study, three cancer-associated genes were selected in order to investigate the association of their methylation changes with treatment outcomes. These genes were CDKN2B, SLC19A3 and DLEC1. CDKN2B is a cyclin-dependent kinase inhibitor, located in a region that is frequently mutated or aberrantly methylated in a wide variety of tumors including leukemia (32). A previous study demonstrated that the expression of CDKN2B, which had previously been silenced by hypermethylation, was increased following treatment with decitabine in myelodysplastic syndromes (33). CDKN2B methylation decreased significantly in patients who achieved CR following a DAA (decitabine, aclacinomycin and Ara-C) treatment regimen, thereby demonstrating that decitabine may have a demethylation effect (34). SLC19A3 encodes the thiamine transporter expressed at the apical surface of polarized cells (35). SLC19A3 mRNA expression has been shown to be downregulated by DNA methylation in colon cancer cell lines (36). DLEC1 has been demonstrated to act as a tumor suppressor gene in the tumorigenesis and progression of numerous types of carcinoma, such as multiple lymphomagenesis, and thus it may serve as a non-invasive tumor marker (37). DLEC1 methylation has also shown the potential to serve as an independent marker of poor survival in squamous cell carcinoma lung cancer (38).
In conclusion, the results of the present study suggest that male-specific chemotherapy-induced hypermethylation occurs in the CDKN2B promoter. Female-specific chemotherapy-induced hypermethylation of the DLEC1 promoter may correlate with a worse prognostic outcome. These results also showed there were no methylation alterations in SLC19A3 following chemotherapy. Due to the complexity of AML and the variety of treatment regimens, that may be used further studies are required in a larger sample set in order to verify these preliminary results.
Acknowledgements
The present study was supported by grants from the National Natural Science Foundation of China (grant nos. 31100919 and 81371469), the Zhejiang Provincial Natural Science Foundation (grant no. LR13H020003), Ningbo City Medical Science and Technology Projects (grant no. 2014A20), and the K.C. Wong Magna Fund of Ningbo University.
References
- 1.Estey EH. Acute myeloid leukemia: 2013 update on risk-stratification and management. Am J Hematol. 2013;88:318–327. doi: 10.1002/ajh.23404. [DOI] [PubMed] [Google Scholar]
- 2.Davis AS, Viera AJ, Mead MD. Leukemia: An overview for primary care. Am Fam Physician. 2014;89:731–738. [PubMed] [Google Scholar]
- 3.Liu L, Zhang Y, Jin Z, Zhang X, Zhao G, Si Y, Lin G, Ma A, Sun Y, Wang L, Wu D. Increasing the dose of aclarubicin in low-dose cytarabine and aclarubicin in combination with granulocyte colony-stimulating factor (CAG regimen) can safely and effectively treat relapsed or refractory acute myeloid leukemia. Int J Hematol. 2014;99:603–608. doi: 10.1007/s12185-014-1528-8. [DOI] [PubMed] [Google Scholar]
- 4.Carlotti ME, Carpignano R, Gasco MR, Trotta M. Optimization of emulsions. Int J Cosmet Sci. 1991;13:209–219. doi: 10.1111/j.1467-2494.1991.tb00562.x. [DOI] [PubMed] [Google Scholar]
- 5.Wang J, Lü S, Yang J, Song X, Chen L, Huang C, Hou J, Zhang W. A homoharringtonine-based induction regimen for the treatment of elderly patients with acute myeloid leukemia: A single center experience from China. J Hematol Oncol. 2009;2:32. doi: 10.1186/1756-8722-2-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Jin J, Jiang DZ, Mai WY, Meng HT, Qian WB, Tong HY, Huang J, Mao LP, Tong Y, Wang L, et al. Homoharringtonine in combination with cytarabine and aclarubicin resulted in high complete remission rate after the first induction therapy in patients with de novo acute myeloid leukemia. Leukemia. 2006;20:1361–1367. doi: 10.1038/sj.leu.2404287. [DOI] [PubMed] [Google Scholar]
- 7.Lee YJ, Moon JH, Kim JG, Chae YS, Kang BW, Lee SJ, Choi JY, Shin HC, Seo JW, Sohn SK. Prospective randomization trial of G-CSF-primed induction regimen versus standard regimen in patients with AML. Chonnam Med J. 2011;47:80–84. doi: 10.4068/cmj.2011.47.2.80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Huang H, Qin Y, Xu R, You X, Teng R, Yang L, Xu M, Liu H. Combination therapy with arsenic trioxide, all-trans retinoic acid and chemotherapy in acute promyelocytic leukemia patients with various relapse risks. Leuk Res. 2012;36:841–845. doi: 10.1016/j.leukres.2012.03.027. [DOI] [PubMed] [Google Scholar]
- 9.Lo-Coco F, Hasan SK. Understanding the molecular pathogenesis of acute promyelocytic leukemia. Best Pract Res Clin Haematol. 2014;27:3–9. doi: 10.1016/j.beha.2014.04.006. [DOI] [PubMed] [Google Scholar]
- 10.Stirewalt DL, Pogosova-Agadjanyan EL, Tsuchiya K, Joaquin J, Meshinchi S. Copy-neutral loss of heterozygosity is prevalent and a late event in the pathogenesis of FLT3/ITD AML. Blood Cancer J. 2014;4:e208. doi: 10.1038/bcj.2014.27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Tao YF, Xu LX, Lu J, Cao L, Li ZH, Hu SY, Wang NN, Du XJ, Sun LC, Zhao WL, et al. Metallothionein III (MT3) is a putative tumor suppressor gene that is frequently inactivated in pediatric acute myeloid leukemia by promoter hypermethylation. J Transl Med. 2014;12:182. doi: 10.1186/1479-5876-12-182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Conway O'Brien E, Prideaux S, Chevassut T. The epigenetic landscape of acute myeloid leukemia. Adv Hematol. 2014;2014:103175. doi: 10.1155/2014/103175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Jiang D, Hong Q, Shen Y, Xu Y, Zhu H, Li Y, Xu C, Ouyang G, Duan S. The diagnostic value of DNA methylation in leukemia: A systematic review and meta-analysis. PLoS One. 2014;9:e96822. doi: 10.1371/journal.pone.0096822. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sonnet M, Claus R, Becker N, Zucknick M, Petersen J, Lipka DB, Oakes CC, Andrulis M, Lier A, Milsom MD, et al. Early aberrant DNA methylation events in a mouse model of acute myeloid leukemia. Genome Med. 2014;6:34. doi: 10.1186/gm551. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Pluta A, Nyman U, Joseph B, Robak T, Zhivotovsky B, Smolewski P. The role of p73 in hematological malignancies. Leukemia. 2006;20:757–766. doi: 10.1038/sj.leu.2404166. [DOI] [PubMed] [Google Scholar]
- 16.Esteller M. Profiling aberrant DNA methylation in hematologic neoplasms: A view from the tip of the iceberg. Clin Immunol. 2003;109:80–88. doi: 10.1016/S1521-6616(03)00208-0. [DOI] [PubMed] [Google Scholar]
- 17.Cancer Genome Atlas Research Network: Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N Engl J Med. 2013;368:2059–2074. doi: 10.1056/NEJMoa1301689. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Tao YF, Ni J, Lu J, Wang N, Xiao PF, Zhao WL, Wu D, Pang L, Wang J, Feng X, Pan J. The promoter of miR-663 is hypermethylated in Chinese pediatric acute myeloid leukemia (AML) BMC Med Genet. 2013;14:74. doi: 10.1186/1471-2350-14-74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Baylin SB, Jones PA. A decade of exploring the cancer epigenome-biological and translational implications. Nat Rev Cancer. 2011;11:726–734. doi: 10.1038/nrc3130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Leone G, Voso MT, Teofili L, Lübbert M. Inhibitors of DNA methylation in the treatment of hematological malignancies and MDS. Clin Immunol. 2003;109:89–102. doi: 10.1016/S1521-6616(03)00207-9. [DOI] [PubMed] [Google Scholar]
- 21.Liu X, Lam EK, Wang X, Zhang J, Cheng YY, Lam YW, Ng EK, Yu J, Chan FK, Jin H, Sung JJ. Promoter hypermethylation mediates downregulation of thiamine receptor SLC19A3 in gastric cancer. Tumour Biol. 2009;30:242–248. doi: 10.1159/000243767. [DOI] [PubMed] [Google Scholar]
- 22.Kwong J, Lee JY, Wong KK, Zhou X, Wong DT, Lo KW, Welch WR, Berkowitz RS, Mok SC. Candidate tumor-suppressor gene DLEC1 is frequently downregulated by promoter hypermethylation and histone hypoacetylation in human epithelial ovarian cancer. Neoplasia. 2006;8:268–278. doi: 10.1593/neo.05502. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Walter RB, Othus M, Burnett AK, Löwenberg B, Kantarjian HM, Ossenkoppele GJ, Hills RK, van Montfort KG, Ravandi F, et al. Significance of FAB subclassification of ‘acute myeloid leukemia, NOS’ in the 2008 WHO classification: Analysis of 5848 newly diagnosed patients. Blood. 2013;121:2424–2431. doi: 10.1182/blood-2012-10-462440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Fasan A, Alpermann T, Haferlach C, Grossmann V, Roller A, Kohlmann A, Eder C, Kern W, Haferlach T, Schnittger S. Frequency and prognostic impact of CEBPA proximal, distal and core promoter methylation in normal karyotype AML: A study on 623 cases. PLoS One. 2013;8:e54365. doi: 10.1371/journal.pone.0054365. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Marzese DM, Huang SK, Hoon DS. In situ sodium bisulfite modification of genomic DNA from microdissected melanoma paraffin-embedded archival tissues. Methods Mol Biol. 2015 Dec 13; doi: 10.1007/7651_2015_303. (Epub ahead of print) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Chen C, Wang L, Liao Q, Huang Y, Ye H, Chen F, Xu L, Ye M, Duan S. Hypermethylation of EDNRB promoter contributes to the risk of colorectal cancer. Diagn Pathol. 2013;8:199. doi: 10.1186/1746-1596-8-199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Vidal DO, Paixão VA, Brait M, Souto EX, Caballero OL, Lopes LF, Vettore AL. Aberrant methylation in pediatric myelodysplastic syndrome. Leuk Res. 2007;31:175–181. doi: 10.1016/j.leukres.2006.06.013. [DOI] [PubMed] [Google Scholar]
- 28.Zhang L, Shi J, Xu L, Shi B, Hou P, Ji M. Aberrant DNA methylation of drug metabolism and transport genes in nodular goiter. Thyroid Res. 2011;4:15. doi: 10.1186/1756-6614-4-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Qu X, Jiang N, Xu F, Shao L, Tang G, Wilkinson B, Liu W. Cloning, sequencing and characterization of the biosynthetic gene cluster of sanglifehrin A, a potent cyclophilin inhibitor. Molecular Biosyst. 2011;7:852–861. doi: 10.1039/C0MB00234H. [DOI] [PubMed] [Google Scholar]
- 30.Moreira MA, Bagni C, de Pinho MB, Mac-Cormick TM, dos Santos Mota M, Pinto-Silva FE, Daflon-Yunes N, Rumjanek VM. Changes in gene expression profile in two multidrug resistant cell lines derived from a same drug sensitive cell line. Leuk Res. 2014;38:983–987. doi: 10.1016/j.leukres.2014.06.001. [DOI] [PubMed] [Google Scholar]
- 31.Si XX, Sun YJ. Aberrant DNA methylation and drug resistance of tumor cells. Yi Chuan. 2014;36:411–419. (In Chinese) [PubMed] [Google Scholar]
- 32.Li J, Bi L, Lin Y, Lu Z, Hou G. Clinicopathological significance and potential drug target of p15INK4B in multiple myeloma. Drug Des Devel Ther. 2014;8:2129–2136. doi: 10.2147/DDDT.S71088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Santos FP, Kantarjian H, Garcia-Manero G, Issa JP, Ravandi F. Decitabine in the treatment of myelodysplastic syndromes. Expert Rev Anticancer Ther. 2010;10:9–22. doi: 10.1586/era.09.164. [DOI] [PubMed] [Google Scholar]
- 34.Song LX, Xu L, Li X, Chang CK, Zhang Y, Wu LY, He Q, Zhang QX, Li X. Clinical outcome of treatment with a combined regimen of decitabine and aclacinomycin/cytarabine for patients with refractory acute myeloid leukemia. Ann Hematol. 2012;91:1879–1886. doi: 10.1007/s00277-012-1550-y. [DOI] [PubMed] [Google Scholar]
- 35.Subramanian VS, Marchant JS, Said HM. Biotin-responsive basal ganglia disease-linked mutations inhibit thiamine transport via hTHTR2: Biotin is not a substrate for hTHTR2. Am J Physiol Cell Physiol. 2006;291:C851–C859. doi: 10.1152/ajpcell.00105.2006. [DOI] [PubMed] [Google Scholar]
- 36.Ikehata M, Ueda K, Iwakawa S. Different involvement of DNA methylation and histone deacetylation in the expression of solute-carrier transporters in 4 colon cancer cell lines. Biol Pharm Bull. 2012;35:301–307. doi: 10.1248/bpb.35.301. [DOI] [PubMed] [Google Scholar]
- 37.Wang Z, Li L, Su X, Gao Z, Srivastava G, Murray PG, Ambinder R, Tao Q. Epigenetic silencing of the 3p22 tumor suppressor DLEC1 by promoter CpG methylation in non-Hodgkin and Hodgkin lymphomas. J Transl Med. 2012;10:209. doi: 10.1186/1479-5876-10-209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Seng TJ, Currey N, Cooper WA, Lee CS, Chan C, Horvath L, Sutherland RL, Kennedy C, McCaughan B, Kohonen-Corish MR. DLEC1 and MLH1 promoter methylation are associated with poor prognosis in non-small cell lung carcinoma. Br J Cancer. 2008;2:375–82. doi: 10.1038/sj.bjc.6604452. [DOI] [PMC free article] [PubMed] [Google Scholar]