Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 May 15.
Published in final edited form as: Methods. 2015 Oct 23;101:36–42. doi: 10.1016/j.ymeth.2015.10.014

Controlling transcription in human pluripotent stem cells using CRISPR-effectors

Ryan M Genga a, Nicola A Kearns a, René Maehr a
PMCID: PMC4842159  NIHMSID: NIHMS733183  PMID: 26525193

Abstract

The ability to manipulate transcription in human pluripotent stem cells (hPSCs) is fundamental for the discovery of key genes and mechanisms governing cellular state and differentiation. Recently developed CRISPR-effector systems provide a systematic approach to rapidly test gene function in mammalian cells, including hPSCs. In this review, we discuss recent advances in CRISPR-effector technologies that have been employed to control transcription through gene activation, gene repression, and epigenome engineering. We describe an application of CRISPR-effector mediated transcriptional regulation in hPSCs by targeting a synthetic promoter driving a GFP transgene, demonstrating the ease and effectiveness of CRISPR-effector mediated transcriptional regulation in hPSCs.

Keywords: Human pluripotent stem cells, CRISPR, Cas9, transcriptional regulation, dCas9-effectors

1. Introduction / Review

1.1 Human pluripotent stem cells

Deciphering human development and disease requires knowledge of the mechanisms regulating cellular differentiation and function. Human pluripotent stem cells (hPSCs) have the ability to self-renew in vitro and the potential to differentiate into any cell type of the body. These properties make hPSCs an effective model system to study factors and mechanisms governing the development of specific cell lineages and their impact on disease onset and progression. The ability to control transcription of specific genes in hPSCs allows for interrogation of the key factors necessary to maintain a given cellular state or drive cellular differentiation. Recently developed CRISPR (clustered regularly interspaced short palindromic repeats)-associated (Cas) systems have been adapted to regulate gene expression. These versatile systems allow rapid examination of gene function in human cells and have the potential to allow high-throughput analyses of either gene activation or repression in hPSCs and their differentiation intermediates.

1.2 CRISPR/Cas9-effector system

CRISPR systems are RNA-guided bacterial adaptive immune responses that detect and silence foreign DNA [1–4]. These systems involve recruitment and binding of a CRISPR-associated endonuclease to a specific target DNA sequence via a trans-activating CRISPR RNA (tracrRNA) and a CRISPR-derived RNA (crRNA). The protospacer, a sequence element of the crRNA, confers site-specificity through complementary base pairing, ensuring proper targeting to foreign DNA. The endonuclease then introduces double strand breaks in the target sequence [2, 3, 5].

The type II CRISPR system has been adapted as a tool for gene editing in mammalian systems. Combination of the tracrRNA and crRNA elements into one chimeric single guide RNA (sgRNA) can efficiently target Cas9 to specific DNA target sites [5–7]. This two component system (Cas9 and sgRNA) has been used to introduce double strand breaks in order to generate disease-relevant mutations or to insert donor sequences at target sites through homologous recombination [6, 7]. In addition, CRISPR nucleases have successfully down-regulated target gene expression by introducing mutations or excising an enhancer [8, 9]. However, nuclease-mediated modifications are irreversible, may require in depth knowledge of the element, can be inefficient because gene disruption relies on indel introduction caused by non-homologous end joining repair errors, may disrupt local genomic architecture, and are not adaptable for gain-of-function approaches.

To adapt CRISPR/Cas9 for gene regulation studies, the nuclease activity of Cas9 has been inactivated through mutation of catalytic residues within its nuclease domains, resulting in a nuclease dead Cas9 (dCas9) [5, 10]. Coupling dCas9 to effector domains converts the CRISPR/Cas9 technology into a site-specific programmable system, which through fused effector domains can regulate gene expression (Figure 1) [11–19]. This versatile system of transcriptional control allows for characterization of the key factors and mechanisms governing a given cellular state. The ability to multiplex sgRNAs allows for synergistic effects on gene expression and permits targeting of multiple genes simultaneously [11, 12, 14, 16, 20]. In addition, the possibility of inducing dCas9-effector or sgRNA expression may allow for temporal and spatial manipulation of gene function. When applied to hPSCs, CRISPR/dCas9-effector systems can be used to influence cellular states of differentiation intermediates and can help to dissect the individual contribution of factors to development and disease.

Figure 1. CRISPR/Cas9 effector-mediated transcriptional control.

Figure 1

(A) Schematic depicting dCas9-effector mediated transcriptional regulation through fusion of dCas9 to transcriptional activation or repression effector domains. (B) Schematic depicting dCas9-effector mediated transcriptional regulation through recruitment of multiple antibody-fused effector domains to a dCas9-fused epitope array. (C) Schematic depicting dCas9-effector mediated transcriptional regulation through recruitment of MS2-effector fusion proteins to tethered copies of the MS2 bacteriophage coat protein-binding RNA stem loop on the 3’-end of an sgRNA. (D) Schematic depicting dCas9-effector mediated transcriptional regulation through scaffolding of a functional RNA module (such as an aptamer or lncRNA) to an sgRNA. (E) Schematic depicting dCas9-effector mediated transcriptional regulation through fusion of dCas9 to epigenetic modifiers to alter local epigenetic marks.

1.3 dCas9-effector mediated transcriptional activation

dCas9/sgRNA complexes can be modified to activate gene expression in mammalian systems when targeted upstream of endogenous transcriptional start sites. Fusion of dCas9 to the p65 activation domain or to tandem repeats of the herpes simplex virus trans-activation domain VP16 (VP48, VP64, VP160, VP192) has been shown to activate endogenous gene expression [11, 14]. In a subsequent study, fusion of dCas9 to the tripartite activator VP64-p65-Rta (VPR) resulted in higher levels of gene activation compared to VP64 fusion alone [21]. The CRISPR/dCas9 system has also been adapted in other ways for site-specific transcriptional activation. dCas9 fused to the single-chain antibody binding SunTag allowed for multimerization of antibody-fused VP64 domains, amplifying gene expression compared to dCas9-VP64 [19]. Tethering copies of the MS2 bacteriophage coat protein-binding RNA stem loop to the 3’-end of a sgRNA activated gene expression when coexpressed with MS2-VP64 fusion proteins and dCas9 [20]. More recently, using CRISP-Disp, RNA domains are combined with sgRNA scaffolds, enabling site-specific recruitment of functional RNA modules, including natural lncRNAs such as HOTTIP, which subsequently mediate gene regulation [22]. All of these adapted dCas9 systems can effectively increase expression of target genes highlighting their potential use in gain-of-function studies.

Recruitment of transcriptional activation domains to endogenous loci in hPSCs and differentiation intermediates may be used to interrogate the effect of gene expression on cellular state. dCas9-effector mediated transcriptional activation has been demonstrated in hPSC systems in order to induce expression of endogenous genes and alter cell fate. Targeting dCas9-VP64 to the promoter of the developmentally relevant transcription factor SOX17 induced its RNA and protein expression in hPSCs [16]. Recruitment of dCas9-VPR to NGN2 or NEUROD1 induced neuronal differentiation, suggesting the potential use of the system to modify cell fate through gene activation [21]. The ability to activate expression of endogenous genes with CRISPR-effector systems may also prove beneficial for imposing cell fate through activation of transcription factor expression. Targeting of dCas9 fused to two VP64 domains to the MyoD1 locus of mouse primary fibroblasts activated endogenous myogenic genes comparably to traditional MyoD1 overexpression methods, resulting in the conversion of fibroblasts into skeletal myocytes [23]. dCas9-VP64 can replace exogenous Oct4 (Pou5f1) during reprogramming of mouse embryonic fibroblasts to induced pluripotent stem cells (iPSCs) by targeting the Oct4 distal enhancer albeit at lower frequency than with a transcription activator-like effector (TALE) fused to VP64 [24]. In a recent study, dCas9-VP192 has replaced transgenic OCT4 in reprogramming of human primary fibroblasts to iPSCs. Furthermore, dCas9-VP192 simultaneously targeted to SOX17, FOXA2, PDX1, and NKX6.1 improved directed differentiation to pancreatic progenitor-like cells and activated downstream endogenous gene expression [25].

1.4 dCas9-effector mediated transcriptional repression

CRISPR-mediated transcriptional repression can occur when dCas9 is targeted to specific genomic sites resulting in steric hindrance of polymerase recruitment and transcriptional elongation [10]. In order to achieve higher levels of gene repression, fusion of dCas9 to various effector domains has been implemented. Repressor domains include the mSin interaction domain (SID) and the Krueppel repressor associated box (KRAB), which recruit repressive complexes in order to silence gene expression [26–28]. It has been demonstrated in mammalian cells that both dCas9-KRAB and dCas9-SID can be targeted to endogenous loci and effectively repress gene expression [15, 16, 18].

Systems to repress gene function are crucial for dissecting the individual contribution of factors that maintain a given cellular state. CRISPR-effector mediated transcriptional repression has been used in PSCs to probe the pluripotency network required to maintain the stem cell state [16, 18]. Targeting the OCT4 promoter region with dCas9-KRAB resulted in decreased OCT4 expression and spontaneous differentiation of cells due to disruption of this key gene of the pluripotency network [16]. Similarly, targeting of regions upstream of the transcriptional start sites of Oct4 and another pluripotency factor, Tbx3, using dCas9-KRAB in mouse embryonic stem cells (mESCs) effectively repressed their expression, resulting in spontaneous differentiation [18]. Through CRISPR/dCas9-effector fusion mediated transcriptional repression of pluripotency factors, these studies demonstrate the capability of the system to dissect the contribution of specific genes to a given cellular state. In future work, dCas9-effector fusions will likely be instrumental to understanding the gene regulatory networks of differentiation intermediates and ultimately the signals that maintain a cellular state.

1.5 dCas9-effector mediated epigenome engineering

Recently, fusion of dCas9 to various epigenetic modifiers has proven an effective tool to specifically target genomic sequences and modify local histone marks in order to study their effect on gene expression [17, 18]. This tool is useful in determining the individual contribution of genetic elements, such as enhancers, to target gene expression. Fusion of dCas9 to the catalytic core of the transcription activator acetyltransferase p300 (dCas9-p300CORE) has been demonstrated to activate genes in human cells. When compared to dCas9-VP64, the dCas9-p300CORE leads to higher levels of gene activation when targeting either promoter or enhancer regions of endogenous genes, including IL1RN, MYOD and OCT4. Importantly, a dCas9 fused with an inactive form of p300 was unable to activate target genes, indicating a crucial role of acetyltransferase activity for gene activation [17].

dCas9-effector mediated epigenetic engineering has been used as a tool to determine the individual contribution of genetic elements to gene expression. Fusion of dCas9 to the histone demethylase LSD1 (KDM1A), known to catalyze demethylation of H3K4 mono- and di-methylation [29], reduces endogenous gene expression in mESCs when specifically targeted to active enhancer regions of known pluripotency-associated genes, Oct4 and Tbx3. Targeting LSD1 to the Tbx3 enhancer led to loss of H3K4me2 and H3K27ac specifically at the enhancer region and caused spontaneous differentiation of mESCs [18]. These studies highlight the important role of individual enhancer elements in transcriptional regulation and suggest that dCas9-effector mediated epigenetic engineering can be used to functionally annotate genetic elements of a given cellular state. In the future, this technology may also prove useful in regulating transcription of target genes through DNA methylation or demethylation as has been demonstrated with TALE-effectors (TALE-DNMTs and TALE-TET1) [30, 31].

1.6 An example of dCas9-KRAB mediated transcriptional repression in hPSCs

Application of dCas9-effector systems to hPSCs allows elucidation of the key genes and mechanisms governing a cellular state. Here, we describe an example to interrogate gene function with a dCas9-KRAB fusion in hPSCs. Through targeting of a knockin minigene, this study examines the timing and degree of dCas9-KRAB mediated gene repression in hPSCs. An eGFP reporter construct was introduced into the AAVS1 locus of H1 hPSCs via zinc finger nuclease augmented gene targeting, resulting in H1 CAG-GFP hPSCs which constitutively express GFP driven by CAG (hybrid of cytomegalovirus immediate early enhancer, chicken β-actin promoter and intron, rabbit β-globin splice acceptor). A doxycycline-inducible dCas9-KRAB (TRE-dCas9-KRAB) from the Streptococcus pyogenes (Sp) system [16] was stably transduced into H1 CAG-GFP hPSCs. Following viral transduction of individual site-specific sgRNAs and doxycycline treatment, dCas9-KRAB was targeted to the CAG promoter and GFP expression was reduced over time. Reduction of GFP expression to baseline wild type H1 hPSC levels was observed in a subset of H1 CAG-GFP cells. This study highlights the kinetics and extent of dCas9-KRAB repression on gene expression in the hPSC system.

2. Materials and methods

2.1 Maintenance of human pluripotent stem cells

H1 and H1 CAG-GFP hPSCs were maintained in mTeSR1 (Stem Cell Technologies, 05850) on Matrigel (Corning, 354277) coated plates. Cells were fed daily and split with TrypLE Express (Gibco, 12604) every 3–4 days in mTeSR1 supplemented with 10 µM Y-27632 (Selleck Chemicals, S1049).

2.2 Generation of H1 CAG-GFP hPSCs

24 hours prior to electroporation, H1 hPSCs were treated with 10 µM Y-27632. On the day of electroporation, cells were split to single cells with TrypLE Express. 10 × 106 H1 hPSCs were resuspended in 800 µL EmbryoMax electroporation buffer (Millipore, ES-003-D) and incubated with 40 µg CAG-GFP plasmid (Addgene plasmid #22212)+ 10 µg zinc finger nuclease plasmid (targeting the AAVS1 locus, sequences obtained from [32]) for 5 min at 4C. Cells were electroporated at 250 V, 500 µF and plated onto puromycin-resistant MEFs in hESC media (KnockOUT DMEM supplemented with 20% KnockOUT Serum Replacement, 1× Glutamax, 1× MEM NEAA, 55 µM β-ME, 10 ng/mL bFGF) and 10 µM Y-27632. 48 hours after electroporation, cells were treated with 0.5 µg/mL puromycin (Sigma-Aldrich) daily in order to select for cells that stably integrated the CAG-GFP construct. 11–14 days following the start of selection, surviving clones were monitored for GFP expression and picked onto Matrigel-coated plates. Site-specific integration was confirmed by PCR using the following primer sequences (forward primer: GCTCTACTGGCTTCTGCG; reverse primer: AGAAGACTTCCTCTGCC). One correctly integrated clone was expanded into the H1 CAG-GFP hPSC line used in this study.

2.3 sgRNA and plasmid design

sgRNA in silico design was performed as previously described [16], candidate sgRNAs were identified by searching for (N)19–21NGG motifs in the CAG promoter. sgRNAs were then cloned into the pLenti U6 Sp sgRNA BsmBI hygro cloning vector (Addgene plasmid #62205) to generate sgRNA lentiviral expression constructs. sgRNA target sequences are listed in table 1 and the protospacer adjacent motif (PAM) is underlined. Tips for sgRNA design can be found in the troubleshooting section.

Table 1.

CAG-specific sgRNA target sequences

sgRNA Target sequence (PAM underlined)
A ctccgaaagtttccttttatgg
B tataaaaagcgaagcgcgcggcgg
C cgttactcccacaggtgagcgg
D tgaaagccttgaggggctccgg

2.4 Lentivirus production

Lentivirus was produced in HEK293T/17 cells (ATCC, CRL-11268). Briefly, pHAGE TRE-dCas9-KRAB (Addgene #50917), or sgRNA coding plasmids were transfected with 3rd generation lentiviral packaging plasmids using TransIT-293 transfection reagent (Mirus, 2700) in Opti-MEM (Gibco, 31985) according to the manufacturer’s instructions. Virus was harvested 48 hours after transfection.

2.5 Generation of stable H1 CAG-GFP TRE-dCas9-KRAB cell line

H1 CAG-GFP hPSCs were split to single cells with TrypLE Express and incubated with TRE-dCas9-KRAB lentivirus for 3 hours in a low attachment plate. Transduced cells were then plated onto Matrigel-coated plates in mTeSR1 supplemented with 10 µM Y-27632. 48 hours after transduction, cells were treated with 50 µg/ml G418 (Gibco, 10131) in order to select for cells that were transduced with TRE-dCas9-KRAB. Following 6 days of selection, the resulting pool of G418-resistant cells were maintained on Matrigel-coated plates in mTeSR1 supplemented with 50 µg/ml G418 and were split with TrypLE Express every 3–4 days.

2.6 Transduction of cells with CAG-specific sgRNA lentivirus

H1 CAG-GFP TRE-dCas9-KRAB hPSCs were split to single cells with TrypLE Express and incubated with CAG-specific sgRNA lentivirus for 3 hours in a low attachment plate. Transduced cells were then plated onto Matrigel-coated plates in mTeSR1 supplemented with 10 µM Y-27632 and 50 µg/ml G418. 48 hours after transduction, cells were treated with 25 µg/ml hygromycin B (Invitrogen, 10687010) in order to select for cells that were transduced with CAG-specific sgRNAs. Following 3 days of selection through completion of the experiment, the media was additionally supplemented with 2 µg/ml doxycycline. The media was changed daily and the cells were split with TrypLE Express every 4 days. Cells were monitored for GFP expression daily.

2.7 Immunofluorescence

Cells were fixed with 4% paraformaldehyde for 30 min at room temperature and then incubated with 5% donkey serum (Jackson ImmunoResearch, 017-000-121) in PBS supplemented with 0.2% Triton X-100 (PBST) for 1 hour at room temperature. Cells were washed 3 times with PBST for 5 min. Hoechst (Invitrogen, H3570) was used for nuclei staining. Fluorescence images were obtained on a Nikon Eclipse Ti microscope.

2.8 Flow cytometry

H1 and H1 CAG-GFP TRE-dCas9-KRAB cells were dissociated to single cells with TrypLE Express, centrifuged at 300 × g for 5 min, and resuspended in flow cytometry staining buffer (PBS + 2% FBS). Data were collected on a BD Accuri C6 flow cytometer daily throughout the time-course and analyzed using FlowJo version 10. Dead cells were excluded from analysis with 7-AAD Viability Staining Solution (eBioscience, 00-6993-50).

3. Results and Discussion

3.1 Constitutive GFP expression in H1 CAG-GFP hPSCs

Using a zinc finger nuclease targeting method, a CAG promoter driving GFP expression was introduced into the AAVS1 locus of H1 hPSCs as described previously (Figure 2A) [32]. AAVS1 is a ‘safe-harbor’ locus in human cells that has an open chromatin structure enabling site-specific integration of the CAG-GFP construct [32, 33]. The CAG-GFP targeting vector included a puromycin-resistance cassette, allowing for selection of targeted clones. Following puromycin selection, GFP positive hPSC colonies were picked and site-specific integration was confirmed by PCR. One clone was expanded into the H1 CAG-GFP hPSC line, maintaining hPSC colony morphology and constitutively expressing GFP (Figure 2B).

Figure 2. dCas9-KRAB-mediated repression of GFP in H1 CAG-GFP hPSCs.

Figure 2

(A) Reporter construct inserted into the AAVS1 locus of H1 hPSCs via zinc finger nuclease gene editing. GFP expression is driven by a CAG (CMV-IE, chicken actin, rabbit beta globin) promoter. Target locations of CAG-specific sgRNAs (A, B, C, and D) and the transcriptional start site (TSS) are indicated. (B) Representative phase contrast and fluorescence images of H1 CAG-GFP cells demonstrating that the targeted cells maintain hPSC morphology and constitutively express GFP. Scale bar = 500 µm (C) Schematic of doxycycline-inducible dCas9-KRAB and CAG-specific sgRNA lentiviral constructs. rtTA expression is constitutively driven by the Ubiquitin C promoter (UbiC) which binds the Tet-responsive element (TRE) in the presence of doxycycline in order to activate dCas9-KRAB expression. CAG-specific sgRNA expression is constitutively driven by the U6 promoter. (D) Fluorescence and (E) flow cytometry analysis of H1 CAG-GFP cells transduced with a CAG-specific sgRNA demonstrating reduced GFP expression in an sgRNA-dependent manner following 9 days of doxycycline treatment. Scale bar = 100 µm. (F) Flow cytometry analysis of H1 CAG-GFP cells mixed with H1 cells (blue) indicating baseline fluorescence levels of both populations. Flow cytometry analysis of H1 CAG-GFP cells transduced with CAG-specific sgRNA C (green) prior to doxycycline treatment (Day 0) and acquired daily following doxycycline treatment (Day 1–Day 10). The percentage of the subset of cells that are losing GFP expression (%GFP negative) is indicated in the upper left of each time-point panel.

3.2 dCas9-KRAB-mediated transcriptional repression of GFP in H1 CAG-GFP hPSCs

Using the H1 CAG-GFP hPSCs, we sought to determine if dCas9-KRAB could effectively repress expression of the constitutive GFP transgene. In order to temporally control dCas9-KRAB expression, we virally introduced a doxycycline-inducible dCas9-KRAB harboring a neomycin-resistance cassette into H1 CAG-GFP cells (Figure 2C) and selected with G418 for cells that were stably transduced. In order to determine whether recruitment of dCas9-KRAB to the CAG promoter could reduce GFP expression, we individually transduced four different CAG-specific sgRNAs that target regions of the CAG promoter (Figure 2A). Through the presence of a hygromycin-resistance cassette in the sgRNA constructs, we were able to select for cells that were transduced with sgRNA virus by treating with hygromycin B.

Doxycycline was supplemented daily in order to induce dCas9-KRAB expression in the cells. After 9 days of doxycycline and selection reagent treatment, fluorescence analysis revealed reduction in the GFP expression of a subset of H1 CAG-GFP cells transduced with sgRNA C and to a lesser extent with sgRNAs A, B, and D as compared to the no sgRNA control condition (Figure 2D). The differing effect observed with each sgRNA is likely due to the lack of clonality in our transduced pools of cells, resulting in heterogeneous expression of both the sgRNA and dCas9-KRAB. Flow cytometry analysis at day 9 revealed reduced GFP fluorescence levels in a subset of H1 CAG-GFP cells when transduced with each sgRNA as compared to GFP levels of the no guide control condition (Figure 2E). sgRNAs A, B, and D have stretches of the same nucleotide in their sequences which may also contribute to the differing abilities of each sgRNA to repress GFP (see section 4. Troubleshooting for sgRNA design tips).

To determine baseline GFP levels in both wildtype H1 and H1 CAG-GFP hPSCs, we co-cultured wild type H1 cells mixed with H1 CAG-GFP cells before analyzing for GFP expression by flow cytometry (Figure 2F, blue histogram). This mixture of cells shows two distinct populations, allowing us to set reference points for GFP positive and GFP negative populations in subsequent experiments.

We next sought to determine the kinetics and extent of dCas9-KRAB mediated GFP repression. We performed a representative time-course of dCas9-KRAB mediated GFP repression with sgRNA C, where reduction in GFP expression levels was analyzed daily by flow cytometry (Figure 2F, green histograms). H1 CAG-GFP TRE-dCas9-KRAB cells were transduced with sgRNA C and GFP fluorescence levels were analyzed daily following the start of doxycycline treatment. GFP levels were reduced in a subset of cells by day 3 compared to the no sgRNA guide control, and continued to decrease toward the GFP negative reference point daily. GFP levels decreased to the GFP negative reference point by day 10, indicating the ability of the system to completely repress GFP in a subset of cells. As we are repressing transcription of the CAG-GFP transgene, reduction in GFP expression levels is limited by the stable half-life of the GFP protein, which may explain the gradual decrease in GFP levels [34, 35]. It is likely that protein reduction may occur faster when repressing genes that encode less stable proteins. Using this platform, we have demonstrated that targeting a transgene expressed in hPSCs with dCas9-KRAB can reduce target protein to baseline levels and established a time-course for dCas9-KRAB to achieve complete repression as measured by protein levels.

3.3 Summary

CRISPR-effector systems provide the ability to manipulate gene expression in hPSCs and thereby study gene function. We demonstrate that dCas9-KRAB can completely repress gene expression in H1 CAG-GFP hPSCs. The ability to influence gene expression in a given cellular state will provide vital information on signals and factors necessary to maintain or transition from that state. The CRISPR-effector system provides a highly rapid and versatile tool to dissect the cell regulatory networks crucial for cell fate decisions. When applied to hPSC differentiation studies, these systems of transcriptional control will be instrumental in determining the key genes linked to cellular state and those that enable differentiation toward clinically-relevant, mature cell types.

4. Troubleshooting

4.1 sgRNA design

An sgRNA for the Sp system contains both a 20-nucleotide DNA targeting sequence and a Cas9 recruiting sequence. The DNA targeting sequence consists of the 20 nucleotides immediately 5’ to the genomic PAM sequence (NGG). While studies examining the effects of sgRNA design on dCas9-effector activity are limited, recent studies using Sp Cas9 nuclease have determined more optimal sgRNA design parameters for CRISPR-mediated gene inactivation through screening of sgRNA pools at endogenous loci [36–38]. These studies highlight sequence features of the sgRNA and the targeted DNA that may be beneficial for sgRNA activity. First, cytosine is preferred as the variable nucleotide of the PAM sequence (CGG) [37, 38]. Guanine is preferable as the nucleotide immediately adjacent to the PAM (GNGG) [36, 37]. Avoid sgRNAs with high or low GC-content; GC-content between 40–80% is desirable [36]. Also avoid long stretches of the same nucleotide in sgRNA sequences as these may trigger RNA polymerase termination and result in disrupted transcription of the sgRNA in your system [36, 37]. Publically available software can help to design optimal sgRNA molecules, including sgRNA scorer 1.0 (crispr.med.harvard.edu/sgRNAScorer [38]) and the Broad sgRNA Designer (broadinstitute.org/rnai/public/analysis-tools/sgrna-design [37]).

Off-target genomic sequences should be examined and sgRNA molecules with high off-targeting potential should also be avoided. In order to increase specificity of the system, make sure that off-target genomic sequences are not followed by a PAM [39]. Maximize nucleotide mismatches within off-targets, avoiding sgRNA sequences that have off-target sequences with less than three mismatches and stretches of mismatches are preferred [39]. Publically available software can predict off-target sequences and calculate mismatches between sgRNAs and off-targets, including the MIT CRISPR design tool (crispr.mit.edu [39]).

4.2 Using other dCas9-effectors in the hPSC system

dCas9-effectors can be employed for transcriptional regulation in hPSCs as exemplified here through dCas9-KRAB mediated transcriptional repression, however alternative mechanisms of gene regulation can easily be achieved by utilizing dCas9 fused to alternative effectors. Many Sp dCas9-effector systems are available through principal investigators or from Addgene. We have previously demonstrated the ability of a dCas9-VP64 fusion to activate expression of SOX17 in hPSCs [16] and others have used dCas9-VP192 to activate developmentally relevant genes in hPSCs and during differentiation [25]. These studies highlight the potential use of various dCas9-effector fusions in hPSCs. Using a variety of dCas9-effector fusions in the hPSC system will be a powerful tool for probing various cell states and altering cell fate during cellular differentiation.

Highlights.

  • Applications of CRISPR-effector technology in mammalian cells and hPSCs is reviewed

  • Effect of dCas9-KRAB on model locus in hPSC is investigated

  • Time course of dCas9-KRAB mediated repression of GFP transgene in hPSCs is provided

Acknowledgements

We are indebted to Dr. S. Wolfe and Dr. M. Garber for discussions and help with sgRNA design. We are grateful to L. Atehortua and M. Enuamah for technical help. R.M. is supported by The Leona M. and Harry B. Helmsley Charitable Trust (2012PG-T1D026 and 2015PG-T1D035), a Charles H. Hood Foundation Child Health Research Award, and the Glass Family Charitable Foundation. This study was supported by NIH grants 1R56AI114525 and 1R21AI119885 to R.M.

Abbreviations

CAG

hybrid of cytomegalovirus immediate early enhancer, chicken β-actin promoter and intron, rabbit β-globin splice acceptor

Cas

CRISPR-associated

CRISPR

clustered regularly interspaced short palindromic repeats

crRNA

CRISPR-derived RNA

dCas9

nuclease-dead Cas9

hPSC

human pluripotent stem cell

KRAB

Krueppel repressor associated box

mESC

mouse embryonic stem cell

PAM

protospacer adjacent motif

sgRNA

single guide RNA

Sp

Streptococcus pyogenes

tracrRNA

trans-activating CRISPR RNA

TALE

transcription activator-like effector

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Horvath P, Barrangou R. CRISPR/Cas, the immune system of bacteria and archaea. Science. 2010;327:167–170. doi: 10.1126/science.1179555. [DOI] [PubMed] [Google Scholar]
  • 2.Bhaya D, Davison M, Barrangou R. CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation. Annu Rev Genet. 2011;45:273–297. doi: 10.1146/annurev-genet-110410-132430. [DOI] [PubMed] [Google Scholar]
  • 3.Wiedenheft B, Sternberg SH, Doudna JA. RNA-guided genetic silencing systems in bacteria and archaea. Nature. 2012;482:331–338. doi: 10.1038/nature10886. [DOI] [PubMed] [Google Scholar]
  • 4.Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P. CRISPR provides acquired resistance against viruses in prokaryotes. Science. 2007;315:1709–1712. doi: 10.1126/science.1138140. [DOI] [PubMed] [Google Scholar]
  • 5.Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337:816–821. doi: 10.1126/science.1225829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013;339:819–823. doi: 10.1126/science.1231143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM. RNA-Guided Human Genome Engineering via Cas9. Science. 2013;339:823–826. doi: 10.1126/science.1232033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Xue W, Chen S, Yin H, Tammela T, Papagiannakopoulos T, Joshi NS, Cai W, Yang G, Bronson R, Crowley DG, Zhang F, Anderson DG, Sharp PA, Jacks T. CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014;514:380–384. doi: 10.1038/nature13589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Li Y, Rivera CM, Ishii H, Jin F, Selvaraj S, Lee AY, Dixon JR, Ren B. CRISPR reveals a distal super-enhancer required for Sox2 expression in mouse embryonic stem cells. PLoS ONE. 2014;9:e114485. doi: 10.1371/journal.pone.0114485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell. 2013;152:1173–1183. doi: 10.1016/j.cell.2013.02.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013;154:442–451. doi: 10.1016/j.cell.2013.06.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Perez-Pinera P, Kocak DD, Vockley CM, Adler AF, Kabadi AM, Polstein LR, Thakore PI, Glass KA, Ousterout DG, Leong KW, Guilak F, Crawford GE, Reddy TE, Gersbach CA. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nat Meth. 2013;10:973–976. doi: 10.1038/nmeth.2600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Maeder ML, Linder SJ, Cascio VM, Fu Y, Ho QH, Joung JK. CRISPR RNA-guided activation of endogenous human genes. Nat Meth. 2013 doi: 10.1038/nmeth.2598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R. Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res. 2013;23:1163–1171. doi: 10.1038/cr.2013.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Konermann S, Brigham MD, Trevino AE, Hsu PD, Heidenreich M, Cong L, Platt RJ, Scott DA, Church GM, Zhang F. Optical control of mammalian endogenous transcription and epigenetic states. Nature. 2013;500:472–476. doi: 10.1038/nature12466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kearns NA, Genga RMJ, Enuameh MS, Garber M, Wolfe SA, Maehr R. Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014;141:219–223. doi: 10.1242/dev.103341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hilton IB, D'Ippolito AM, Vockley CM, Thakore PI. Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nature. 2015 doi: 10.1038/nbt.3199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kearns NA, Pham H, Tabak B, Genga RM, Silverstein NJ, Garber M, Maehr R. Functional annotation of native enhancers with a Cas9-histone demethylase fusion. Nat Meth. 2015;12:401–403. doi: 10.1038/nmeth.3325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD. A Protein-Tagging System for Signal Amplification in Gene Expression and Fluorescence Imaging. Cell. 2014;159:635–646. doi: 10.1016/j.cell.2014.09.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 doi: 10.1038/nbt.2675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, PR Iyer E, Lin S, Kiani S, Guzman CD, Wiegand DJ, Ter-Ovanesyan D, Braff JL, Davidsohn N, Housden BE, Perrimon N, Weiss R, Aach J, Collins JJ, Church GM. Highly efficient Cas9-mediated transcriptional programming. Nat Meth. 2015;12:326–328. doi: 10.1038/nmeth.3312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shechner DM, Hacisuleyman E, Younger ST, Rinn JL. Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Nat Meth. 2015;12:664–670. doi: 10.1038/nmeth.3433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chakraborty S, Ji H, Kabadi AM, Gersbach CA, Christoforou N, Leong KW. A CRISPR/Cas9-based system for reprogramming cell lineage specification. Stem Cell Reports. 2014;3:940–947. doi: 10.1016/j.stemcr.2014.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Gao X, Tsang JCH, Gaba F, Wu D, Lu L, Liu P. Comparison of TALE designer transcription factors and the CRISPR/dCas9 in regulation of gene expression by targeting enhancers. Nucleic Acids Res. 2014;42:e155. doi: 10.1093/nar/gku836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Balboa D, Weltner J, Eurola S, Trokovic R, Wartiovaara K, Otonkoski T. Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Stem Cell Reports. 2015;5:448–459. doi: 10.1016/j.stemcr.2015.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Urrutia R. KRAB-containing zinc-finger repressor proteins. Genome Biol. 2003;4:231. doi: 10.1186/gb-2003-4-10-231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bellefroid EJ, Poncelet DA, Lecocq PJ, Revelant O, Martial JA. The evolutionarily conserved Krüppel-associated box domain defines a subfamily of eukaryotic multifingered proteins. Proc Natl Acad Sci USA. 1991;88:3608–3612. doi: 10.1073/pnas.88.9.3608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ayer DE, Laherty CD, Lawrence QA, Armstrong AP, Eisenman RN. Mad proteins contain a dominant transcription repression domain. Mol Cell Biol. 1996;16:5772–5781. doi: 10.1128/mcb.16.10.5772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shi Y, Lan F, Matson C, Mulligan P, Whetstine JR, Cole PA, Casero RA, Shi Y. Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell. 2004;119:941–953. doi: 10.1016/j.cell.2004.12.012. [DOI] [PubMed] [Google Scholar]
  • 30.Bernstein DL, Le Lay JE, Ruano EG, Kaestner KH. TALE-mediated epigenetic suppression of CDKN2A increases replication in human fibroblasts. J Clin Invest. 2015;125:1998–2006. doi: 10.1172/JCI77321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Maeder ML, Angstman JF, Richardson ME, Linder SJ, Cascio VM, Tsai SQ, Ho QH, Sander JD, Reyon D, Bernstein BE, Costello JF, Wilkinson MF, Joung JK. Targeted DNA demethylation and activation of endogenous genes using programmable TALE-TET1 fusion proteins. Nat Biotechnol. 2013;31:1137–1142. doi: 10.1038/nbt.2726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hockemeyer D, Soldner F, Beard C, Gao Q, Mitalipova M, DeKelver RC, Katibah GE, Amora R, Boydston EA, Zeitler B, Meng X, Miller JC, Zhang L, Rebar EJ, Gregory PD, Urnov FD, Jaenisch R. Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol. 2009;27:851–857. doi: 10.1038/nbt.1562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.DeKelver RC, Choi VM, Moehle EA, Paschon DE, Hockemeyer D, Meijsing SH, Sancak Y, Cui X, Steine EJ, Miller JC, Tam P, Bartsevich VV, Meng X, Rupniewski I, Gopalan SM, Sun HC, Pitz KJ, Rock JM, Zhang L, Davis GD, Rebar EJ, Cheeseman IM, Yamamoto KR, Sabatini DM, Jaenisch R, Gregory PD, Urnov FD. Functional genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger nuclease-driven transgenesis into a safe harbor locus in the human genome. Genome Res. 2010;20:1133–1142. doi: 10.1101/gr.106773.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Li X, Zhao X, Fang Y, Jiang X, Duong T, Fan C, Huang CC, Kain SR. Generation of destabilized green fluorescent protein as a transcription reporter. J Biol Chem. 1998;273:34970–34975. doi: 10.1074/jbc.273.52.34970. [DOI] [PubMed] [Google Scholar]
  • 35.Stepanenko OV, Verkhusha VV, Kazakov VI, Shavlovsky MM, Kuznetsova IM, Uversky VN, Turoverov KK. Comparative studies on the structure and stability of fluorescent proteins EGFP, zFP506, mRFP1, “dimer2,” and DsRed1. Biochemistry. 2004;43:14913–14923. doi: 10.1021/bi048725t. [DOI] [PubMed] [Google Scholar]
  • 36.Wang T, Wei JJ, Sabatini DM, Lander ES. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 2014;343:80–84. doi: 10.1126/science.1246981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, Sullender M, Ebert BL, Xavier RJ, Root DE. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol. 2014;32:1262–1267. doi: 10.1038/nbt.3026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Chari R, Mali P, Moosburner M, Church GM. Unraveling CRISPR-Cas9 genome engineering parameters via a library-on-library approach. Nat Meth. 2015;12:823–826. doi: 10.1038/nmeth.3473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G, Zhang F. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. 2013 doi: 10.1038/nbt.2647. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES