Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2016 Apr 5;113(16):4506–4511. doi: 10.1073/pnas.1603294113

Inflammatory and neuropathic cold allodynia are selectively mediated by the neurotrophic factor receptor GFRα3

Erika K Lippoldt a,1, Serra Ongun a,b,1, Geoffrey K Kusaka a, David D McKemy a,b,2
PMCID: PMC4843462  PMID: 27051069

Significance

There are few effective treatments for chronic cold pain induced by tissue damage, nerve injury, or chemotherapeutic polyneuropathies. Here, we show that the specific artemin receptor, glial cell line-derived neurotrophic factor family of receptors-α3, is absolutely required for injury-induced cold pain, and we show results of a specific transduction pathway that can be targeted selectively to treat cold pain.

Keywords: Gfrα3, artemin, cold, pain, allodynia

Abstract

Tissue injury prompts the release of a number of proalgesic molecules that induce acute and chronic pain by sensitizing pain-sensing neurons (nociceptors) to heat and mechanical stimuli. In contrast, many proalgesics have no effect on cold sensitivity or can inhibit cold-sensitive neurons and diminish cooling-mediated pain relief (analgesia). Nonetheless, cold pain (allodynia) is prevalent in many inflammatory and neuropathic pain settings, with little known of the mechanisms promoting pain vs. those dampening analgesia. Here, we show that cold allodynia induced by inflammation, nerve injury, and chemotherapeutics is abolished in mice lacking the neurotrophic factor receptor glial cell line-derived neurotrophic factor family of receptors-α3 (GFRα3). Furthermore, established cold allodynia is blocked in animals treated with neutralizing antibodies against the GFRα3 ligand, artemin. In contrast, heat and mechanical pain are unchanged, and results show that, in striking contrast to the redundant mechanisms sensitizing other modalities after an insult, cold allodynia is mediated exclusively by a single molecular pathway, suggesting that artemin–GFRα3 signaling can be targeted to selectively treat cold pain.


When pain continues past its usefulness as a warning of potential tissue damage, it becomes a debilitating condition for which few viable treatments are currently available. The result can be an exacerbation of pain in response to both innocuous (allodynia) and noxious (hyperalgesia) stimuli (1). For example, pain felt with normally pleasant mild cooling (cold allodynia) occurs in many pathological conditions, such as fibromyalgia, multiple sclerosis, stroke, and chemotherapeutic-induced polyneuropathy, but what underlies this specific form of pain at the cellular or molecular level is largely unknown (2–5). Pain-sensing afferent neurons (nociceptors) are sensitized during injury or disease, in part, by a vast array of proalgesic compounds termed the “inflammatory soup” (e.g., neurotrophic factors, protons, bradykinin, prostaglandins, and ATP) (1). These substances are released locally at the site of injury by infiltrating immune cells, such as macrophages, neutrophils, and T cells, as well as resident cells, including keratinocytes and mast cells (6), and either directly activate sensory receptors or sensitize them to subsequent stimuli (7). Moreover, prolonged inflammation can lead to central sensitization (in the spinal cord and brain) and bring about long-lasting chronic pain that persists after acute inflammation has resolved. Thus, a better understanding of the molecules involved in neuroinflammation may lead to therapeutic options for acute and chronic pain.

Of the range of proalgesics known to promote pain, only nerve growth factor (NGF) and the glial cell line-derived neurotrophic factor family ligand (GFL) artemin have been shown to lead to cold hypersensitivity (8–11). Both are major components of the inflammatory soup and produce nociceptor sensitization and pain through their cognate cell surface receptors. NGF, the classical proalgesic neurotrophic factor, leads to thermal and mechanical sensitization directly through its receptor tyrosine kinase TrkA expressed on nociceptors and indirectly through the activation of peripheral cells (12). Glial cell line-derived neurotrophic factor family of receptors-α (GFRαs) are typically coupled to the receptor tyrosine kinase Ret (1). However, GFRαs are more widely expressed than Ret, and Ret-independent GFL-induced neuronal sensitization has been reported, suggesting that these receptors may signal through additional transmembrane proteins (13–16).

Here, we show that cold allodynia induced by inflammation, nerve injury, or chemotherapeutics is completely abolished in mice null for GFRα3 (Gfrα3−/−). In contrast, heat and mechanical hyperalgesia are unaltered in Gfrα3−/− mice, indicating that GFRα3 has a limited role in pain associated with these sensory modalities but predominates the potentiation of cold sensitivity after injury. This specificity strongly suggests that therapeutic interventions into cold allodynia should focus on artemin–GFRα3 signaling. Indeed, we find that pathological cold pain alone is ameliorated in animals treated with artemin-neutralizing antibodies. These results show that cold allodynia is mediated exclusively by artemin–GFRα3 signaling and that blocking this pathway is a viable treatment option for cold pain.

Results

Previously, we showed that intraplantar hind paw injections of artemin or NGF induce a robust and transient TRPM8-dependent cold allodynia (8). The NGF/TrkA signaling pathways and their requirement in sensory neuron development and sensitization are well-established (1), but how GFRα receptors induce sensory neuron sensitization is poorly understood. Therefore, to determine how artemin leads to cold pain, we first examined acute sensitivity of mice lacking the artemin receptor GFRα3 (Gfrα3−/−) to thermal or mechanical stimuli, which to the best of our knowledge, has not been reported for these animals (17, 18). Using the cold plantar (19), von Frey (mechanical), and Hargreaves (radiant heat) assays, we compared thermal and mechanically evoked behaviors of WT and Gfrα3−/− mouse littermates, finding no differences between the two genotypes (Fig. S1 A–C) (P > 0.05). These data show that acute nociceptive behaviors are not altered in GFRα3-deficient mice.

Fig. S1.

Fig. S1.

Gfrα3−/− mice display normal acute cold, heat, and mechanosensory behaviors. Withdrawal latencies in response to (A) cold and (C) heat stimuli were similar in naïve adult (8–14 wk of age) Gfrα3−/− and WT mice (P > 0.05; n = 5–12). (B) Paw withdrawal threshold forces did not differ between genotypes in the electronic von Frey assay (P > 0.05; n = 5–10). (E) Gfrα3−/− mice injected with artemin (20 μg; P > 0.05 for all time points; n = 7) showed no change in cold sensitivity compared with (D) vehicle-injected mice in the cold plantar assay (n = 7). **P < 0.01; ***P < 0.001. (F) Gfrα3−/− mice injected with artemin showed no change in cold sensitivity compared with vehicle injection in the evaporative cooling assay (P > 0.05 for all time points; n = 5–6). ARTN, artemin; contr, contralateral; ipsi, ipsilateral; ns, not significant.

Among the four distinct GFL α-receptor subtypes (GFRα), artemin has been reported to be highly selective for GFRα3 (20) but has also been suggested to cross-react with other GFL receptors (21). Therefore, to determine if artemin’s effects on cold sensitivity are GFRα3-specific, we examined cold sensitivity after intraplantar artemin injections in both WT and Gfrα3−/− mice. In the WTs, the latency to a paw withdrawal from a radiant cold stimulus using the cold plantar assay was significantly decreased at 1 and 3 h after artemin injection (Fig. S1D) (P < 0.001 at 1 h vs. basal or vehicle-injected; P < 0.01 at 3 h). However, consistent with this ligand’s selectivity for GFRα3 (20), hind paw injections of artemin failed to alter cold sensitivity in Gfrα3−/− mice (Fig. S1E) (P > 0.05). Similar results were observed in Gfrα3−/− mice using the evaporative cooling assay (Fig. S1F), showing that artemin-induced cold hypersensitivity is GFRα3-dependent.

Next, to test the role of GFRα3 in pathological cold pain, we examined adult WT and Gfrα3−/− littermates in classical models of inflammation, nerve injury, and chemotherapeutic-induced neuropathic pain (22, 23). WT mice show robust cold allodynia 2 d after unilateral injections of the inflammatory agent complete Freund’s adjuvant (CFA) (Fig. 1A) (P < 0.01, pre- vs. post-CFA or ipsilateral vs. contralateral), which we and others have previously reported (22–24). In contrast, Gfrα3−/− mice show no differences in their hind paw lift latencies between the ipsilateral (inflamed) and the contralateral (control) sides, and there were no differences in their sensitivity compared with the basal, preinflamed state (Fig. 1A) (P > 0.05). To determine the general nature of this inability of Gfrα3−/− mice to mount a cold allodynic response after injury, we also examined animals with neuropathic pain caused by chronic constriction injury (CCI) of the sciatic nerve (25). As with inflammation, cold allodynia was observed in WT animals (Fig. 1B) (P < 0.01, preinjury vs. 7 d postinjury; P < 0.001, ipsilateral vs. contralateral), but cold sensitivity was remarkably unchanged in Gfrα3−/− mice (ipsilateral vs. contralateral; preinjury vs. 7 d postinjury; P > 0.05). Lastly, one of the major side effects of platin-based chemotherapeutics is cold pain (26), a phenotype that can be modeled in mice given a single systemic injection of oxaliplatin (22, 23). As with the previous pain models, the cold allodynia observed in WT mice (P < 0.001, basal vs. 7 d postinjection) was completely absent in mice null for GFRα3 (Fig. 1C) (P > 0.05, pre- vs. postinjection and Gfrα3−/− postinjection vs. WT mice preinjection). We observed similar results in all three pathological pain models when cold sensitivity was determined by evaporative cooling (Fig. S2).

Fig. 1.

Fig. 1.

GFRα3 is required for cold allodynia induced by inflammation, nerve injury, and chemotherapy polyneuropathy. (A) Decreased cold-evoked withdrawal latencies in WT but not Gfrα3−/− mice 2 d after an intraplantar injection of CFA. Post-CFA latencies for Gfrα3−/− mice were not statistically different (P > 0.05) than basal. **P < 0.01 (n = 7–9). (B) Cold allodynia observed in the ipsilateral hind paw in WT mice after CCI was absent in Gfrα3−/− mice with postinjury withdrawal latencies identical to preinjury times (P > 0.05; n = 6–7). **P < 0.01; ***P < 0.001. (C) Oxaliplatin-induced decreases in withdrawal latencies to cold observed in WT controls were absent in Gfrα3−/− mice, with response times the same as preinjection times for both genotypes (P > 0.05; n = 11–12). contr, Contralateral; ipsi, ipsilateral; ns, not significant; oxal, oxaliplatin. ***P < 0.001.

Fig. S2.

Fig. S2.

Evaporative cooling assay to assess GFRα3 in cold allodynia induced by inflammation, nerve injury, and chemotherapy polyneuropathy. Increased acetone-cooling evoked response score was observed in WT but not Gfrα3−/− mice (A) after an intraplantar injection of CFA (n = 8), (B) after CCI of the sciatic nerve (n = 7), and (C) in oxaliplatin polyneuropathy (n = 9). Postinjury scores for Gfrα3−/− mice were not statistically different (P > 0.05) between ipsilateral and contralateral hind paws (CFA and CCI) or vs. basal (oxalplatin). contr, Contralateral; ipsi, ipsilateral; ns, not significant. **P < 0.01.

We asked how specific the role of GFRα3 signaling is for cold pain vs. other pain modalities. To address this question, we examined mechanical- and radiant heat-evoked responses in WT and Gfrα3−/− mice in the three pain models tested previously. In striking contrast to cold-evoked behaviors, we observed robust mechanical hyperalgesia in both WT and Gfrα3−/− mice in the context of inflammation (Fig. 2A) (P < 0.001, pre- vs. post-CFA or ipsilateral vs. contralateral), with nerve injury (Fig. 2B) (P < 0.01, pre- vs. postinjury; P < 0.001, ipsilateral vs. contralateral), and with oxaliplatin-induced polyneuropathy (Fig. S3) (P < 0.001, basal vs. postinjection). Next, we examined heat hyperalgesia in both the CFA inflammatory and CCI neuropathic pain models (oxaliplatin does not induce heat hyperalgesia). As with mechanical pain, we observed strong heat hyperalgesia in both WT and Gfrα3−/− mice with inflammation (Fig. 2C) (P < 0.05 and P < 0.01, pre- vs. post-CFA for WT and Gfrα3−/− mice, respectively; P < 0.001, ipsilateral vs. contralateral) or irritation of the sciatic nerve (Fig. 2D) (P < 0.01, pre- vs. postinjury; P < 0.001, ipsilateral vs. contralateral). Furthermore, there was no difference between the levels of mechanical and heat hyperalgesia between the two genotypes (P > 0.05), showing that GFRα3 is not absolutely required for heat and mechanical pain, such as it is for cold. These remarkable results show that, unlike the redundant nature of heat or mechanical sensitization, which is mediated by several algogenic receptors (1), injury-evoked cold allodynia, both inflammatory and neuropathic, requires the artemin receptor GFRα3.

Fig. 2.

Fig. 2.

Heat and mechanical hyperalgesia are not dependent on GFRα3. Both WT and Gfrα3−/− mice exhibit reduced threshold forces inducing a paw withdrawal (A) 3 d after unilateral CFA injection or (B) 7 d after CCI surgery (ipsilateral vs. contralateral; n = 6–7). Similarly, heat hyperalgesia was observed (C) 3 d after the induction of inflammation or (D) 7 d after nerve injury (ipsilateral vs. contralateral; n = 7–8). contr, Contralateral; ipsi, ipsilateral. *P < 0.05; **P < 0.01; ***P < 0.001.

Fig. S3.

Fig. S3.

Oxaliplatin-induced mechanical hyperalgesia is not dependent on GFRα3. Cold allodynia observed 7 d after a single injection of oxaliplatin was robust in both WT and Gfrα3−/− mice (n = 6–8). ns, Not significant. ***P < 0.001.

Experimentally induced overexpression of artemin in peripheral tissues has been shown to lead to heat and mechanical hyperalgesia as well as altered expression of molecules involved in sensory transduction (27, 28). However, these studies involved either genetically induced artemin overexpression in the periphery (27) or multiple plantar injections of exogenous artemin (28), making it unclear if artemin–GFRα3 signaling influences afferent expression phenotypes under physiological conditions. Thus, to determine if the lack of a cold allodynic phenotype in Gfrα3−/− mice is a result of alterations in sensory afferent development caused by the absence of GFRα3, we used quantitative PCR to determine expression of array markers involved in cold thermosensation (29). In adult dorsal root ganglia (DRG) (Fig. S4A) and trigeminal neurons (Fig. S4B), we observed no differences (P > 0.05) in transcript expression of either known thermosensory receptors (Trpm8, Trpa1, or Trpv1) or channels implicated in excitability of thermosensory afferents (Nav1.8, Nav1.6, Task3, Traak, and Trek1) in WT and Gfrα3−/− mice (30).

Fig. S4.

Fig. S4.

Expression of genes involved in cold transduction is not dependent on GFRα3. cDNA purified from (A) adult dorsal root and (B) trigeminal ganglia was analyzed by quantitative PCR, showing that transcript levels of a number of genes involved in somatosensory signaling are similar between Gfrα3−/− and WT tissues (n = 4 mice).

Next, using immunohistochemistry, we examined the protein expression phenotype of Gfrα3−/− mice, first establishing that immunoreactivity for GFRα3 was absent in adult L4–L6 DRG from these animals (Fig. S5). TRPM8 is the principle cold thermoreceptor in mammals, and we have shown that it is required for artemin-mediated cold allodynia (8, 31). GFRα3 is expressed in one-half of TRPM8+ DRG neurons (8), but consistent with our transcript expression analysis, we observed no difference in the number of TRPM8-positive neurons between WT and Gfrα3−/− mice (Fig. S5F) (P > 0.05). GFRα3 is found exclusively in TRPV1-positive afferents (27, 32), but we observed no difference in TRPV1 expression in Gfrα3−/− mice (Fig. S5 A and F). Moreover, the numbers of neurons immunoreactive to antibodies to calcitonin gene-related peptide, a marker of peptidergic nociceptors (Fig. S5 B and F), and bound to the nonpeptidergic neuronal marker isolectin IB4 (Fig. S5 C and F) were similar. There was also no difference in fiber-type distribution, because the numbers of neurons labeled for the A-fiber marker NF200 (Fig. S5 D and F) and the C-fiber marker peripherin (Fig. S5 E and F) were similar between genotypes. These results show that the development of DRG neurons is not influenced by GFRα3 signaling, results consistent with prior analyses of these mice as well as those lacking artemin expression (17, 18).

Fig. S5.

Fig. S5.

Expressions of somatosensory markers are unaltered in the absence of GFRα3. (A–E) Representative images of triple-labeled DRG sections from both adult (Upper) WT and (Lower) Gfrα3−/− mice. In A–E, TRPM8 (green) and GFRα3 (blue) expressions are compared with a difference marker (red). (A) TRPV1 labeling in DRGs and their overlap with TRPM8 (green) showed no differences in thermosensory TRP channel expression between genotypes. Similarly, expressions of (B) the peptide calcitonin gene-related peptide (CGRP), (C) the nonpeptidergic marker IB4, (D) the A-fiber marker NF200, and (E) the C-fiber marker peripherin (Per) were similar in WT and Gfrα3−/− mice. Arrowheads indicate triple-labeled neurons (WT) or double-labeled neurons (Gfrα3−/−), whereas arrows indicate TRPM8 cells that are not positive for either marker. (F) Quantification of immunohistochemical labeling of various sensory neuron makers shows similar proportions in Gfrα3−/− and WT controls DRGs. Percentages of total DRG neurons that were positive for each marker are similar in Gfrα3−/− tissue compared with WT tissue (P > 0.05; n = 15–32 sections from at least three mice). ns, Not significant.

Our results suggest that cold allodynia is specifically mediated by artemin signaling through its receptor GFRα3, which likely functions upstream of molecules involved in cold transduction, highlighting what seems to be a highly specific pathway leading to cold pain. Because of this extraordinary specificity, we hypothesized that in vivo artemin neutralization in mouse models of inflammatory and neuropathic pain could selectively block cold allodynia, even that which is localized at or near a site of injury, whereas heat and mechanical pain would remain intact. Artemin-neutralizing antibodies are known to effectively inhibit binding of artemin with GFRα3 in vivo and serve as a potential pharmacological mechanism to ameliorate or prevent the effects of artemin exposure (33–35). Therefore, we tested whether a systemic injection of an established artemin-neutralizing mAb could reverse inflammatory and neuropathic pain. Remarkably, both inflammatory cold allodynia (Fig. 3A) and oxaliplatin-induced (Fig. 3B) cold allodynia were ameliorated in WT mice 4 h after intradermal injection (10 mg/kg) of the antiartemin antibody MAB1085 (P > 0.05, ipsilateral vs. contralateral), whereas mice injected with an isotype control antibody remained sensitized to cold (Fig. 3 A and B) (P < 0.01, ipsilateral vs. contralateral or pre- vs. postinjection). We observed a similar reduction in cold allodynia in mice tested with the evaporative cooling assay (Fig. S6).

Fig. 3.

Fig. 3.

Artemin neutralization selectively attenuates cold hypersensitivity. (A) Inflammatory cold allodynia was attenuated in WT mice 4 h after s.c. injection of an artemin-neutralizing antibody (P > 0.05, ipsilateral vs. contralateral; n = 6–7) compared with in control mice. **P < 0.01. (B) Chemotherapeutic-induced cold pain was attenuated after antibody injection (P > 0.05, preoxaliplatin vs. postantibody) and significantly different from controls. **P < 0.01. (C) Conversely, inflammatory mechanical hyperalgesia was unaffected (P > 0.05, ipsilateral control vs. ipsilateral antibody; P < 0.001, ipsilateral vs. contralateral for both treatments; n = 5–8). ***P < 0.001. (D) Chemotherapeutic-induced mechanical hyperalgesia was unaffected (P > 0.05, postantibody vs. control; P < 0.01, preoxaliplatin vs. postantibody; n = 5–6). **P < 0.01. (E) Inflammatory thermal hyperalgesia was unaffected (P > 0.05, ipsilateral control vs. ipsilateral antibody; P < 0.001, ipsilateral vs. contralateral for both treatments; n = 6). ARTN, artemin; contr, contralateral; ipsi, ipsilateral; ns, not significant; oxal, oxaliplatin. ***P < 0.001.

Fig. S6.

Fig. S6.

Artemin neutralization attenuates cold hypersensitivity in the evaporative cooling assay. Inflammation-induced (CFA) cold hypersensitivity was attenuated in WT mice 4 h after s.c. injection of an antiartemin antibody (MAB1085; 10 mg/kg; P > 0.05, ipsilateral vs. contralateral; n = 8) compared with in mice injected with an IgG2A isotype control (10 mg/kg). ARTN, artemin; contr, contralateral; ipsi, ipsilateral; ns, not significant. **P < 0.01.

Moreover, in agreement with our genetic analysis, treatment with MAB1085 had no effect on mechanical (Fig. 3 C and D) (P < 0.001) or heat (Fig. 3E) (P < 0.001) hyperalgesia observed in the ipsilateral vs. contralateral hind paws, and the level of hyperalgesia was not different between control and MAB1085-treated mice (P > 0.05). These data show that artemin-neutralizing antibodies can reverse multiple types of injury-induced cold pain in an effective and highly specific manner.

To date, unlike heat and mechanical hyperalgesia, only artemin and to a lesser extent, NGF have been found to induce cold hypersensitivity in mice when administered by intraplantar injections (8, 9, 11). NGF signals through the tyrosine kinase TrkA and is a major mediator of heat hyperalgesia through sensitization of the heat-gated capsaicin receptor TRPV1 (36, 37). Based on the extensive literature on NGF/TrkA signaling, we expected that NGF-induced cold sensitization was mediated by TrkA through cellular signal transduction cascades that sensitize molecules involved in cold transduction. However, to our surprise, we found that cold allodynia observed in WT mice 1 h after intraplantar NGF injection (Fig. 4A) (P < 0.01 at 1 h vs. basal and vehicle-injected) was absent in Gfrα3−/− mice injected with NGF (Fig. 4B) (P > 0.05 at 1 and 3 h postinjection; P > 0.05, NGF vs. vehicle at all times tested), results similar to those observed after artemin injection. To ensure that this absence of cold allodynia was not because of a general reduction in NGF sensitization in these mice, we tested heat hyperalgesia, finding that, consistent with our analyses of inflammatory and neuropathic pain, heat hyperalgesia remained intact in Gfrα3−/− mice (Fig. 4D) (P < 0.001 at 1 h postinjection and NGF vs. vehicle; P < 0.01 at 3 h postinjection and NGF vs. vehicle), similar to that observed in WT animals (Fig. 4C). Thus, these results show that NGF-induced cold allodynia requires GFRα3, suggesting for the first time, to our knowledge, that cellular mechanisms leading to cold hypersensitivity converge on GFRα3.

Fig. 4.

Fig. 4.

NGF-induced cold allodynia is GFRα3-dependent. (A) WT mice exhibit cold allodynia 1 h but not 3 h after intraplantar NGF injections (P > 0.05; n = 9–11), whereas (B) Gfrα3−/− mice showed no change in cold sensitivity compared with vehicle-injected mice in the cold plantar assay (P > 0.05; n = 9–11). **P < 0.01. Both (C) WT and (D) Gfrα3−/− mice displayed robust heat hyperalgesia 1 and 3 h after NGF administration (n = 6). ns, Not significant. *P < 0.05; **P < 0.01; ***P < 0.001.

How then does NGF prompt GFRα3-dependent cold allodynia? NGF does not directly interact with or stimulate GFRα receptors (38). However, in addition to direct sensitization of nociceptors, NGF also acts indirectly through activation of various peripheral cell types and the subsequent release of a host of inflammatory mediators, which in turn, sensitize sensory afferents (12, 39–41). Several inflammatory conditions stimulate artemin release from a number of peripheral cell types, including keratinocytes, fibroblasts, and immune cells (28, 42, 43), and we hypothesized that NGF-induced cold allodynia was mediated by NGF indirectly promoting artemin release. To test this hypothesis, we again used artemin-neutralizing antibodies and found that NGF-evoked cold allodynia observed in control mice (Fig. 5A) (P < 0.001, NGF vs. vehicle, ipsilateral vs. contralateral), measured 1 h after intraplantar NGF injections, was blocked when MAB1085 was administered systemically 1 h before NGF treatment (Fig. 5A) (P > 0.05, NGF vs. vehicle, ipsilateral vs. contralateral). This absence of NGF-evoked sensitization was again modality-specific, because MAB1085 had no effect on heat hyperalgesia compared with controls (Fig. 5B) (P < 0.001, NGF vs. vehicle, ipsilateral vs. contralateral for both conditions). Thus, these results show that NGF-induced cold allodynia is mediated by artemin signaling through its cognate cellular receptor GFRα3, further validating the necessity and specificity of this signaling pathway on pathological cold pain.

Fig. 5.

Fig. 5.

Artemin neutralization blocks NGF-induced cold allodynia. (A) NGF-induced cold allodynia was attenuated in WT mice by artemin neutralization (P > 0.05, pre- vs. post-NGF and vs. vehicle-injected mice; n = 4) 1 h before intraplantar NGF injection. Control mice show robust cold allodynia after NGF injection (pre- vs. post-NGF and vs. vehicle-injected; n = 4). ***P > 0.001. (B) NGF-induced heat hyperalgesia was unaffected by antibody treatment and similar to controls (pre- vs. post-NGF and vs. vehicle-injected; n = 4). **P < 0.01; ***P > 0.001. ARTN, artemin; contr, contralateral; ipsi, ipsilateral; ns, not significant.

Discussion

To our knowledge, this study is the first rigorous report of nociception in mice lacking GFRα3, and our results are consistent with prior studies that found no discernable phenotype in peripheral sensory ganglia in both artemin and GFRα3-null mice (17, 18). The lack of any salient somatosensory abnormalities in naïve Gfrα3−/− mice suggests that the receptor has no substantial role in sensory nervous system development, despite the fact that it is expressed in ∼20% of adult DRG neurons.

Nonetheless, we now show the necessity of GFRα3 in pathological cold pain induced by an important inflammatory mediator (NGF) and inflammation itself and in two distinct forms of neuropathic pain. What is a remarkable and seminal result of our study is that injury-induced cold allodynia of multiple etiologies is totally dependent on GFRα3, unlike the redundant nature of heat and mechanical pain that signal through a diverse repertoire of cell surface receptors (1). NGF, protons, bradykinin, and histamine, to name a few, are all capable of potentiating TRPV1 responses (7, 29, 44, 45) and responsible for the development of heat hyperalgesia. However, only artemin and NGF induce cold allodynia in a manner similar to that found after injury (8). Here, we show that both proalgesics promote cold pain through GFRα3 and, surprisingly, that NGF-induced cold allodynia occurs through a mechanism that involves artemin, because it is ameliorated with artemin neutralization. The latter result is consistent, however, with an indirect action of NGF on nociceptors, in which NGF activates immune cells to release a host of inflammatory mediators, including artemin (12, 39).

The signal transduction mechanisms that lead to cold sensitization after artemin activation of GFRα3 remain unclear. We recently reported that artemin- and NGF-evoked cold allodynia was dependent on TRPM8 channels, but artemin and GFRα3 have not been shown to directly sensitize TRPM8 channels in vitro. The molecular processes whereby NGF/TrkA activation leads to heat hyperalgesia are well-documented (7), but to date, the molecular nature of GFL signaling on nociception has yet to be elucidated. For example, we and others have shown that acute exposure of GFLs, including artemin, in vivo leads to heat hyperalgesia (8, 42, 45). Similarly, GFLs potentiate capsaicin responses in dissociated DRG neurons recorded by Ca2+ imaging, showing sensitization of TRPV1+ cells (45). However, specific changes in TRPV1 channel activity have not been reported, and the preponderance of data suggests that artemin-induced heat hyperalgesia is caused by increased TRPV1 expression (27, 28, 46, 47). Moreover, unlike the established TRPM8 dependence of artemin- and NGF-evoked cold allodynia (8) or the necessity of TRPV1 for NGF-induced heat hyperalgesia (36), the molecule determinants of GFL-evoked alterations in nociception in vivo are unknown (48).

What then underlies artemin- and GFRα3-dependent cold pain? As a glycosyl-phosphatidylinositol (GPI)-linked extraceullular receptor, GFRα3 must bind to a transmembrane protein to transduce a signal, which in many systems, is the tyrosine kinase Ret (49). However, recent evidence has uncovered GFRα actions that are Ret-independent, and although the exact transduction mechanisms underlying the GFL signaling in the absence of Ret have yet to be elucidated, both the neural cell adhesion molecules and integrin-β1 are reported to act as coreceptors with GFRαs (50, 51). These receptor complexes signal intracellularly through similar molecular mechanisms, including protein kinases (MAPK, p38/JNK, PI3K, src family, PKA, and PKC) and phospholipases (PLCβ and PLCγ) (15, 49, 50), pathways also known to modulate heat sensitivity (52–56), suggesting a potentially similar mechanism of action.

Artemin- and NGF-induced sensitization of cold responses is TRPM8-dependent, and multiple studies have shown that TRPM8 plays a role in the development of cold allodynia (8, 22–24, 57). However, inflammatory cold allodynia is also diminished by both an TRPA1 antagonist and reduced TRPA1 transcript expression, and cold hypersensitivity can be induced by TRPA1 agonism in WT but not Trpa1−/− mice (58, 59). Thus, both TRPM8 and TRPA1 are involved in pathological cold pain, although it should be noted that artemin directly inhibits TRPA1 channels (60), but it is unknown how channel inhibition influences any potential changes to TRPA1 function downstream of GFRα3 activation.

Lastly, ion channels involved in neuronal excitability have been implicated in cold pain. For example, two-pore, nongated potassium channels contribute to cold pain as they are down-regulated after oxaliplatin treatment, thereby leading to enhanced neuronal excitability (61, 62). Moreover, antagonism of the voltage-gated sodium channel Nav1.6 attenuated neuropathic cold allodynia (63). Thus, the mechanisms that potentiate cold responses at the molecular and cellular levels are diverse, but our data strongly suggest that future studies into cold pain should center around the effect of GFRα3 activation on these pathways.

Finally, we provide evidence here that artemin and GFRα3 are potential therapeutic targets for conditions in which cold alloydnia is a symptom. Artemin-neutralizing antibodies can ameliorate both inflammatory and neuropathic cold pain, which has already been established in the animal, suggesting that interfering with artemin is a potential therapeutic strategy for this pain modality. Our results are consistent with other recent reports that suggest that artemin neutralization was found to inhibit noninflammatory heat hyperalgesia in the tongue and reduce bladder hyperalgesia (33–35). Moreover, this approach is analogous to therapeutic interventions to block pain with NGF-neutralizing antibodies that are currently ongoing (64, 65). The finding that antiartemin antibodies can block oxaliplatin-induced cold allodynia provides a particularly promising prospect for clinical application. When taken as a whole, these studies show that, unlike the broad range of mediators of mechanical and heat pain, the exacerbation of cold pain after injury is mediated exclusively by the GFL artemin and its receptor GFRα3, providing the first evidence, to our knowledge, of a proalgesic agent singularly required for cold sensitization. Thus, artemin and GFRα3 can be considered as valuable therapeutic targets because of their effectiveness and specificity to cold pain.

Materials and Methods

Behavioral Assays.

Details are in SI Materials and Methods. All experiments were approved by the University of Southern California Institutional Animal Care and Use Committee and performed in accordance with the recommendations of the International Association for the Study of Pain and Guide for the Care and Use of Laboratory Animals by the NIH (66). Adult WT or GFRα3−/− mice (a gift from Brian Davis, University of Pittsburgh, Children's Hospital of Pittsburgh, Pittsburgh, PA) of both sexes were used in behavioral assays. Cold, heat, and mechanical sensitivity were assayed as described (19, 22).

Artemin and NGF Injections.

Artemin and NGF injections to the hind paw were performed as described previously (8).

Pain Models.

Inflammation was induced unilaterally by intraplantar injection of 20 μL CFA into the hind paw. Neuropathic pain was induced using the CCI model or chemotherapeutic oxaliplatin (22, 25).

SI Materials and Methods

Behavioral Assays.

All experiments were approved by the University of Southern California Institutional Animal Care and Use Committee and performed in accordance with the recommendations of the International Association for the Study of Pain and Guide for the Care and Use of Laboratory Animals by the NIH (66). Adult (at least 8 wk of age) WT or GFRα3−/− mice (a gift from Brian Davis, University of Pittsburgh, Children's Hospital of Pittsburgh, Pittsburgh, PA) of both sexes were used in behavioral assays. All results from behavioral assays are shown as averages ± SEMs for each group, and statistical differences were determined using the appropriate t test for all, except the evaporative cooling assay, for which statistical differences were determined using the Mann–Whitney and Wilcoxon tests.

Electronic von Frey.

Stimulation with an electronic von Frey apparatus (IITC) was performed as previously described (23). Briefly, animals were acclimated to an elevated mesh platform for 20 min. The apparatus was fitted with a semiflexible tip and raised to the plantar surface of the hind paw. The force at which the mouse removed the paw was measured, and average paw withdraw threshold was measured per foot from three trials per foot, alternating paws, with 3 min between trials.

Hargreaves test.

To evaluate hind paw sensitivity to noxious heat, the Hargreaves test was performed as previously described (8). Mice were allowed to acclimate in Plexiglas chambers placed on a glass surface heated to 32 °C (Plantar Test Apparatus; IITC) for 2 h. A radiant heat source was focused on the hind paw, and the time to withdrawal of the paw was measured, with an interstimulation period of 5 min per mouse, alternating paws, for a total of four trials per paw for each time point. The readings from the four trials were averaged to give the withdrawal latency.

Cold plantar assay.

To assess cold sensitivity in a manner comparable with that of the Hargreaves test, the cold plantar assay was performed (19). Mice were acclimated in Plexiglas chambers placed on a glass plate for 3 h. A dry ice pellet was then applied to the hind paw of the mouse through the glass, and the latency to withdrawal was recorded, with an interstimulation period of 5 min per mouse, alternating paws, for a total of four trials per paw for each time point. The thickness of the glass (6 mm) was such that latencies were 8–12 s at baseline.

Evaporative cooling assay.

To evaluate cold sensitivity of the hind paws, the acetone evaporative cooling assay was performed as previously described (23). Briefly, mice were acclimated for 20 min in an elevated chamber with a mesh floor (IITC), and a small drop of acetone (∼50 µL) was deposited on the paw plantar surface of the hind paw using the tip of a 10-mL syringe. Mice were tested with an interstimulation period of 4 min per mouse, alternating paws between stimulations, for a total of four trials per paw for each time point. Responses were video-recorded for later quantification by an observer blind to genotype and the solution injected. Behaviors were scored according to the magnitude of the response along the following scale: 0, no response; 1, brief lift, sniff, flick, or startle; 2, jumping or paw shaking; 3, multiple lifts or paw lick; 4, prolonged paw lifting, licking, shaking, or jumping; and 5, paw guarding (22–24).

Artemin and NGF injections.

Artemin and NGF injections to the hind paw were performed as described previously (8). Briefly, mice were lightly anesthetized with isofluorane, and 20 μL vehicle (0.9% saline), artemin (diluted to 10 μg/mL in saline; R&D Systems), or NGF (diluted to 10 μg/mL in saline; Life Technologies) was administered by intraplantar injection.

Pain models.

Inflammation was induced unilaterally by intraplantar injection of 20 μL CFA into the hind paw. Mice were tested 2 d after injection for cold and mechanical sensitivity and 3 d after injection for heat sensitivity.

The CCI model was used to evaluate neuropathic pain as previously described (22, 25). Mice were anesthetized with 5% (vol/vol) isofluorane for induction and 3% (vol/vol) isofluorane for maintenance. The surface of the left hind limb was shaved and sterilized. A 2-cm incision was made in the skin, and the muscles overlaying the sciatic nerve were gently retracted. Three loose ligatures of 6-0 chromic gut were tied around the nerve proximal to the trifurcation site. The muscles were replaced, and the wound was closed with VetBond Tissue Adhesive (3M) and swabbed with topical antibiotic. Animals were monitored for infection and proper wound healing and tested on day 7 postsurgery.

The oxaliplatin model was used to test chemotherapeutic-induced neuropathic pain. Oxaliplatin (dissolved in 5% glucose in saline; Sigma-Aldrich) was administered by i.p. injection at a concentration of 3 mg/kg. Mice were tested on day 3 postinjection for von Frey, day 4 for evaporative cooling, and day 7 for cold plantar assays.

Antibody administration.

Antiartemin antibody (MAB1085; Rat IgG2A; R&D Systems) or isotype control (MAB006; Rat IgG2A) was dissolved in saline and injected s.c. to the scruff at a concentration of 10 mg/kg. For CFA, antibodies were injected on day 2 post-CFA for acetone, cold plantar, and von Frey assays and day 3 for Hargreaves. For oxaliplatin, antibodies were injected on day 7 postoxaliplatin for cold plantar and von Frey. In all cases, responses were measured 4 h postantibody injection. For oxaliplatin, an additional time point for the cold plantar assay was assessed 24 h after antibody injection. For NGF injections, mice were injected with the antiartemin antibody, and then, unilateral plantar NGF injections were performed as described above 1 h later.

Immunohistochemistry.

To study the neurochemical profile of TRPM8 neurons in GFRα3−/− sensory ganglia, TRPM8GFP mice were crossed with the GFRα3−/− line to obtain TRPM8GFP-GFRα3+/− mice, which were then crossed with each other. As has been previously described (8, 67), immunolabeling was carried out on sections of L4–L6 DRG dissected from adult (at least 8-wk-old) TRPM8GFP or TRPM8GFP-GFRα3−/− mice. Primary antibodies were diluted in a working solution (0.3% Triton X-100, 1–5% normal donkey serum in PBS, pH 7.4). Primary antibodies and dilutions used are as follows: 1:500 chicken anti-GFP (GFP-1020; Aves Labs), 1:200 goat anti-GFRα3 (GT15123; Neuromics), 1:500 guinea pig anticalcitonin gene-related peptide (T-5027; Bachem), 1:500 rabbit antiperipherin (AB1530; Millipore), 1:500 rabbit anti-NF200 (N4142; Sigma-Aldrich), and 1:500 guinea pig anti-TRPV1 (a gift from David Julius, University of California, San Francisco). Sections were incubated with primary antibody solutions at 4 °C for 24–48 h, washed, and incubated with the appropriate Alexa Fluor-conjugated secondary antibody solutions (1:1,000 Alexa Fluor 350, Alexa Fluor 488, or Alexa Fluor 594; Molecular Probes) at room temperature for 1–2 h. To detect IB4 binding, 1:2,000 Griffonia simplicifolia isolectin GS-IB4-Alexa 568 (I-21412; Life Technologies) was added to the secondary antibody solutions. Slides were washed and mounted in ProLong Gold Reagent (Life Technologies). Digital images were acquired using a Zeiss Axio Imager.M2 with an Apotome attachment and Axiovision software and analyzed using ImageJ. Quantification is reported as the percentage overlap between two or three markers plus or minus the SE between fields (68), and statistical differences were determined using the unpaired t test.

Quantitative PCR Analysis.

To determine whether the lack of GFRα3−/− receptors influenced the expression levels of genes implicated in nociception and thermal sensitivity, quantitative PCR analysis was performed. DRG were harvested from Gfrα3−/− mice or WT littermate controls and placed in RNAlater Buffer (Qiagen), and total RNA was purified using the RNeasy Mini Kit (Qiagen) with in-column DNA digestion according to the manufacturer’s instructions. The iScript cDNA Synthesis Kit (Bio-Rad) was used to synthesize cDNA from the purified RNA samples, and quantitative PCR was performed using Ssofast EvaGreen Supermix (Bio-Rad) and a Bio-Rad CFX96 Detection System. All samples were run in duplicate, and delta cycle threshold (ΔCt) values normalized to the reference standard were obtained as follows: ΔCt = Ct (gene of interest) − Ct (GAPDH). Relative changes in expression were calculated using the ΔΔCt method. The primers used are listed below:

  • TRPM8 FWD: 5′ GCTGCCTGAAGAGGAAATTG 3′ (600 bp),

  • TRPM8 REV: 5′ GCCCAGATGAAGAGAGCTTG 3′,

  • TRPV1 FWD: 5′ CTTCAGCCATCGCAAGGAGT 3′ (769 bp),

  • TRPV1 REV: 5′ GTTTCTCCCTGAAACTCGGC 3′,

  • TRPA1 FWD: 5′ ACAAGAAGTACCAAACATTGACACA 3′ (243 bp),

  • TRPA1 REV: 5′ TTAACTGCGTTTAAGACAAAATTCC 3′,

  • Nav1.6 FWD: 5′ TCCCAGGCCTGAAGACAATC 3′ (445 bp),

  • Nav1.6 REV: 5′ GCTCGTAAGGTCAGCTGGTAT 3′,

  • Nav1.8 FWD: 5′ ACCAGCAGACACTCCGGGCT 3′ (457 bp),

  • Nav1.8 REV: 5′ ACGTCTTGGCTGGGTGCTCG 3′,

  • TREK1 FWD: 5′ GAGATACAGACTGCTGGCATAG 3′ (229 bp),

  • TREK1 REV: 5′ GTAGATGTAAGTACGGGCACAG 3′,

  • TRAAK FWD: 5′ TTATGTACCCGGCGATGGCACCGG 3′ (127 bp),

  • TRAAK REV: 5′ TGCTCGCAACCAGTTGCCGATG 3′,

  • TASK3 FWD: 5′ GGAACACCTACTTCCGGTCC 3′ (169 bp),

  • TASK3 REV: 5′ GGGAAAGAGGAGTTGGGACAAT 3′,

  • GAPDH FWD: 5′ TGTAGACCATGTAGTGAGGTCA 3′ (123 bp), and

  • GAPDH REV: 5′ AGGTCGGTGTGAACGGATTTG 3′.

Acknowledgments

We thank Dr. Brian Davis (University of Pittsburgh) for providing Gfrα3-null mice and the members of the laboratory of D.D.M. for helpful insights and discussions throughout the completion of this project. This work was supported by National Institute of Neurological Disorders and Stroke Grants NS087542 (to D.D.M.) and NS078530 (to D.D.M.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1603294113/-/DCSupplemental.

References

  • 1.Basbaum AI, Bautista DM, Scherrer G, Julius D. Cellular and molecular mechanisms of pain. Cell. 2009;139(2):267–284. doi: 10.1016/j.cell.2009.09.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Knowlton WM, McKemy DD. TRPM8: From cold to cancer, peppermint to pain. Curr Pharm Biotechnol. 2011;12(1):68–77. doi: 10.2174/138920111793937961. [DOI] [PubMed] [Google Scholar]
  • 3.Svendsen KB, Jensen TS, Hansen HJ, Bach FW. Sensory function and quality of life in patients with multiple sclerosis and pain. Pain. 2005;114(3):473–481. doi: 10.1016/j.pain.2005.01.015. [DOI] [PubMed] [Google Scholar]
  • 4.Greenspan JD, Ohara S, Sarlani E, Lenz FA. Allodynia in patients with post-stroke central pain (CPSP) studied by statistical quantitative sensory testing within individuals. Pain. 2004;109(3):357–366. doi: 10.1016/j.pain.2004.02.002. [DOI] [PubMed] [Google Scholar]
  • 5.Lampert A, O’Reilly AO, Reeh P, Leffler A. Sodium channelopathies and pain. Pflugers Arch. 2010;460(2):249–263. doi: 10.1007/s00424-009-0779-3. [DOI] [PubMed] [Google Scholar]
  • 6.Ji RR, Xu ZZ, Gao YJ. Emerging targets in neuroinflammation-driven chronic pain. Nat Rev Drug Discov. 2014;13(7):533–548. doi: 10.1038/nrd4334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Julius D. TRP channels and pain. Annu Rev Cell Dev Biol. 2013;29:355–384. doi: 10.1146/annurev-cellbio-101011-155833. [DOI] [PubMed] [Google Scholar]
  • 8.Lippoldt EK, Elmes RR, McCoy DD, Knowlton WM, McKemy DD. Artemin, a glial cell line-derived neurotrophic factor family member, induces TRPM8-dependent cold pain. J Neurosci. 2013;33(30):12543–12552. doi: 10.1523/JNEUROSCI.5765-12.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Linte RM, Ciobanu C, Reid G, Babes A. Desensitization of cold- and menthol-sensitive rat dorsal root ganglion neurones by inflammatory mediators. Exp Brain Res. 2007;178(1):89–98. doi: 10.1007/s00221-006-0712-3. [DOI] [PubMed] [Google Scholar]
  • 10.Andersson DA, Chase HW, Bevan S. TRPM8 activation by menthol, icilin, and cold is differentially modulated by intracellular pH. J Neurosci. 2004;24(23):5364–5369. doi: 10.1523/JNEUROSCI.0890-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhang X, et al. Direct inhibition of the cold-activated TRPM8 ion channel by Gαq. Nat Cell Biol. 2012;14(8):851–858. doi: 10.1038/ncb2529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lewin GR, Rueff A, Mendell LM. Peripheral and central mechanisms of NGF-induced hyperalgesia. Eur J Neurosci. 1994;6(12):1903–1912. doi: 10.1111/j.1460-9568.1994.tb00581.x. [DOI] [PubMed] [Google Scholar]
  • 13.Yu T, et al. Expression of GDNF family receptor components during development: Implications in the mechanisms of interaction. J Neurosci. 1998;18(12):4684–4696. doi: 10.1523/JNEUROSCI.18-12-04684.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Poteryaev D, et al. GDNF triggers a novel ret-independent Src kinase family-coupled signaling via a GPI-linked GDNF receptor alpha1. FEBS Lett. 1999;463(1-2):63–66. doi: 10.1016/s0014-5793(99)01590-2. [DOI] [PubMed] [Google Scholar]
  • 15.Trupp M, Scott R, Whittemore SR, Ibáñez CF. Ret-dependent and -independent mechanisms of glial cell line-derived neurotrophic factor signaling in neuronal cells. J Biol Chem. 1999;274(30):20885–20894. doi: 10.1074/jbc.274.30.20885. [DOI] [PubMed] [Google Scholar]
  • 16.Schmutzler BS, Roy S, Pittman SK, Meadows RM, Hingtgen CM. Ret-dependent and Ret-independent mechanisms of Gfl-induced sensitization. Mol Pain. 2011;7:22. doi: 10.1186/1744-8069-7-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Nishino J, et al. GFR alpha3, a component of the artemin receptor, is required for migration and survival of the superior cervical ganglion. Neuron. 1999;23(4):725–736. doi: 10.1016/s0896-6273(01)80031-3. [DOI] [PubMed] [Google Scholar]
  • 18.Honma Y, et al. Artemin is a vascular-derived neurotropic factor for developing sympathetic neurons. Neuron. 2002;35(2):267–282. doi: 10.1016/s0896-6273(02)00774-2. [DOI] [PubMed] [Google Scholar]
  • 19.Brenner DS, Golden JP, Gereau RW., 4th A novel behavioral assay for measuring cold sensation in mice. PLoS One. 2012;7(6):e39765. doi: 10.1371/journal.pone.0039765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Carmillo P, et al. Glial cell line-derived neurotrophic factor (GDNF) receptor alpha-1 (GFR alpha 1) is highly selective for GDNF versus artemin. Biochemistry. 2005;44(7):2545–2554. doi: 10.1021/bi049247p. [DOI] [PubMed] [Google Scholar]
  • 21.Baloh RH, et al. Artemin, a novel member of the GDNF ligand family, supports peripheral and central neurons and signals through the GFRalpha3-RET receptor complex. Neuron. 1998;21(6):1291–1302. doi: 10.1016/s0896-6273(00)80649-2. [DOI] [PubMed] [Google Scholar]
  • 22.Knowlton WM, et al. A sensory-labeled line for cold: TRPM8-expressing sensory neurons define the cellular basis for cold, cold pain, and cooling-mediated analgesia. J Neurosci. 2013;33(7):2837–2848. doi: 10.1523/JNEUROSCI.1943-12.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Knowlton WM, Daniels RL, Palkar R, McCoy DD, McKemy DD. Pharmacological blockade of TRPM8 ion channels alters cold and cold pain responses in mice. PLoS One. 2011;6(9):e25894. doi: 10.1371/journal.pone.0025894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Colburn RW, et al. Attenuated cold sensitivity in TRPM8 null mice. Neuron. 2007;54(3):379–386. doi: 10.1016/j.neuron.2007.04.017. [DOI] [PubMed] [Google Scholar]
  • 25.Bennett GJ, Xie YK. A peripheral mononeuropathy in rat that produces disorders of pain sensation like those seen in man. Pain. 1988;33(1):87–107. doi: 10.1016/0304-3959(88)90209-6. [DOI] [PubMed] [Google Scholar]
  • 26.Ventzel L, et al. Assessment of acute oxaliplatin-induced cold allodynia: A pilot study. Acta Neurol Scand. June 2, 2015 doi: 10.1111/ane.12443. [DOI] [PubMed] [Google Scholar]
  • 27.Elitt CM, et al. Artemin overexpression in skin enhances expression of TRPV1 and TRPA1 in cutaneous sensory neurons and leads to behavioral sensitivity to heat and cold. J Neurosci. 2006;26(33):8578–8587. doi: 10.1523/JNEUROSCI.2185-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ikeda-Miyagawa Y, et al. Peripherally increased artemin is a key regulator of TRPA1/V1 expression in primary afferent neurons. Mol Pain. 2015;11:8. doi: 10.1186/s12990-015-0004-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Palkar R, Lippoldt EK, McKemy DD. The molecular and cellular basis of thermosensation in mammals. Curr Opin Neurobiol. 2015;34:14–19. doi: 10.1016/j.conb.2015.01.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.McKemy DD. The molecular and cellular basis of cold sensation. ACS Chem Neurosci. 2013;4(2):238–247. doi: 10.1021/cn300193h. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.McKemy DD, Neuhausser WM, Julius D. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature. 2002;416(6876):52–58. doi: 10.1038/nature719. [DOI] [PubMed] [Google Scholar]
  • 32.Orozco OE, Walus L, Sah DW, Pepinsky RB, Sanicola M. GFRalpha3 is expressed predominantly in nociceptive sensory neurons. Eur J Neurosci. 2001;13(11):2177–2182. doi: 10.1046/j.0953-816x.2001.01596.x. [DOI] [PubMed] [Google Scholar]
  • 33.Thornton P, et al. Artemin-GFRα3 interactions partially contribute to acute inflammatory hypersensitivity. Neurosci Lett. 2013;545:23–28. doi: 10.1016/j.neulet.2013.04.007. [DOI] [PubMed] [Google Scholar]
  • 34.DeBerry JJ, Saloman JL, Dragoo BK, Albers KM, Davis BM. Artemin immunotherapy is effective in preventing and reversing cystitis-induced bladder hyperalgesia via TRPA1 regulation. J Pain. 2015;16(7):628–636. doi: 10.1016/j.jpain.2015.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Shinoda M, et al. Involvement of peripheral artemin signaling in tongue pain: Possible mechanism in burning mouth syndrome. Pain. 2015;156(12):2528–2537. doi: 10.1097/j.pain.0000000000000322. [DOI] [PubMed] [Google Scholar]
  • 36.Chuang HH, et al. Bradykinin and nerve growth factor release the capsaicin receptor from PtdIns(4,5)P2-mediated inhibition. Nature. 2001;411(6840):957–962. doi: 10.1038/35082088. [DOI] [PubMed] [Google Scholar]
  • 37.Prescott ED, Julius D. A modular PIP2 binding site as a determinant of capsaicin receptor sensitivity. Science. 2003;300(5623):1284–1288. doi: 10.1126/science.1083646. [DOI] [PubMed] [Google Scholar]
  • 38.Tsui-Pierchala BA, Milbrandt J, Johnson EM., Jr NGF utilizes c-Ret via a novel GFL-independent, inter-RTK signaling mechanism to maintain the trophic status of mature sympathetic neurons. Neuron. 2002;33(2):261–273. doi: 10.1016/s0896-6273(01)00585-2. [DOI] [PubMed] [Google Scholar]
  • 39.Woolf CJ, Ma QP, Allchorne A, Poole S. Peripheral cell types contributing to the hyperalgesic action of nerve growth factor in inflammation. J Neurosci. 1996;16(8):2716–2723. doi: 10.1523/JNEUROSCI.16-08-02716.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Bennett G, al-Rashed S, Hoult JR, Brain SD. Nerve growth factor induced hyperalgesia in the rat hind paw is dependent on circulating neutrophils. Pain. 1998;77(3):315–322. doi: 10.1016/S0304-3959(98)00114-6. [DOI] [PubMed] [Google Scholar]
  • 41.Bennett DL. Neurotrophic factors: Important regulators of nociceptive function. Neuroscientist. 2001;7(1):13–17. doi: 10.1177/107385840100700105. [DOI] [PubMed] [Google Scholar]
  • 42.Murota H, et al. Artemin causes hypersensitivity to warm sensation, mimicking warmth-provoked pruritus in atopic dermatitis. J Allergy Clin Immunol. 2012;130(3):671–682.e4. doi: 10.1016/j.jaci.2012.05.027. [DOI] [PubMed] [Google Scholar]
  • 43.Weinkauf B, et al. Local gene expression changes after UV-irradiation of human skin. PLoS One. 2012;7(6):e39411. doi: 10.1371/journal.pone.0039411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Osikowicz M, Longo G, Allard S, Cuello AC, Ribeiro-da-Silva A. Inhibition of endogenous NGF degradation induces mechanical allodynia and thermal hyperalgesia in rats. Mol Pain. 2013;9:37. doi: 10.1186/1744-8069-9-37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Malin SA, et al. Glial cell line-derived neurotrophic factor family members sensitize nociceptors in vitro and produce thermal hyperalgesia in vivo. J Neurosci. 2006;26(33):8588–8599. doi: 10.1523/JNEUROSCI.1726-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Elitt CM, Malin SA, Koerber HR, Davis BM, Albers KM. Overexpression of artemin in the tongue increases expression of TRPV1 and TRPA1 in trigeminal afferents and causes oral sensitivity to capsaicin and mustard oil. Brain Res. 2008;1230:80–90. doi: 10.1016/j.brainres.2008.06.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Jankowski MP, et al. Sensitization of cutaneous nociceptors after nerve transection and regeneration: Possible role of target-derived neurotrophic factor signaling. J Neurosci. 2009;29(6):1636–1647. doi: 10.1523/JNEUROSCI.3474-08.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Devesa I, Ferrer-Montiel A. Neurotrophins, endocannabinoids and thermo-transient receptor potential: A threesome in pain signalling. Eur J Neurosci. 2014;39(3):353–362. doi: 10.1111/ejn.12455. [DOI] [PubMed] [Google Scholar]
  • 49.Airaksinen MS, Saarma M. The GDNF family: Signalling, biological functions and therapeutic value. Nat Rev Neurosci. 2002;3(5):383–394. doi: 10.1038/nrn812. [DOI] [PubMed] [Google Scholar]
  • 50.Paratcha G, Ledda F, Ibáñez CF. The neural cell adhesion molecule NCAM is an alternative signaling receptor for GDNF family ligands. Cell. 2003;113(7):867–879. doi: 10.1016/s0092-8674(03)00435-5. [DOI] [PubMed] [Google Scholar]
  • 51.Cao JP, et al. Integrin beta1 is involved in the signaling of glial cell line-derived neurotrophic factor. J Comp Neurol. 2008;509(2):203–210. doi: 10.1002/cne.21739. [DOI] [PubMed] [Google Scholar]
  • 52.Jin X, et al. Modulation of TRPV1 by nonreceptor tyrosine kinase, c-Src kinase. Am J Physiol Cell Physiol. 2004;287(2):C558–C563. doi: 10.1152/ajpcell.00113.2004. [DOI] [PubMed] [Google Scholar]
  • 53.Zhuang ZY, Xu H, Clapham DE, Ji RR. Phosphatidylinositol 3-kinase activates ERK in primary sensory neurons and mediates inflammatory heat hyperalgesia through TRPV1 sensitization. J Neurosci. 2004;24(38):8300–8309. doi: 10.1523/JNEUROSCI.2893-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Ji RR, Samad TA, Jin SX, Schmoll R, Woolf CJ. p38 MAPK activation by NGF in primary sensory neurons after inflammation increases TRPV1 levels and maintains heat hyperalgesia. Neuron. 2002;36(1):57–68. doi: 10.1016/s0896-6273(02)00908-x. [DOI] [PubMed] [Google Scholar]
  • 55.Zhu W, Oxford GS. Phosphoinositide-3-kinase and mitogen activated protein kinase signaling pathways mediate acute NGF sensitization of TRPV1. Mol Cell Neurosci. 2007;34(4):689–700. doi: 10.1016/j.mcn.2007.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Bonnington JK, McNaughton PA. Signalling pathways involved in the sensitisation of mouse nociceptive neurones by nerve growth factor. J Physiol. 2003;551(Pt 2):433–446. doi: 10.1113/jphysiol.2003.039990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Gauchan P, Andoh T, Kato A, Kuraishi Y. Involvement of increased expression of transient receptor potential melastatin 8 in oxaliplatin-induced cold allodynia in mice. Neurosci Lett. 2009;458(2):93–95. doi: 10.1016/j.neulet.2009.04.029. [DOI] [PubMed] [Google Scholar]
  • 58.da Costa DS, et al. The involvement of the transient receptor potential A1 (TRPA1) in the maintenance of mechanical and cold hyperalgesia in persistent inflammation. Pain. 2010;148(3):431–437. doi: 10.1016/j.pain.2009.12.002. [DOI] [PubMed] [Google Scholar]
  • 59.del Camino D, et al. TRPA1 contributes to cold hypersensitivity. J Neurosci. 2010;30(45):15165–15174. doi: 10.1523/JNEUROSCI.2580-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Yoshida N, et al. Inhibition of TRPA1 channel activity in sensory neurons by the glial cell line-derived neurotrophic factor family member, artemin. Mol Pain. 2011;7:41. doi: 10.1186/1744-8069-7-41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Descoeur J, et al. Oxaliplatin-induced cold hypersensitivity is due to remodelling of ion channel expression in nociceptors. EMBO Mol Med. 2011;3(5):266–278. doi: 10.1002/emmm.201100134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Morenilla-Palao C, et al. Ion channel profile of TRPM8 cold receptors reveals a role of TASK-3 potassium channels in thermosensation. Cell Reports. 2014;8(5):1571–1582. doi: 10.1016/j.celrep.2014.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Deuis JR, et al. An animal model of oxaliplatin-induced cold allodynia reveals a crucial role for Nav1.6 in peripheral pain pathways. Pain. 2013;154(9):1749–1757. doi: 10.1016/j.pain.2013.05.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Bannwarth B, Kostine M. Targeting nerve growth factor (NGF) for pain management: What does the future hold for NGF antagonists? Drugs. 2014;74(6):619–626. doi: 10.1007/s40265-014-0208-6. [DOI] [PubMed] [Google Scholar]
  • 65.Mantyh PW, Koltzenburg M, Mendell LM, Tive L, Shelton DL. Antagonism of nerve growth factor-TrkA signaling and the relief of pain. Anesthesiology. 2011;115(1):189–204. doi: 10.1097/ALN.0b013e31821b1ac5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.National Institutes of Health . Guide for the Care and Use of Laboratory Animals. 8th Ed National Academies Press; Washington, DC: 2011. [Google Scholar]
  • 67.Takashima Y, et al. Diversity in the neural circuitry of cold sensing revealed by genetic axonal labeling of transient receptor potential melastatin 8 neurons. J Neurosci. 2007;27(51):14147–14157. doi: 10.1523/JNEUROSCI.4578-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Takashima Y, Ma L, McKemy DD. The development of peripheral cold neural circuits based on TRPM8 expression. Neuroscience. 2010;169(2):828–842. doi: 10.1016/j.neuroscience.2010.05.039. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES