Abstract Abstract
As presently recognized, the genus Capoeta includes 24 species, nine of which are known to occur in Iran (Capoeta aculeata, Capoeta capoeta, Capoeta buhsei, Capoeta damascina, Capoeta fusca, Capoeta heratensis, Capoeta mandica, Capoeta saadii and Capoeta trutta) and are distributed in almost all Iranian basins except Sistan and Mashkid. Capoeta coadi sp. n. is a new species from the Karun River, southern Iran, draining into the Arvand Rud (Shatt al-Arab) which drains into the Persian Gulf. It is distinguished from all other species of Capoeta by the combination of the following characters: elongate and usually cylindrical body; 8–9 branched dorsal-fin rays; last unbranched dorsal-fin ray weakly to moderately ossified and serrated along 1/3–2/3 of its length; scales small; 70-84 in lateral line (total); 12–17 scales between dorsal-fin origin and lateral line; 9-11 scales between anal-fin origin and lateral line; 26–32 circum-peduncular scales; 10–13 gill rakers on lower limb of first gill arch; 45–47 total vertebrae; one posterior pair of barbels; bright golden-greenish or silvery body coloration in life; length of the longest dorsal-fin ray 15–22% SL; head length 23–26% SL; mouth width 7–10% SL. Capoeta coadi is also distinguished from all other congeners in the Iranian drainages by fixed diagnostic nucleotide substitutions in the mtDNA COI barcode region and cyt b. It is nested in the Capoeta damascina species complex.
Keywords: Capoeta damascina species complex, COI, Cyt b, Persian Gulf, phylogenetic relationships
Introduction
The Middle East is a transition zone between three major biogeographic units, the Palaearctic, the Afrotropical, and the Oriental realms. It served as an important crossroad of biotic exchange resulting in an outstanding biological diversity of freshwater fishes (Durand et al. 2002, Krupp et al. 2009). Lying between major drainages of the Nile in Africa to the west, the Indus in southern Asia to the east and the Caspian and Black Sea drainages to the north, the Tigris-Euphrates River drainage is the largest river system in the Middle East and has high fish diversity, especially in cyprinid fishes.
Capoeta Valenciennes in Cuvier and Valenciennes 1842 is an example of a cyprinid genus widely spread in the Middle East (Krupp and Schneider 1989). Being found in a wide range of habitats, species of this genus display considerable morphological variability (e.g., scale counts and colour pattern) and the extent of morphological plasticity and genetic variability remain to be determined. As a consequence, there has been considerable disagreement regarding the status of several species. However, Capoeta is considered monophyletic (Krupp 1985, Küçük et al. 2009).
Members of the genus Capoeta are cyprinids characterized by having an elongate, cylindrical body and a short dorsal fin. They have three to five unbranched and 5–9 branched dorsal-fin rays, the last unbranched ray being ossified and serrated. All species have three unbranched and 5 branched anal-fin rays. Scales are usually small. Mouth is inferior and the lower lip is covered with a horny sheath. One pair of barbels (rarely two) is present and the pharyngeal teeth are arranged in three rows. The shape of the mouth as well as the pharyngeal teeth are nearly identical in all species, which indicate their adaptation to the same mode of feeding. This combination of character states distinguishes Capoeta from all other cyprinids (Krupp 1985, Krupp and Schneider 1989).
As presently recognized, the genus Capoeta includes about 24 species (Eschmeyer and Fricke 2016) in different phylogenetic groups widely distributed in many river drainages and basins in southwestern Asia except the Arabian Peninsula (Alwan 2011, Levin et al. 2012). Levin et al. (2012) studied the phylogenetic relationships of the genus Capoeta based on complete mitochondrial gene for cytochrome b sequences obtained from 20 species from the overall range of the genus. Three main groups were detected: the Mesopotamian group (Capoeta trutta group), the Anatolian-Iranian group (Capoeta damascina group) and the Aralo-Caspian group (Capoeta capoeta group).
Members of the Capoeta damascina species group, characterized by having small scales, include Capoeta buhsei Kessler, 1877, Capoeta caelestis Schöter, Özuluğ & Freyhof, 2009, Capoeta damascina (Valenciennes, 1842), Capoeta kosswigi Karaman, 1969, Capoeta saadii (Heckel, 1847), and Capoeta umbla (Heckel, 1843) (Alwan 2011). Based on phylogenetic analyses of (COI) and the large subunit (LSU or 28S) ribosomal RNA gene sequences Alwan (2011) identified two main lineages within what we will refer to in this paper, as the “Capoeta damascina species complex”. A western lineage is represented by Capoeta caelestis, Capoeta damascina and Capoeta umbla and an eastern lineage represented by Capoeta buhsei, Capoeta saadii, and a new undescribed species.
Traditionally, Capoeta damascina is recorded from Tigris, Mond, Kor, Esfahan, Dasht-e Kavir, Namak Lake, Kor River, Lake Maharlu, Persian Gulf (now Persis), Kerman-Na’in, Dasht-e Lut, Sirjan, Hormuz, and Hamun-e Jaz Murian basins in Iran (Nikol’skii 1899, Berg 1949, Kähsbauer 1964, Armantrout 1980, Rainboth 1981, Bianco and Banarescu 1982, Ghorbani Chafi 2000, Jalali et al. 2005, Esmaeili et al. 2010, Bahrami Kamangar et al. 2012). Its distribution over such wide range of isolated water bodies, raises questions regarding the status of Capoeta damascina. Currently, Capoeta damascina s.l. represents a complex of closely related species with high intraspecific and comparatively low interspecific variation (Alwan 2011, Levin et al. 2012). Now, three species of Capoeta from Iranian water bodies are recognized as being members of Capoeta damascina species complex group: Capoeta buhsei, Capoeta saadii (Iranian populations were considered as Capoeta damascina) (see Alwan 2011, Levin et al. 2012), and a new undescribed species from the Karun (Karoun) River drainage. It is described here as a new species, Capoeta coadi.
Material and methods
After anaesthesia, fishes were either fixed in 5% formaldehyde, and stored in 70% ethanol, or directly fixed in 99% ethanol (for molecular studies). Measurements were made with a digital caliper and recorded to 0.01 mm. All measurements were made point to point, and never by projections. Methods for counts and measurements follow Hubbs and Lagler (1958) and Krupp (1983). (SL) was measured from the tip of the snout to the end of the hypural complex. The length of the caudal peduncle was measured from behind the base of the last anal-fin ray to the end of the hypural complex. The last two branched rays articulating on a single pterygiophore in the dorsal and anal fins are counted as “1½”.The holotype is included in the calculation of means and SD.
Abbreviations used: SL; HL.
Abbreviations used for museum collections: (ZM-CBSU), the (SMF: Frankfurt, Germany), and the private collection of (FSJF: Fischsammlung J. Freyhof).
DNA extraction and PCR amplification protocol
For DNA sequencing, specimens were directly fixed in 99% molecular grade ethanol. Mitochondrial DNA was extracted using Salt method (Bruford et al. 1992). The standard vertebrate DNA barcode region of the COI (cytochrome c oxidase subunit 1) and cytochrome b (cyt b) were amplified using primer pairs named FishF1-5'TCAACCAACCACAAAGACATTGGCAC3’ and FishR1-5'TAGACTTCTGGGTGGCCAAAGAATCA3’ (Ward et al. 2005) and L14724-5'GTGACTTGAAAAACCACCGTTG3’ and H15915-5'CAACGATCTCCGGTTTAGAAGAC3’ (Xiao et al. 2001) or GluF- 5'AACCACCGTTGTATTCAACTACAA3’ and H-15560 5`TAGGCRAATAGGAAR TATCA3` (Machordom and Doadrio 2001), respectively.
Purification and sequencing of the PCR products were conducted at Macrogen Korea Laboratories using the aforementioned primer sets.
Molecular data analyses
Data processing and sequence assembly was done in BioEdit 7.2.5 (Hall 1999); MEGA6 (Tamura et al. 2013) was used to create a DNA sequence alignment. No indications of unexpected stop-codons or nuclear copies of mitochondrial fragments occurred in any sequences. All generated DNA barcodes and cyt b were deposited in the NCBI GenBank. The most appropriate sequence evolution model for the given data was determined with Modeltest (Posada and Crandall 1998) as implemented in the MEGA6 software, treating gaps and missing data with the partial deletion option under 95% site coverage cut-off. The model with the lowest BIC score is considered the best model to describe the substitution pattern for each gene. To explore species phylogenetic relationships, trees were generated using Maximum Likelihood analysis with 10,000 bootstrap replicates in RaxML 7.2.5 (Stamatakis 2006) under the GTR+G model of nucleotide substitution, with fast bootstrap and also (BA), using the (MCMC), with 6,000,000 generations under the most generalizing model (GTR+G+I) using Mr. Bayes 3.1.1 (Huelsenbeck and Ronquist 2001). Screening for diagnostic nucleotide substitutions was performed manually from the sequence alignment. As an appropriate outgroup to root the constructed phylogenetic hypothesis, we included the distantly related Cyprinus carpio.
Results
Morphological assessments
Capoeta coadi sp. n.
http://zoobank.org/4B5B0984-0C65-4B6D-97CC-31245E179D13
Figure 1.
Capoeta coadi sp. n., ZM-CBSU Z190, holotype, 157 mm SL; Iran: Kohgiluyeh and Boyer Ahmad, Beshar River, Karun River drainage.
Figure 2.
Capoeta coadi sp. n., paratypes: a ZM-CBSU Z191; 157 mm SL b ZM-CBSU Z192, 148 mm SL; Iran: Kohgiluyeh and Boyer Ahmad, Beshar River, Karun River drainage.
Figure 3.
Live specimen of Capoeta coadi sp. n, Iran: Kohgiluyeh and Boyer Ahmad, Beshar River, Karun River drainage.
Holotype.
ZM-CBSU Z190, 157 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar (Bashar) River at Tale Gah village, Karun River drainage, 30°47'27"N, 51°25'13"E.
Paratypes.
ZM-CBSU Z191, 6, 91–157 mm SL; same data as holotype. ZM-CBSU J520, 1, 107 mm SL; ZM-CBSU Z275, 12, 105–152 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar (Bashar) River at Tale Gah village, Karun River drainage, 30°47'27"N, 51°25'13"E. 15 December 2014, G. Sayyadzadeh, R. Khaefi, A. Khajehpanah. ZM-CBSU J526, 1, 98 mm SL; ZM-CBSU J533, 1, 114 mm SL; ZM-CBSU J535, 1, 97 mm SL; ZM-CBSU J540, 1, 67 mm SL; All from Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tange sorkh, Karun River drainage, 30°26'14"N, 51°45'48"E. 24 July 2011, R. Zamaneian Nejad, S. Mirgheiasi, S. Ghasemian. ZM-CBSU J444, 2, 73–90 mm SL; ZM-CBSU J447, 2, 76–111 mm SL; ZM-CBSU J450, 1, 86 mm SL; ZM-CBSU J452, 1, 107 mm SL; ZM-CBSU J459, 2, 104–120 mm SL; ZM-CBSU J464, 1, 110 mm SL; all from Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Mokhtar village, Karun River drainage, 30°40'31"N, 51°31'26"E. 25 May 2011, R. Zamaneian Nejad.
Additional material.
ZM-CBSU 7880–7881, 2, 96.69–158.12 mm SL; Iran, Fars prov., Sepidan city, Gorgu River, a tributary of Beshar River, north of Sepidan city, Karun River drainage, 30°21.283'N, 51°45.754'E. 2006. H.R. Esmaeili, A. Teimori, M. Ebrahimi and A. Gholamhoseini. SMF 33337, 1, 48.86 mm SL; Iran, Lorestan prov., Hadi River between Zagheh and Polehoru, 33°31.138'N, 48°46.340'E. 04 March 2008. N. Alwan, K. Borkenhagen, M. Ghanbari Fardi and A. Kazemi. FSJF 2213, 11, 107.92–143.94 mm SL; Iran, Chaharmahal and Bakhtiari Prov., Sandgan River (Sandgan stream) at Sandgan, 31°15.692'N, 51°17.150'E. 19 April 2007, A. Abdoli and J. Freyhof. FSJF 2233, 2, 156.22–162.23 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River, 20 km northeast of Yasuj, 30°44.152'N, 51°29.522'E. 19 April 2007. A. Abdoli and J. Freyhof. SMF 30865, 1, 26.94 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tang-e Sorkh, 30°27.680'N, 51°44.907'E. 28 November 2007, K. Borkenhagen, H. R. Esmaeili and F. Wicker (in 96% alcohol). SMF 30871, 1, 28.34 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tang-e Sorkh, 30°27.680'N, 51°44.907'E. 28 November 2007. K. Borkenhagen, H. R. Esmaeili and F. Wicker (in 96% alcohol). SMF 33316, 7, 35.22–166.87 mm SL; Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tang-e Sorkh, 30°27.680'N, 51°44.907'E. 28 November 2007, K. Borkenhagen, H. R. Esmaeili and F. Wicker. SMF 30872, 1, 29.70 mm SL; Iran, Fars prov., Sepidan, Tang-e Tizab, 30°23.470'N, 51°46.710'E, 28 November 2007, K. Borkenhagen, H. R. Esmaeili and F. Wicker (in 96% alcohol).
Capoeta coadi specimens used for molecular genetic analysis.
ZM-CBSU M1275,1, Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Dehno village, Karun River drainage, 30°38'55"N, 51°37'05"E. 16 January 2014, H.R. Esmaeili, G. Sayyadzadeh, H.R. Mehraban, M. Razbani. GenBank accession number: (COI: KU564296); ZM-CBSU M1447, 2, GenBank accession number: (COI: KU564297, KU564298; cytb: KU564303, KU564304) ZM-CBSU M1458, 2); Iran, Kohgiluyeh and Boyer Ahmad prov., Beshar River at Tale Gah village, Karun River drainage, 30°47'27"N, 51°25'13"E. 14 December 2013. G. Sayyadzadeh, A. Khajehpanah, R. Khaefi. GenBank accession number: (COI: KU564294, KU564295; cytb: KU564305, KU564306).
Diagnosis.
Capoeta coadi sp. n. is distinguished from all other species of Capoeta by the following combination of characters: last unbranched dorsal-fin ray weakly to moderately ossified and serrated in 1/3–2/3 of its length; scales small, 70–84 total lateral line scales (84 in holotype), 12–17 scales between dorsal-fin origin and lateral line (16 in holotype), 9–11 scales between anal-fin origin and lateral line (11 in holotype), 26–32 encircling least circumference of caudal peduncle (31 in holotype); total gill rakers 14–18 (17 in holotype), 10–13 gill rakers on lower limb of first gill arch (12 in holotype); 45–47 total vertebrae; one posterior pair of barbels; length of the longest dorsal-fin ray 14.92–21.58% SL (18.90 in holotype); head length 22.87–26.33% SL (23.76 in holotype); mouth width 7.48–9.77% SL (8.65 in holotype); bright golden-greenish or silvery body coloration in life.
Description.
General body shape and appearance are shown in Figs 1–3, morphometric data in Table 1 and meristic data are summarized in Tables 2–9. Body elongate and cylindrical; predorsal body profile smoothly convex with no marked discontinuity between head and body except when a nuchal hump is present in few specimens; greatest body depth at level of dorsal-fin origin; snout rounded (in 20 specimens) or pointed (in 14 specimens) and not size dependent; mouth inferior; lips slightly fleshy, especially at the mouth corners; lower lip covered with a sharp-edged horny sheath, its anterior margin straight in adult specimens and rounded to almost crescent-shaped in juveniles, with a considerable degree of individual variation.
Table 1.
Morphometric data of Capoeta coadi sp. n. (holotype ZM-CBSU Z190, and 33 paratypes), Capoeta buhsei and Capoeta saadii.
| Holotype | Paratypes (n=33) | Capoeta buhsei (n=27) | Capoeta saadii (n=20) | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Range | Mean | SD | Range | Mean | SD | Range | Mean | SD | ||
| Standard length (mm) | 157.64 | 67.23–157.64 | 110.67 | 74.30–149.30 | 112.56 | 51.31–231 | 109.30 | |||
| In percent of standard length | ||||||||||
| Head length | 23.76 | 22.87–26.33 | 24.5 | 0.80 | 21.47–25.98 | 23.56 | 0.98 | 24.28–29.62 | 26.84 | 1.32 |
| Body depth at dorsal-fin origin | 21.82 | 21.33–25.04 | 23.15 | 0.98 | 19.78–24.55 | 21.82 | 1.19 | 19.58–27.78 | 23.32 | 2.11 |
| Predorsal length | 49.07 | 47.75–53.43 | 50.23 | 1.31 | 48.85–55.05 | 51.59 | 1.34 | 44.33–55.12 | 51.93 | 2.51 |
| Postdorsal length | 54.13 | 54.13–63.19 | 57.53 | 1.88 | 48.20–60.13 | 55.24 | 2.78 | 50.79–59.64 | 55.06 | 2.60 |
| Preanal length | 72.45 | 70.22–76.14 | 72.8 | 1.36 | 71.34–76.34 | 74.01 | 1.28 | 69.37–78.38 | 75.61 | 2.07 |
| Prepelvic length | 53.74 | 50.22–55.90 | 52.84 | 1.31 | 50.17–56.64 | 53.58 | 1.49 | 51.23–61.21 | 56.22 | 2.36 |
| Distance between pectoral and pelvic-fin origins | 32.42 | 27.81–32.42 | 30.19 | 1.13 | 29.07–33.64 | 31.30 | 1.04 | 25.55–32.66 | 30.87 | 2.15 |
| Distance between pelvic and anal-fin origins | 21.48 | 19.31–23.17 | 21.12 | 0.88 | 19.90–23.65 | 21.60 | 0.91 | 18.32–23.41 | 20.83 | 1.56 |
| Depth of caudal peduncle | 10.37 | 10.03–11.61 | 10.65 | 0.37 | 8.58–10.84 | 10.05 | 0.50 | 8.98–11.15 | 10.43 | 0.60 |
| Length of caudal peduncle | 20.73 | 17.16–22. 35 | 19.85 | 1.14 | 18.64–22.01 | 19.81 | 0.91 | 15.19–20.11 | 17.67 | 1.30 |
| Dorsal-fin base length | 12.71 | 12.27–16.17 | 14.41 | 0.89 | 11.75–15.28 | 13.51 | 0.80 | 10.46–14.39 | 12.98 | 1.11 |
| Anal-fin base length | 6.78 | 6.38–8.85 | 7.39 | 0.55 | 6.96–8.80 | 7.88 | 0.58 | 6.24–8.27 | 7.17 | 0.60 |
| Pectoral-fin length | 17.32 | 16.68–20.46 | 18.43 | 0.89 | 16.39–20.96 | 18.38 | 0.99 | 16.15–19.16 | 17.86 | 1.01 |
| Pelvic-fin length | 15.05 | 14.24–16.96 | 15.61 | 0.68 | 13.85–18.08 | 15.61 | 1.08 | 13.58–16.23 | 15.08 | 0.82 |
| Length of the longest dorsal fin ray | 18.90 | 14.92–21.58 | 19.57 | 1.27 | 16.42–21.22 | 18.78 | 1.06 | 16.35–21.53 | 19.03 | 1.47 |
| Mouth width | 8.65 | 7.48–9.77 | 8.63 | 0.51 | 6.49–8.89 | 7.87 | 0.57 | 6.51–9.38 | 8.1 | 0.73 |
| In percent of head length | ||||||||||
| Head depth at eye | 56.88 | 49.05–61.87 | 54.21 | 2.73 | 48.01–56.63 | 67.01 | 2.26 | 49.17–57.97 | 65.47 | 3.96 |
| Snout length | 38.32 | 31.60–47.70 | 38.08 | 2.60 | 32.69–38.89 | 35.55 | 1.67 | 32.65–40.61 | 36.18 | 2.41 |
| Postorbital distance | 48.83 | 33.82–51.84 | 48.01 | 3.01 | 47.66–56.59 | 51.57 | 1.89 | 46.58–54.84 | 51.05 | 2.28 |
| Interorbital width | 40.04 | 34.62–42.81 | 38.19 | 1.98 | 33.88–41.49 | 37.15 | 1.93 | 30.90–40.16 | 35.57 | 2.70 |
| Eye diameter | 15.97 | 15.07–23.57 | 18.52 | 2.36 | 13.91–24.44 | 17.36 | 2.11 | 11.95–26.18 | 18.23 | 3.43 |
| Maximum head width | 60.53 | 51.75–66.89 | 59.60 | 3.99 | 57.83–69.68 | 62.76 | 3.04 | 47.38–59.00 | 54.62 | 3.39 |
| Barbel length | 15.14 | 13.30–20.20 | 16.25 | 1.66 | 15.66–24.60 | 19.71 | 2.27 | 13.34–24.64 | 18.11 | 2.73 |
Table 2.
Number of pectoral and pelvic fin rays in examined Capoeta species.
| Pectoral fin rays | Pelvic fin rays | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 7 | 8 | 9 | 10 | 11 | ||
| Capoeta buhsei | 2 | 10 | 4 | 6 | 2 | 14 | 10 | |||||||||
| Capoeta coadi | 6 | 10 | 8 | 11 | 7 | 1 | 3 | 1 | 14 | 16 | 12 | 8 | ||||
| Capoeta mandica | 1 | 7 | 2 | 1 | 9 | 2 | ||||||||||
| Capoeta saadii | 3 | 12 | 4 | 1 | 9 | 10 | 1 | |||||||||
| Capoeta trutta | 2 | 8 | 17 | 8 | 5 | 22 | 17 | 1 | ||||||||
Table 9.
Number of total gill rakers on the first gill arch in examined Capoeta species.
| 12 | 13 | 14 | 15 | 16 | 17 | 18 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 31 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Capoeta buhsei | 10 | 13 | 6 | |||||||||||||
| Capoeta coadi | 1 | 7 | 14 | 6 | 5 | |||||||||||
| Capoeta mandica | 2 | 2 | 2 | 1 | 4 | |||||||||||
| Capoeta saadii | 1 | 9 | 6 | 1 | 2 | 1 | ||||||||||
| Capoeta trutta | 1 | 1 | 9 | 11 | 7 | 5 | 4 | 1 | 1 |
Dorsal-fin origin anterior to pelvic-fin origin, its outer margin usually straight to concave with 3–5 unbranched and 8–9 branched rays (3 and 8 in holotype, respectively); last unbranched dorsal-fin ray weakly to moderately ossified, flexible and soft at the tip, serrated in 1/2–2/3 of its length (Fig. 4); pectoral fins not extending to pelvic-fin base; their outer margins usually slightly convex with 16–22 rays in total (19 in holotype) (Table 2); pelvic fins not extending to anal fin base, their outer margin straight or slightly convex and blunt with 7–11 rays in total (8 in holotype) (Table 2); pelvic axillary scale present; anal fin with 3 unbranched and 5 branched rays, outer margin straight or slightly convex; caudal fin forked with 16–19 branched rays (17 in holotype) (Table 3), its tip pointed and its upper lobe often longer than lower one.
Figure 4.
Dorsal fins of Capoeta coadi sp. n. a ZM-CBSU J 444; 73 mm SL b ZM-CBSU Z195; 104 mm SL c ZM-CBSU Z192; 148 mm SL; Iran: Kohgiluyeh and Boyer Ahmad, Beshar River, Karun River drainage, to show size-dependent variability of the last simple dorsal-fin ray serration.
Table 3.
Number of branched caudal fin rays in examined Capoeta species.
| Branched caudal fin rays | 15 | 16 | 17 | 18 | 19 | 20 |
|---|---|---|---|---|---|---|
| Capoeta buhsei | 3 | 21 | 3 | |||
| Capoeta saadii | 1 | 29 | 2 | 1 | ||
| Capoeta mandica | 2 | 8 | 1 | |||
| Capoeta trutta | 1 | 9 | 16 | 11 | 3 |
Scales small, total lateral-line scales 70–84; 12–17 scales between dorsal-fin origin and lateral line (Table 4); 9–11 scales between anal-fin origin and lateral line (Table 4); 26–32 circum-peduncle scales (Table 5); ventral midline and pectoral region covered with deeply embedded scales of reduced size; gill rakers slightly hooked, total gill rakers 14–18 (10–13 gill rakers on lower limb) of first gill arch (Table 8–9); 45–47 total vertebrae; usually one posterior pair of barbels present (very rarely two, 1 out of 51 individual); pharyngeal teeth arranged in 3 rows in the following manner: 2.3.5–5.3.2 and very similar in shape to those of Capoeta damascina; teeth in the main row spatulate or spoon-shaped and crowns flat, narrow and curved.
Table 4.
Number of scales above (between dorsal-fin origin and lateral line) and below (between dorsal-fin origin and lateral line) lateral line in examined Capoeta species.
| Above lateral line | Below lateral line | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | |
| Capoeta buhsei | 3 | 6 | 4 | 12 | 3 | 13 | 7 | 3 | 1 | ||||||||||||
| Capoeta coadi | 1 | 9 | 9 | 15 | 15 | 1 | 11 | 20 | 18 | ||||||||||||
| Capoeta mandica | 1 | 10 | 4 | 5 | 2 | ||||||||||||||||
| Capoeta saadii | 1 | 2 | 1 | 8 | 7 | 1 | 2 | 4 | 3 | 9 | 2 | ||||||||||
| Capoeta trutta | 2 | 1 | 1 | 7 | 16 | 7 | 3 | 3 | 7 | 19 | 8 | 6 | |||||||||
Table 5.
Number of circum-pendicular scales in examined Capoeta species.
| 19 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | 32 | 33 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Capoeta buhsei | 1 | 3 | 2 | 5 | 5 | 3 | 4 | 3 | ||||||
| Capoeta coadi | 3 | 11 | 7 | 14 | 4 | 7 | 5 | |||||||
| Capoeta fusca | 1 | 6 | 2 | 4 | 1 | 1 | ||||||||
| Capoeta mandica | 5 | 1 | 3 | 1 | 1 |
Table 8.
Gill rakers on the lower limb of the first gill arch in studied Capoeta species.
| GR | 8 | 9 | 10 | 11 | 12 | 13 | 17 | 18 | 19 | 20 | 22 | 24 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Capoeta buhsei | 2 | 19 | 6 | |||||||||
| Capoeta coadi | 1 | 9 | 19 | 20 | ||||||||
| Capoeta mandica | 1 | 2 | 3 | 1 | 3 | 1 |
Coloration. Live specimens. Dorsum and sides bright golden-green or silvery, darker dorsally and lighter below the lateral line; dorsal head bright golden-green or light pink-brown; dorsal, anal and caudal fins beige to light brown with light pink to red tinge; pectoral and pelvic-fins beige to light brown or golden with brown tinge on the first few rays (Fig. 3); few large black blotches present on the body of some specimens whereas small diffuse black spots are present only on the body of some juveniles (above the lateral line).
Preserved specimens.
Dorsum, head and sides grey or brownish-grey dorsally and beige or yellow ventrally; dorsal and caudal fins dusky grey; pectoral, pelvic and anal fins white or beige with or without grey tinge; blotches and spots well discernible (Figs 1–2).
Sexual dimorphism.
Breeding tubercles present in both sexes, being bigger and more pronounced in males. Tubercles present on the sides of the snout but may also cover the entire body surface, on and above the lateral line with one or two tubercles per scale but not on each scale, below the lateral line especially in the area above the anal fin and on the branched anal-fin rays; tip of anal fin reaching to or beyond the vertical of the caudal-fin base in females and to about 2/3 of the caudal peduncle in males.
Habitat and distribution.
Capoeta coadi sp. n. occurs in medium-fast flowing rivers with usually gravel substrates and clear waters (Fig. 5). At the Beshar River sampling site, the river is about 25 m wide, with substrate consisting of coarse gravel and boulders, and fast-flowing and semi-transparent waters. The physicochemical parameters at the spot were: dissolved oxygen, 9.89 mg/L; total dissolved solids, 190.2 mg/L; salinity, 0.19‰; conductivity, 395 µs/cm; pH: 8.5 and water temperature 23.4 °C. It is known only from the Karun River drainage, a system that constitutes the southeastern part of the Tigris-Euphrates River system.
Figure 5.
Beshar River at Taleh Gah village, Karun River drainage, type locality of Capoeta coadi.
Etymology.
The new species is named after Brian W. Coad, a well-known ichthyologist for his valuable contribution to the knowledge of freshwater fishes of Iran.
Comparative remarks.
The presence of one pair of barbels in Capoeta coadi sets the species apart from Capoeta antalyensis, Capoeta baliki, Capoeta banarescui, Capoeta tinca, and Capoeta heratensis, all of which have two pairs of barbels based on data from Turan et al. (2006a) and this study. The new species is further distinguished from Capoeta antalyensis by the presence of serrae on the last unbranched dorsal-fin ray (vs. absence) (Fig. 4), and by number of scales between dorsal-fin origin and lateral line (12–17 vs. 10–12 in Capoeta antalyensis) (Table 4), between anal-fin origin and lateral line (9–11 vs. 7), and by total number of the lateral-line scales (70–84 vs. 51–57) (Table 7). Capoeta coadi is distinguished from Capoeta banarescui by number of scales between anal-fin origin and lateral line (9–11 vs. 8–9) (Table 4). Data for Capoeta antalyensis and Capoeta banarescui are from Turan et al. (2006a).
Table 7.
Number of lateral-line scales in examined Capoeta species.
| 58 | 59 | 61 | 62 | 63 | 64 | 65 | 66 | 67 | 68 | 69 | 70 | 71 | 72 | 73 | 74 | 75 | 76 | 77 | 78 | 79 | 80 | 81 | 82 | 83 | 84 | 85 | 87 | 89 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Capoeta buhsei | 1 | 3 | 1 | 2 | 1 | 2 | 4 | 3 | 1 | 2 | 4 | 1 | 1 | ||||||||||||||||
| Capoeta coadi | 2 | 1 | 2 | 6 | 1 | 4 | 4 | 1 | 5 | 3 | 5 | 6 | 5 | 1 | 1 | ||||||||||||||
| Capoeta mandica | 1 | 1 | 2 | 1 | 2 | 1 | 2 | 1 | |||||||||||||||||||||
| Capoeta saadii | 1 | 2 | 1 | 2 | 2 | 1 | 2 | 3 | 1 | 1 | 2 | 2 | |||||||||||||||||
| Capoeta trutta | 1 | 2 | 1 | 3 | 1 | 5 | 4 | 2 | 2 | 2 | 5 | 3 | 2 | 4 | 2 | 1 |
Capoeta coadi is distinguished from Capoeta mandica, Capoeta erhani, and Capoeta trutta by having 10–13 gill rakers on the lower limb of the first gill arch (vs. 17–24 in Capoeta mandica, 20–22 in Capoeta erhani and 18–25 in Capoeta trutta [data from Krupp 1985, Turan et al. 2008, Table 8]). The total number of gill rakers in Capoeta coadi specimens is 14–18 that is lower than in Capoeta mandica (23–27), Capoeta barroisi (28–30), Capoeta turani (25–30) and Capoeta trutta (21–31) [data from Turan et al. (2006b), Özuluğ and Freyhof (2008), and this study] Table 9. Capoeta coadi is further distinguished from Capoeta mandica by having fewer pectoral fin rays (16–22 vs. 13–16) (Table 2). Capoeta coadi is distinguished from Capoeta bergamae, Capoeta capoeta and Capoeta sieboldii by number of scales between dorsal-fin origin and lateral line (12–17 in Capoeta coadi vs. 8–10 in Capoeta capoeta and 9–11 in Capoeta sieboldii); number of scales between anal-fin origin and lateral line (9–11 in Capoeta coadi vs. 7–9 in Capoeta bergamae, 6–10 in Capoeta capoeta and 8–10 in Capoeta sieboldii); total lateral line scales (70–84 in Capoeta coadi vs. 48–66 in Capoeta capoeta and 52–60 in Capoeta sieboldii) [data from Banarescu 1999, Turan et al. 2006b, Tables 4, 7]. In addition to the presence of serrae on the unbranched dorsal-fin ray, Capoeta coadi is set apart from Capoeta caelestis by the number of scales between the dorsal-fin origin and lateral line (12–17 in Capoeta coadi vs. 10–13.5 in Capoeta caelestis); scales between anal-fin origin and lateral line (9–11 in Capoeta coadi vs. 7–8 in Capoeta caelestis); circum-peduncular scales (26–32 in Capoeta coadi vs. 23–24 in Capoeta caelestis) (Tables 4–5) and probably vertebral counts (45–47 in Capoeta coadi vs. 44 in Capoeta caelestis) [data from Schöter et al. 2009].
Table 6.
Number of caudal-peduncle scales in examined Capoeta species.
| 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Capoeta buhsei | 6 | 3 | 7 | 9 | 1 | 1 | |||||||
| Capoeta coadi | 1 | 1 | 2 | 8 | 15 | 2 | 3 | 1 | |||||
| Capoeta mandica | 4 | 2 | 4 | 1 | |||||||||
| Capoeta saadii | 2 | 1 | 10 | 6 | 1 | ||||||||
| Capoeta trutta | 1 | 1 | 2 | 3 | 5 | 14 | 8 | 1 | 4 | 1 |
It is distinguished from Capoeta damascina by having 11–13, modally 13, gill rakers on the lower limb of the first gill arch (vs. 12–18, modally 14–15) (Alwan 2011, Table 8). Capoeta coadi is clearly distinguished from Capoeta ekmekciae by number of scales between dorsal-fin origin and lateral line (12–17 in Capoeta coadi vs. 9–10 in Capoeta ekmekciae); number of scales between anal-fin origin and lateral line (9–11 in Capoeta coadi vs. 6–7 in Capoeta ekmekciae) (Table 4); number of lateral line scales (70–84 in Capoeta coadi vs. 55–61 in Capoeta ekmekciae [data from Turan et al. 2006b; Alwan 2011].
Capoeta coadi is distinguished from Capoeta kosswigi by total number of gill rakers (Table 9): 14–18 in Capoeta coadi vs. 19–28 in Capoeta kosswigi (see Karaman 1969; Turan et al. 2006b; Turan 2008).
Capoeta coadi is distinguished from Capoeta mauricii and Capoeta pestai by having a weaker, thinner and less ossified last unbranched dorsal-fin ray in juveniles and adults and fewer scales between dorsal-fin origin and lateral line (12–17 in Capoeta coadi vs. 18–22 in Capoeta mauricii and 16–19 in Capoeta pestai [data from Özuluğ and Freyhof 2008, Küçük et al. 2009]). It is further distinguished from Capoeta pestai by the absence of spots on the body except in juveniles (vs. presence of many on the body [see Özuluğ and Freyhof 2008, Küçük et al. 2009]). Capoeta coadi is distinguished from Capoeta umbla by total number of lateral line scales (70–84 vs. 86–104), number of scales between dorsal-fin origin and lateral line (12–17 vs. 18–24), number of scales between anal-fin origin and lateral line (9–11 vs. 11.5–15.5), and circum-pendicular scales (26–32 vs. 32–39) (see Alwan 2011, Tables 4–7).
Compared to other Iranian species of Capoeta, Capoeta coadi has more scales and fewer gill rakers than Capoeta aculeata (number of scales between dorsal-fin origin and lateral line: 12–17 vs. 6–10; number of scales between anal-fin origin and lateral line: 9–11 vs. 5–8; circum-peduncular scales: 26–32 vs. 13–23; total number of lateral line scales: 70–84 vs. 36–52; caudal peduncle scales: 14–18 vs. 10–12; gill rakers on the lower limb of the first gill arch: 10–13 vs. 15–18 [data from Coad and Krupp 1994] and this study (Tables 4–9)). Capoeta coadi is distinguished from Capoeta fusca by more total vertebrae (45–47 vs. 44), and more total lateral-line scales (70–84 vs. 40–62) (see Coad 2008, Johari et al. 2009).
Capoeta coadi differs from its sister species (see Figs 6–7), Capoeta buhsei in having more gill rakers on lower limb of first gill arch (10–13 vs. 8–10), more gill rakers on the whole first gill arch (14–18 vs. 12–14, see Tables 8–9) and by depth of caudal peduncle in percent of standard length (10.03–11.61 vs. 8.58–10.84). Capoeta coadi is distinguished from another closely related species, Capoeta saadii by having more scales below the lateral line (9–11 vs. 6–10, modally 9) (Table 4) and more circum-pendicular scales (26–32 vs. 23–28, modally 25–26) [data from Alwan (2011)].
Figure 6.
Bayesian tree inferred from cyt b. Numbers left of the slash, indicate the posterior probabilities of the Bayesian analysis, using MrBayes, while numbers right of the slash are the bootstrap support for 10,000 replicates in the Maximum Likelihood tree, using RaxML. Asterisks (*) indicate less than 50% Maximum Likelihood support for the node.
Figure 7.
Bayesian tree inferred from COI. Numbers left of the slash, indicate the posterior probabilities of the Bayesian analysis, using MrBayes, while numbers right of the slash are the bootstrap support for 10,000 replicates in the Maximum Likelihood tree, using RaxML. Asterisks (*) indicate less than 50% Maximum Likelihood support and (-) indicates less than 0.50 Bayesian posterior probabilities for the node.
Molecular phylogenetic assessments
We generated COI barcode and cyt b sequences for a total of 76 and 61 Capoeta specimens, respectively (Tables 10–11). Two phylogenetic approaches including Maximum Likelihood and Bayesian analyses for species of Capoeta are given in Figs 6–7. Tables 12–13 provide the diagnostic nucleotide substitutions found in the mtDNA COI barcode region and cyt b, respectively.
Table 10.
List of species used for molecular analysis for cyt b (*present study, the ones without * are obtained from GenBank). Cyprinus carpio was considered as outgroup.
| Species | Accession Number | Locality |
|---|---|---|
| Capoeta aculeata | JF798267 | Stream Sangan, Karun River basin, Tigris basin, Iran |
| Capoeta aculeata | JF798264 | Sevah River, Kor basin, Iran |
| Capoeta aculeata | JF798266 | Beshar River, Karun basin, Tigris basin, Iran |
| Capoeta aculeata | JF798265 | Sevah River, Kor basin, Iran |
| Capoeta angorae | JF798268 | Pozanti River, Mediterranean Sea basin, Turkey |
| Capoeta antalyensis | JF798269 | Boga Cayi River, Mediterranean Sea basin, Turkey |
| Capoeta baliki | JF798272 | Kizilirmak River, Black Sea basin, Turkey |
| Capoeta baliki | JF798273 | Biggest tributary of Kurtbog˘azi dam lake, Sakarya River basin, Turkey |
| Capoeta baliki | JF798275 | Stream Cakirca, Lake Iznik basin, Turkey |
| Capoeta baliki | GQ424019 | Unknown |
| Capoeta baliki | GQ424020 | Unknown |
| Capoeta baliki | JF798271 | Kizilirmak River, Black Sea basin, Turkey |
| Capoeta banarescui | GQ423987 | Unknown |
| Capoeta banarescui | GQ423988 | Unknown |
| Capoeta bergamae | JF798282 | Bakacak stream, Marmara Sea basin, Turkey |
| Capoeta bergamae | JF798280 | Bakircay River, Turkey |
| Capoeta bergamae | JF798281 | Stream Guzelhisar, Aegean Sea basin, Turkey |
| Capoeta buhsei | JF798283 | Taghra Rud stream, Namak Lake basin, Iran |
| Capoeta buhsei* | KU312369 | Kordan River, Namak Lake basin, Karaj, Iran |
| Capoeta buhsei* | KU312370 | Kordan River, Namak Lake basin, Karaj, Iran |
| Capoeta caelestis | JF798336 | Ilica stream, Gulf of Antalya, Mediterranean Sea basin,Turkey |
| Capoeta caelestis | JF798286 | Goksu River, Mediterranean Sea basin, Turkey |
| Capoeta caelestis | JF798287 | Kargi Cayi River, Mediterranean Sea basin, Turkey |
| Capoeta coadi* | KU564303 | Beshar River, Tigris River basin, Iran |
| Capoeta coadi* | KU564304 | Beshar River, Tigris River basin, Iran |
| Capoeta coadi* | KU564305 | Beshar River, Tigris River basin, Iran |
| Capoeta coadi* | KU564306 | Beshar River, Tigris River basin, Iran |
| Capoeta damascina | JF798309 | Karadut River, Euphrates basin, Turkey |
| Capoeta damascina | JF798303 | Stream Arsuz, Iskenderun Gulf basin, Mediterranean Sea, Turkey |
| Capoeta damascina | JF798308 | Yocalti River, Turkey |
| Capoeta damascina | JF798306 | Spring Incesu, Orontes basin, Mediterranean Sea, Turkey |
| Capoeta damascina | JF798307 | Yocalti River, Mediterranean Sea basin, Turkey |
| Capoeta ekmekciae | GQ424027 | Unknown |
| Capoeta heratensis | JF798319 | Keltechinar River, Turkmenistan |
| Capoeta heratensis | JF798318 | Yanbash River, Turkmenistan |
| Capoeta heratensis | JF798317 | Yanbash River, Turkmenistan |
| Capoeta heratensis | JF798316 | Murgab River, Turkmenistan |
| Capoeta kosswigi | JF798322 | Deli Cayi River, Van Lake basin, Turkey |
| Capoeta kosswigi | JF798323 | Deli Cayi River, Van Lake basin, Turkey |
| Capoeta mandica * | KU564307 | Ghare Aghaj River, Mond River basin, Khaneh Zanian , Iran |
| Capoeta mandica * | KU564308 | Ghare Aghaj River, Mond River basin, Khaneh Zanian , Iran |
| Capoeta mandica * | KU312375 | Ghare Aghaj River, Mond River basin, Khaneh Zanian , Iran |
| Capoeta mauricii | JF798325 | Eflatum spring, Beysehir Lake basin, Turkey |
| Capoeta mauricii | JF798324 | Sarioz stream, Beysehir Lake basin, Turkey |
| Capoeta saadii* | KU564309 | Ghare Aghaj River, Mond River basin, Firuzabad, Iran |
| Capoeta saadii* | KU564310 | Ghare Aghaj River, Mond River basin, Firuzabad , Iran |
| Capoeta saadii* | KU564311 | Saadii Tomb Spring, Maharlu basin, Iran |
| Capoeta saadii* | KU312373 | Helleh River, Helleh basin, KohmarSorkhi, Iran |
| Capoeta saadii* | KU564312 | Kor River, Kor basin, Kamfirouz, Iran |
| Capoeta saadii* | KU564313 | Kor River, Kor basin, Kamfirouz, Iran |
| Capoeta saadii | JF798326 | Rodan River, Makran basin, Iran |
| Capoeta saadii | JF798327 | Spring Golabii, 35 km north from Darab, Hormuz basin, Iran |
| Capoeta sieboldii | JF798329 | Kizilirmak River, Black Sea basin, Turkey |
| Capoeta sieboldii | JF798330 | Kelkit Cayi River, Black Sea basin, Turkey |
| Capoeta tinca | GQ424008 | Unknown |
| Capoeta tinca | GQ424007 | Unknown |
| Capoeta trutta | JF798334 | Dez River, Karun River basin, Iran |
| Capoeta trutta | JF798333 | Sultansuyu River, Euphrates basin, Turkey |
| Capoeta trutta | JF798332 | Gelal River, Ab e Seymareh, Tigris River basin, Iran |
| Capoeta turani | JF798335 | Çatkit River, Mediterranean Sea basin, Turkey |
| Cyprinus carpio | DQ868875 | Unknown |
Table 11.
List of species used for molecular analysis for COI (*present study, the ones without * are obtained from GenBank). Cyprinus carpio was considered as outgroup.
| Species | Accession num. | Locality |
|---|---|---|
| Capoeta heratensis* | KU564288 | Gilas spring, Tedzen basin, Iran |
| Capoeta heratensis* | KU564289 | Gilas spring, Tedzen basin, Iran |
| Capoeta heratensis* | KU564290 | Gilas spring, Tedzen basin, Iran |
| Capoeta heratensis* | KU564291 | Bezangan Lake, Tedzen basin, Iran |
| Capoeta angorae | KJ553074 | Seyhan, Turkey |
| Capoeta angorae | KJ552868 | Seyhan, Turkey |
| Capoeta antalyensis | KJ552850 | Aksu, Turkey |
| Capoeta antalyensis | KJ553025 | Aksu, Turkey |
| Capoeta barroisi | KJ553267 | Orontes, Turkey |
| Capoeta barroisi | KJ553245 | Orontes, Turkey |
| Capoeta barroisi | KJ552785 | Orontes, Turkey |
| Capoeta barroisi | KJ552810 | Orontes, Turkey |
| Capoeta bergamae | KJ553157 | Bakir, Turkey |
| Capoeta bergamae | KJ552877 | Bakir, Turkey |
| Capoeta bergamae | KJ553253 | Biga, Turkey |
| Capoeta bergamae | KJ553081 | Biga, Turkey |
| Capoeta buhsei* | KU312349 | Kordan River, Namak Lake basin, Karaj, Iran |
| Capoeta buhsei* | KU312350 | Kordan River, Namak Lake basin, Karaj, Iran |
| Capoeta buhsei* | KU564292 | Roudbar River, Kavir basin,Iran |
| Capoeta buhsei* | KU564293 | Roudbar River, Kavir basin,Iran |
| Capoeta caelestis | KJ552856 | Göksu, Turkey |
| Capoeta caelestis | KJ553237 | Ilica, Turkey |
| Capoeta caelestis | KJ553301 | Göksu, Turkey |
| Capoeta caelestis | KJ553030 | Göksu, Turkey |
| Capoeta damascina | KJ553080 | Arsuz, Turkey |
| Capoeta damascina | KJ553043 | Orontes, Turkey |
| Capoeta damascina | KJ552896 | Orontes, Turkey |
| Capoeta damascina | KJ553272 | Orontes, Turkey |
| Capoeta damascina | KJ552846 | Orontes, Turkey |
| Capoeta damascina | KJ552874 | Ceyhan, Turkey |
| Capoeta damascina | KJ552797 | Orontes, Syria |
| Capoeta damascina | KJ553202 | Orontes, Syria |
| Capoeta damascina | KJ553027 | Ceyhan, Turkey |
| Capoeta damascina | KJ553194 | Ceyhan, Turkey |
| Capoeta damascina | KJ552763 | Ceyhan, Turkey |
| Capoeta damascina | KJ552939 | Jordan River Drainage, Syria |
| Capoeta damascina | KJ553216 | Orontes, Turkey |
| Capoeta damascina | KJ553089 | Orontes, Turkey |
| Capoeta erhani | KJ552767 | Ceyhan, Turkey |
| Capoeta erhani | KJ552087 | Ceyhan, Turkey |
| Capoeta erhani | KJ552806 | Ceyhan,Turkey |
| Capoeta erhani | KJ553067 | Ceyhan,Turkey |
| Capoeta mandica* | KU564301 | Ghare Aghaj River, Mond River basin, Khaneh Zanian, Iran |
| Capoeta mandica* | KU564302 | Ghare Aghaj River, Mond River basin, Khaneh Zanian, Iran |
| Capoeta mandica* | KU312368 | Ghare Aghaj River, Mond River basin, Khaneh Zanian, Iran |
| Capoeta pestai | KJ553304 | Egirdir, Turkey |
| Capoeta pestai | KJ553138 | Egirdir, Turkey |
| Capoeta pestai | KJ552113 | Egirdir, Turkey |
| Capoeta pestai | KJ552841 | Egirdir, Turkey |
| Capoeta pestai | KJ552818 | Egirdir, Turkey |
| Capoeta tinca | KJ553229 | Simav, Turkey |
| Capoeta tinca | KJ553168 | Simav, Turkey |
| Capoeta trutta* | KU312352 | Karkheh River, Tigris River basin, Seymareh, Iran |
| Capoeta trutta* | KU312351 | Gavi River, Tigris River basin, Illam, Iran |
| Capoeta turani | KJ553224 | Ceyhan Nehri, Turkey |
| Capoeta saadii* | KU312358 | Saadii Tomb Spring, Maharlou basin, Iran |
| Capoeta saadii* | KU312395 | Spring Pirbanoo, Maharlou basin, Iran |
| Capoeta saadii* | KU312360 | Helleh River, Helleh basin, KohmarSorkhi, Iran |
| Capoeta saadii* | KU312361 | Helleh River, Helleh basin, KohmarSorkhi, Iran |
| Capoeta saadii* | KU564299 | Kor River, Kor basin, Kamfiruz, Iran |
| Capoeta saadii* | KU564300 | Kor River, Kor basin, Kamfiruz, Iran |
| Capoeta saadii* | KU312359 | Kor River, Kor basin, Kamfiruz, Iran |
| Capoeta coadi* | KU564294 | Beshar River, Tigris River basin, Iran |
| Capoeta coadi* | KU564295 | Beshar River, Tigris River basin, Iran |
| Capoeta coadi* | KU564296 | Beshar River, Tigris River basin, Iran |
| Capoeta coadi* | KU564297 | Beshar River, Tigris River basin, Iran |
| Capoeta coadi* | KU564298 | Beshar River, Tigris River basin, Iran |
| Capoeta sp. | KJ552935 | Dalaman, Turkey |
| Capoeta sp. | KJ553011 | Büyük Menderes, Turkey |
| Capoeta sp. | KJ552882 | Dalaman, Turkey |
| Cyprinus carpio | DQ868875 | Unknown |
Table 12.
Diagnostic nucleotide substitutions found in mtDNA COI barcode region of Capoeta species. Nucleotide position relative to Cyprinus carpio complete mitochondrial genome.
| Species | 6545 | 6620 | 6626 | 6665 | 6683 | 6713 | 6749 | 6758 | 6761 | 6770 | 6818 | 6845 | 6875 | 6887 | 6905 | 6986 | 6995 | 7076 | 7088 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Capoeta buhsei | C | A | A | T | G | G | T | C | G | G | G | A | A | C | C | G | A | G | T |
| Capoeta caelestis | T | G | C | T | G | A | G | T | G | A | A | C | G | T | T | G | G | G | C |
| Capoeta coadi | C | A | A | T | A | G | T | C | G | G | G | A | A | C | C | A | A | G | T |
| Capoeta damscina | T | A | G | T | G | A | G | T | A | A | G | C | A | T | T | G | G | A | C |
| Capoeta saadii | T | A | A | C | G | G | T | C | A | A | G | A | A | C | C | T | A | G | T |
Table 13.
Diagnostic nucleotide substitutions found in cyt b of Capoeta species. Nucleotide position relative to Cyprinus carpio complete mitochondrial genome.
| Species | 15430 | 15451 | 15457 | 15463 | 15472 | 15526 | 15550 | 15610 | 15670 | 15682 | 15760 | 15814 | 15925 | 16011 | 16027 | 16039 | 16045 | 16063 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Capoeta buhsei | C | G | T | A | A | G | G | T | G | T | G | G | G | C | C | A | G | C |
| Capoeta caelestis | T | A | C | A | A | G | G | A | A | C | A | A | G | T | T | G | A | T |
| Capoeta coadi | T | G | C | A | G | G | A | C | G | T | G | G | G | C | C | A | G | C |
| Capoeta damascina | T | A | C | G | A | A | A | T | A | T | G | A | A | C | T | G | A | T |
| Capoeta saadii | T | G | C | G | A | A | A | T | A | T | G | A | A | C | T | G | A | T |
For inter-specific differences, the greatest pairwise genetic divergence between Capoeta coadi and its congeners was found to be 6.5 by Capoeta erhani and lowest by Capoeta buhsei (0.4) for COI and greatest 9.7 by Capoeta mandica and lowest (1.5) by Capoeta buhsei for cyt b (Tables 14–15).
Table 14.
Mean genetic distance for cyt b between Capoeta species.
| Capoeta sieboldii | Capoeta caelestis | Capoeta mauricii | Capoeta bergamae | Capoeta baliki | Capoeta antalyensis | Capoeta tinca | Capoeta banarescui | Capoeta turani | Capoeta trutta | Capoeta buhsei | Capoeta coadi | Capoeta mandica | Capoeta saadii | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Capoeta sieboldii | ||||||||||||||
| Capoeta caelestis | 3.8 | |||||||||||||
| Capoeta mauricii | 5.1 | 4.6 | ||||||||||||
| Capoeta bergamae | 5.3 | 5.4 | 4.8 | |||||||||||
| Capoeta baliki | 4.4 | 4.7 | 4.5 | 5.7 | ||||||||||
| Capoeta antalyensis | 4.3 | 4.1 | 4.1 | 4.9 | 4.6 | |||||||||
| Capoeta tinca | 5.3 | 5.6 | 5.3 | 6.6 | 1.0 | 5.6 | ||||||||
| Capoeta banarescui | 5.7 | 4.9 | 4.9 | 6.0 | 4.9 | 4.4 | 4.9 | |||||||
| Capoeta turani | 8.1 | 8.4 | 9.3 | 9.5 | 8.5 | 8.6 | 8.8 | 11.0 | ||||||
| Capoeta trutta | 8.7 | 8.7 | 9.1 | 9.9 | 9.1 | 9.2 | 9.4 | 10.9 | 1.2 | |||||
| Capoeta buhsei | 4.3 | 2.6 | 4.1 | 5.6 | 4.3 | 4.0 | 5.1 | 4.7 | 9.3 | 9.5 | ||||
| Capoeta coadi | 4.2 | 2.6 | 4.5 | 6.0 | 5.0 | 4.3 | 5.8 | 5.4 | 9.4 | 9.6 | 1.5 | |||
| Capoeta mandica | 8.5 | 8.8 | 9.0 | 9.9 | 8.7 | 9.5 | 9.2 | 11.4 | 1.5 | 1.1 | 9.6 | 9.7 | ||
| Capoeta saadii | 4.8 | 3.3 | 4.8 | 4.6 | 4.7 | 4.8 | 5.4 | 5.8 | 8.5 | 8.9 | 2.8 | 2.7 | 9.1 | |
| Capoeta aculeata | 6.5 | 6.6 | 7.2 | 7.7 | 7.4 | 6.5 | 8.0 | 7.5 | 9.2 | 9.2 | 6.8 | 7.0 | 9.7 | 6.8 |
Table 15.
Mean genetic distance for COI gene between Capoeta species.
| Capoeta trutta | Capoeta heratensis | Capoeta buhsei | Capoeta coadi | Capoeta saadii | Capoeta pestai | Capoeta caelestis | Capoeta damascina | Capoeta barroisi | Capoeta bergamae | Capoeta tinca | Capoeta erhani | Capoeta angorae | Capoeta antalyensis | Capoeta mauricii | Capoeta mandica | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Capoeta trutta | ||||||||||||||||
| Capoeta heratensis | 7.15 | |||||||||||||||
| Capoeta buhsei | 6.02 | 5.10 | ||||||||||||||
| Capoeta coadi | 6.01 | 5.23 | 0.44 | |||||||||||||
| Capoeta saadii | 6.22 | 5.16 | 1.12 | 1.42 | ||||||||||||
| Capoeta pestai | 5.82 | 5.07 | 3.83 | 3.60 | 3.82 | |||||||||||
| Capoeta caelestis | 6.03 | 4.54 | 2.61 | 3.10 | 2.88 | 4.01 | ||||||||||
| Capoeta damascina | 5.65 | 4.31 | 2.56 | 3.05 | 2.49 | 3.65 | 1.24 | |||||||||
| Capoeta barroisi | 0.57 | 6.72 | 5.99 | 6.52 | 6.17 | 6.29 | 5.93 | 5.52 | ||||||||
| Capoeta bergamae | 6.56 | 4.87 | 3.95 | 3.81 | 3.98 | 4.33 | 3.64 | 3.45 | 6.75 | |||||||
| Capoeta tinca | 4.39 | 5.32 | 4.50 | 4.77 | 4.49 | 5.02 | 4.44 | 4.01 | 4.21 | 4.47 | ||||||
| Capoeta erhani | 0.94 | 6.74 | 6.03 | 6.55 | 6.20 | 6.18 | 5.83 | 5.27 | 0.99 | 6.35 | 4.18 | |||||
| Capoeta angorae | 6.37 | 4.68 | 3.28 | 3.41 | 3.02 | 3.97 | 1.91 | 0.74 | 6.27 | 3.78 | 4.46 | 5.97 | ||||
| Capoeta antalyensis | 5.25 | 4.15 | 2.58 | 2.71 | 2.92 | 2.91 | 2.42 | 2.76 | 5.34 | 2.73 | 3.64 | 5.25 | 3.08 | |||
| Capoeta mauricii | 5.82 | 5.07 | 3.83 | 3.60 | 3.82 | 0.00 | 4.01 | 3.65 | 6.29 | 4.33 | 5.02 | 6.18 | 3.97 | 2.91 | ||
| Capoeta mandica | 0.42 | 7.31 | 6.22 | 6.34 | 6.39 | 5.99 | 6.20 | 5.83 | 0.73 | 6.54 | 4.58 | 1.18 | 6.54 | 5.43 | 5.99 | |
| Cyprinus carpio | 15.32 | 14.89 | 15.13 | 14.97 | 14.23 | 15.85 | 16.32 | 15.39 | 15.53 | 15.57 | 15.45 | 16.06 | 15.34 | 15.61 | 15.85 | 15.87 |
The two different phylogenetic analyses produced similar topologies. Both analyses produced a tree with 3 major clades (Figs 6–7). These included Clade I) Capoeta antalyensis, Capoeta baliki, Capoeta banarescui, Capoeta bergamae, Capoeta buhsei, Capoeta caelestis, Capoeta coadi, Capoeta damascina (Capoeta angorae is a synonym [Alwan 2011]), Capoeta kosswigi, Capoeta mauricii, Capoeta pestai, Capoeta saadii, Capoeta sieboldii, and Capoeta tinca, Clade II) Capoeta aculeata, Capoeta ekmeckciae, and Capoeta heratensis, and Clade III) Capoeta barroisi, mandica, Capoeta trutta, and Capoeta turani.
The Iranian members of the Capoeta damascina species complex, clustered together and formed the sister group to the other members in the complex. In these trees, samples of the Capoeta coadi, from Beshar River in Tigris River basin, form a well-supported monophyletic group, sister to Capoeta buhsei in clade I.
Discussion
Based on morphological and molecular results, Capoeta saadii and Capoeta coadi are distinct species in the Capoeta damascina species complex group formerly known as Capoeta damascina in Iranian water bodies. Phylogenetic analyses recovered three main groups inside the genus Capoeta: the Mesopotamian group (Capoeta trutta group), the Anatolian-Iranian group (Capoeta damascina group) and the Aralo-Caspian group (Capoeta capoeta group) which is in agreement with Levin et al. (2012). The genus Capoeta is monophyletic (Levin et al. 2012). Based on the previous published data, the Capoeta damascina species complex group diverged from the Capoeta capoeta group about 9.1 MYA (95% CI: 6.4–10.9) in the Tortonian period (Levin et al. 2012). Iranian members of the Capoeta damascina group (buhsei, saadii and coadi) formed a clade sister to other Capoeta damascina species complex group members.
The populations of Capoeta from the Karun River drainage have long been considered as Capoeta damascina (Esmaeili et al. 2010). However, it has been proposed that Capoeta damascina might be restricted to the Damascus area in Syria. Most Iranian populations, referred to Capoeta damascina, including Karun River population have been considered as Capoeta saadii (Heckel, 1847) (Teimori et al. 2016). Capoeta saadii was originally described from Persepolis, Pulwar (Sivand) River, Kor River basin, Ruins, northeast of Shiraz, Iran. It was considered as a synonym of Capoeta damascina (Esmaeili et al. 2010) and as a valid species by Bianco and Bănărescu (1982), by Levin et al. (2012) and by Teimori et al. (2016). Based on morphological and molecular results presented here, Capoeta saadii is a valid species closely related to Capoeta buhsei (as proposed by Bianco and Bănărescu (1982) and to Capoeta coadi yet is diagnosed from these species and from Capoeta damascina (see Alwan 2011). Capoeta saadii is the least known species of the genus. It is not mentioned in the revision of the genus by Karaman (1969) who had no specimens available, but its position within the genus Capoeta and its close phylogenetic relationship to Capoeta coadi and Capoeta buhsei were demonstrated using many fresh specimens at our disposal, mostly from type localities.
Comparative materials used in morphological and molecular phylogenetic analyses
Morphological analyses
Capoeta buhsei: ZM-CBSU Z218-229, 12, 104-149 mm SL; Iran, Semnan prov., Kavir basin, Hableh Rud at Garmsar, 35°18'06"N, 52°24'57"E. 21 August 2011. H.R. Esmaeili, G. Sayyadzadeh, A. Gholamifard, R. Zamaniannejad. ZM-CBSU Z260-274, 15, 88–130 mm SL; Iran, Albourz prov., Kordan River at Karaj, 35°57'12"N, 56°50'18"E. 5 July 2014. M. Masoudi, R. Khaefi. H.R. Mehraban.
Capoeta fusca: ZM-CBSU Z197-211, 15, 50–78 mm SL; Iran, south Khorasan prov., Sharifabad Qanat at Birjand, 33°58'08"N, 59°17'03"E. 29 August 2011. H.R. Esmaeili, G. Sayyadzadeh, A. Gholamifard, R. Zamaniannejad.
Capoeta mandica: ZM-CBSU Z230-234, 5, 82-130 mm SL; Iran, Fars prov., Qareh Aghaj River at Khaneh Zanian, 29°41'13"N, 52°05'58"E. 30 May 2015. H. Zareian, A. Gholamhosseini, G. Sayyadzadeh. ZM-CBSU Z212-217, 6, 83-118 mm SL; Iran, Fars prov., Qareh Aghaj River at Kavar, 29°10'55"N, 52°41'32"E. 27 February 2015. G. Sayyadzadeh, M. Masoudi.
Capoeta saadii: ZM-CBSU Z136-146, 11, 78-121 mm SL; ZM-CBSU 2504, 1, 82 mm SL; ZM-CBSU 2508, 1, 69 mm SL; ZM-CBSU 2520-2521, 2, 51-62 mm SL; ZM-CBSU 2524-2528, 5, 113-231 mm SL; Iran, Fars prov., Ghadamgah spring, Doroodzan, 30°15'11"N, 54°25'32"E. 21 December 2003. H.R. Esmaeili, Biglari.
Capoeta trutta: ZM-CBSU E100-123, 24, 50-149 mm SL; Iran, Kermanshah prov., Gamasiab River, 34°23'31"N, 47°42'57"E. 27 September 2007. A. Teimori, A. Gholamhosseini, M. Ebrahimi, A. Gholamifard; ZM-CBSU C453-463, 11, 67-177 mm SL; ZM-CBSU C474-477, 4, 67–75 mm SL; ZM-CBSU C481, 76 mm SL; all from Iran, Khuzestan prov., Maroon River at Aghajari, 30°44'52"N, 49°54'59"E. 21 March 2008. H. Zareian.
Molecular phylogenetic analyses
Capoeta buhsei; ZM-CBSU M1299-1300, 2, Iran, Albourz prov., Kordan River at Karaj, 35°57'12"N, 56°50'18"E. 5 July 2014. M. Masoudi, R. Khaefi. H.R. Mehraban. GenBank accession number: (COI: KU312349, KU312350; cytb: KU312369, KU312370); ZM-CBSU M1289-1290, 2, Iran: Semnan Prov., Kavir basin, Roudbar River at Mehdishahr, 35°37'56"N, 53°20'41"E. 30 August 2011. H.R. Esmaeili et al., GenBank accession number: (COI: KU564292, KU564293).
Capoeta heratensis; ZM-CBSU M813-815, 3, Iran, Razavi Khorasan prov., Gilas spring, 36°36'55"N, 59°20'17"E. 25 August 2011. H.R. Esmaeili et al. GenBank accession number: (COI: KU564288, KU564289, KU564290). ZM-CBSU M816, 1, Iran, Razavi Khorasan prov., Bezangan Lake, Tedzen basin. 36°17'03"N, 60°24'18"E. 25 August 2011. H.R. Esmaeili et al. GenBank accession number: (COI: KU564291).
Capoeta mandica: ZM-CBSU M1433-1435, 3, Iran, Fars prov., Qareh Aghaj River at Khaneh Zanian, 29°41'13"N, 52°05'58"E. 30 May 2015. H. Zareian, A. Gholamhosseini, G. Sayyadzadeh. GenBank accession number: (COI: KU564301, KU564302, KU312368; cytb: KU564307, KU564308, KU312375).
Capoeta saadii: ZM-CBSU M1426-1427, 2, Iran: Fars prov. Kor River, at Kamfirouz, 30°25'2"N, 52°8'59"E. H. Zareian. 24 October 2015. GenBank accession number: (COI: KU564299, KU564300; cytb: KU564312, KU564313). ZM-CBSU M1421, ZM-CBSU1422-1425, 3, Iran, Fars prov., Qareh Aghaj River at Firuzabad, 28°41'31"N, 52°27'43"E. 25 April 2015. H. Zareian. GenBank accession number: (cytb: KU564309, KU564310, KU564311). ZM-CBSU M157, 1, Iran, Fars prov., Shiraz, Saadii Tomb, Maharlou basin, 29°37.348'N, 52° 34.934'E. R. Khaefi, 2009. GenBank accession number: (COI: KU312358). ZM-CBSU M825, M831, 2, Iran, Fars prov., Helleh River, Helleh basin, KohmarhSorkhi, S. Mirgheiasi, S. Ghasemian. 29°23'39"N, 52°09'49"E. GenBank accession number: (COI: KU312361, KU312360; cytb: KU312373). ZM-CBSU M822, 1, Iran, Fars prov., Qareh Aghaj River at Firuzabad, 29°07'34"N, 52°51'24"E. GenBank accession number: (cytb: KU564310). FSJF DNA-18 Iran: Fars prov.: spring Pirbanoo about 10 km south of Shiraz, 29°31'08"N, 52°27'55"E GenBank accession number: (COI: KU312395). FSJF DNA-22; Iran: Fars prov.: River Kor about 73 km north of Shiraz, 30°11'37"N, 52°27'56"E. GenBank accession number: (COI: KU312359).
Capoeta trutta: ZM-CBSU M583, 1, Iran: Ilam prov.; Gavi River at Mehran, H.R. Esmaeili, 13 November 2012, 33°39'18"N, 47°02'14"E. GenBank accession number: COI: KU312351; ZM-CBSU M593, 1, Iran, Ilam prov.; Seymareh River, H.R. Esmaeili, 13 November 2012, 33°38'17"N, 47°01'30"E. GenBank accession number: COI: KU312352.
Supplementary Material
Acknowledgments
We are pleased to thank A. Gholamhosseini, A. Teimori, M. Masoudi, H. Mehraban, G. Sayyadzadeh, R. Sadeghi, A. Khajepanah & M. Razbani for their help during field work. The research work was funded by the Shiraz University and was approved by the Ethics Committee of Biology Department (ECBD-SU-909789).
Citation
Alwan NH, Zareian H, Esmaeili HR (2016) Capoeta coadi, a new species of cyprinid fish from the Karun River drainage, Iran based on morphological and molecular evidence (Teleostei, Cyprinidae). ZooKeys 572: 155–180. doi: 10.3897/zookeys.572.7377
References
- Alwan N. (2011) Systematics, taxonomy, phylogeny and zoogeography of the Capoeta damascina species complex (Pisces: Teleostei: Cyprinidae) inferred from comparative morphology and molecular markers. PhD thesis, Goethe Universität, Frankfurt a.M., Germany. [Google Scholar]
- Armantrout NB. (1980) The freshwater fishes of Iran. Ph.D. Thesis, Oregon State University, Corvallis, Oregon. [Google Scholar]
- Banarescu PM. (1999) The Freshwater Fishes of Europe. Cyprinidae 2. Part I: Rhodeus to Capoeta. Volume 5 AULA-Verlag, Wiebelsheim. [Google Scholar]
- Bahrami Kamangar B, Ghaderi E, Hossinpour H. (2012) The fish biodiversity of Gheshlagh River (Sanandj, Iran), a tributary of Tigris basin with occurrence of Rutilus kutum and Hemiculter leucisculus. In: The GIAN International Symposium on” Biodiversity in Zagros Region (Tehran, Iran) May 2012. [Google Scholar]
- Berg LS. (1949) Freshwater Fishes of the USSR and Adjacent Countries Academy of Sciences of the USSR; [Translation by O. Ronen, 1964, Israel Programme for Scientific Translations, IPST Press, Jerusalem] [Google Scholar]
- Bianco PG, Banarescu PM. (1982) A contribution to the knowledge of the Cyprinidae of Iran (Pisces, Cypriniformes). Cybium 3: 75–96. [Google Scholar]
- Bruford MW, Hanotte O, Brokfield JFY, Burke T. (1992) Single-locus and multilocus DNA fingerprinting. In: Hoelzel AR. (Ed.) Molecular genetic analysis of populations: a practical approach. Oxford University Press, New York, 225–269. [Google Scholar]
- Coad BW. (2008) Fishes of Tehran Province and adjacent areas. Shabpareh Publications, Tehran, 244 pp. [Google Scholar]
- Coad BW, Krupp F. (1994) Capoeta aculeata (Valenciennes in Cuv. & Val. 1844), a valid species of cyprinid fish from Iran (Teleostei: Cyprinidae). Zoology in the Middle East 10: 63–72. doi: 10.1080/09397140.1994.10637662 [Google Scholar]
- Cuvier G, Valenciennes A. (1842) Histoire naturelle des poissons. Tome 16 Paris. [Google Scholar]
- Durand JD, Tsigenopoulos CS, Unlü E, Berrebi P. (2002) Phylogeny and biogeography of the family Cyprinidae in the Middle East inferred from cytochrome b DNA- evolutionary significance of this region. Molecular Phylogenetics and Evolution 22(1): 91–100. doi: 10.1006/mpev.2001.1040 [DOI] [PubMed] [Google Scholar]
- Esmaeili HR, Coad BW, Gholamifard A, Nazari N, Teimory A. (2010) Annotated checklist of the freshwater fishes of Iran. Zoosystematica Rossica 19: 361–386. [Google Scholar]
- Eschmeyer WN, Fricke E. (Eds) Catalog of fishes: genera, species, references. http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp [Electronic version accessed 25 January 2016]
- Ghorbani Chafi H. (2000) Identification of different fish species in Koohrang, Bazoft and Zayandeh Rood River in Chahar Mahal-e-Bakhtiary Province. Iranian Journal of Fisheries Sciences 8(4): 43–56. [In Farsi] [Google Scholar]
- Hall TA. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. [Google Scholar]
- Heckel JJ. (1849) Die Fische Persiens gesammelt von Theodor Kotschy. In: Russegger J. (Ed.) Reisen in Europa, Asien und Afrika. Volume 2 Schweitzerbart’sche Verlagsbuchhandlung, Stuttgart, 255–335. [Google Scholar]
- Hubbs CL, Lagler KF. (1958) Fishes of the Great Lakes Region. University of Michigan Press, Ann Arbor. [Google Scholar]
- Huelsenbeck JP, Ronquist F. (2001) MrBayes: Bayesian inference of phylogeny. Bioinformatics 17: 754–755. doi: 10.1093/bioinformatics/17.8.754 [DOI] [PubMed] [Google Scholar]
- Jalali B, Shamsi Sh, Barzegar M. (2005) Occurrence of Gyrodactylus spp. (Monogenea: Gyrodactylidae) from Iranian freshwater fishes. Iranian Journal Fish Sciences 4: 19–30. [Google Scholar]
- Johari SA, Coad BW, Mazloomi S, Kheyri M, Asghari S. (2009) Biological and morphometric characteristics of Capoeta fusca, a cyprinid fish living in the qanats of south Khorasan, Iran (Osteichthyes: Cyprinidae). Zoology in the Middle East 47: 63–70. doi: 10.1080/09397140.2009.10638348 [Google Scholar]
- Kähsbauer P. (1964) Zur Kenntnis der Ichthyofauna von Iran (II. Teil). Annalen des naturhistorischen Museums in Wien 67: 453–475, 1 Taf. [Google Scholar]
- Karaman MS. (1969) Süßwasserfische der Türkei. 7. Teil. Revision der kleinasiatischen und vorderasiatischen Arten des Genus Capoeta (Varicorhinus, Partim). Mitteilungen aus dem hamburgischen Zoologischen Museum und Institut 66: 17–54. [Google Scholar]
- Kessler KF. (1877) Ryby, vodyashchiesya i vstrechayushchiesya v Aralo-kaspiisko-pontiiskoi ikhtiologicheskoi oblasti. Volume 4 Trudy Aralo-Kaspiiskoi Ekspeditsi, Sankt-Peterburg. [Google Scholar]
- Krupp F. (1983) Freshwater fishes of Saudi Arabia and adjacent regions of the Arabian Peninsula. Fauna of Saudi Arabia 5: 568–636. [Google Scholar]
- Krupp F. (1985) Systematik und Zoogeographie der Süßwasserfische des levantinischen Grabenbruchsystems und der Ostküste des Mittelmeeres Dissertation zur Erlangung des Grades “Doktor der Naturwissenschaften” am Fachbereich Biologie der Johannes Gutenberg - Universität in Mainz, Mainz. [Google Scholar]
- Krupp F, Schneider W. (1989) The fishes of the Jordan River drainage basin and Azraq Oasis. Fauna of Saudi Arabia 10: 347–416. [Google Scholar]
- Krupp F, Al-Jumaily M, Bariche M, Khalaf M, Malek M, Streit B. (2009) The Middle Eastern Biodiversity Network: Generating and sharing knowledge for ecosystem management and conservation. ZooKeys 31: 3–15. doi: 10.3897/zookeys.31.371 [Google Scholar]
- Küçük F, Turan D, Şahin C, Gülle İ. (2009) Capoeta mauricii n. sp., a new species of cyprinid fish from Lake Beyşehir, Turkey (Osteichthyes: Cyprinidae). Zoology in the Middle East 47: 71–82. doi: 10.1080/09397140.2009.10638349 [Google Scholar]
- Levin BA, Freyhof J, Lajbner Z, Perea S, Abdoli A, Gaffaro lug M, Özuluh M, Rubenyan HR, Salnikov VB, Doadrio I. (2012) Phylogenetic relationships of the algae scraping cyprinid genus Capoeta (Teleostei: Cyprinidae). Molecular Phylogenetics and Evolution 62: 542–549. doi: 10.1016/j.ympev.2011.09.004 [DOI] [PubMed] [Google Scholar]
- Machordom A, Doadrio I. (2001) Evidence of a Cenozoic Betic–Kabilian Connection Based on Freshwater Fish Phylogeography (Luciobarbus, Cyprinidae). Molecular Phylogenetics and Evolution 18(2): 252–263. doi: 10.1006/mpev.2000.0876 [DOI] [PubMed] [Google Scholar]
- Nikol’skii AM. (1899) Presmykayushchiyasya, amfibii i ryby vtorogo puteshestviya NA Zarudnego v Persiyu v 1898 g [Reptiles, amphibians and fishes collected on the second expedition of NA Zarudnyi to Persia in 1898]. Ezhegodnik Zoologicheskago Muzeya Imperatorskoi Akademii Nauk, St. Petersburg: 4: 375–417. [Google Scholar]
- Özuluğ M, Freyhof J. (2008) Capoeta turani, a new species of barbel from River Seyhan, Turkey (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 19(4): 289–296. [Google Scholar]
- Posada D, Crandall KA. (1998) Modeltest: Testing the model of DNA substitution. Bioinformatics 14: 817–818. doi: 10.1093/bioinformatics/14.9.817 [DOI] [PubMed] [Google Scholar]
- Rainboth WJ. (1981) Systematics of the Asiatic Barbins (Pisces, Cyprinidae). Unpubl. Ph.D. Dissertation The University of Michigan, Ann Arbor. [Google Scholar]
- Schöter C, Özuluğ M, Freyhof J. (2009) Capoeta caelestis, a new species from Göksu River, Turkey (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 20(3): 229–236. [Google Scholar]
- Stamatakis A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: . doi: 10.1093/bioinformatics/btl446 [DOI] [PubMed] [Google Scholar]
- Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2013) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731–2739. doi: 10.1093/molbev/msr121 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Teimori A, Mostafavi H, Esmaeili HR. (2016) An update note on diversity and conservation of the endemic fishes in Iranian inland waters. Turkish Journal of Zoology 40: 87–102. doi: 10.3906/zoo-1407-2 [Google Scholar]
- Turan C. (2008) Molecular systematics of Capoeta (Cyprinidae) species complex inferred from mitochondrial 16s rDNA sequence data. Acta Zoologica Cracoviensia 51A(1-2): 1–14. doi: 10.3409/azc.51a_1-2.1-14 [Google Scholar]
- Turan D, Kottelat M, Ekmekçi FG. (2008) Capoeta erhani, a new species of cyprinid fish from Ceyhan River, Turkey (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 19(3): 263–270. [Google Scholar]
- Turan D, Kottelat M, Ekmekçi FG, Imamoglu HO. (2006a) A review of Capoeta tinca, with descriptions of two new species from Turkey (Teleostei: Cyprinidae). Revue Suisse de Zoologie 113(2): 421–436. doi: 10.5962/bhl.part.80358 [Google Scholar]
- Turan D, Kottelat M, Kirankaya SG, Engin S. (2006b) Capoeta ekmekciae, a new species of cyprinid fish from northeastern Anatolia (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 17(2): 147–156. [Google Scholar]
- Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN. (2005) DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 360(1462): 1847–1857. doi: 10.1098/rstb.2005.1716 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiao W, Zhang Y, Liu H. (2001) Molecular systematics of Xenocyprinae (Teleostei: Cyprinidae): taxonomy, biogeography, and coevolution of a special group restricted in East Asia. Molecular Phylogenetics and Evolution 18: 163–173. doi: 10.1006/mpev.2000.0879 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.