Abstract
Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various plant physiological responses. To determine the functions of calmodulin in fleshy fruit, expression studies were performed on a family of six calmodulin genes (SlCaMs) in mature-green stage tomato fruit in response to mechanical injury and Botrytis cinerea infection. Both wounding and pathogen inoculation triggered expression of all those genes, with SlCaM2 being the most responsive one to both treatments. Furthermore, all calmodulin genes were upregulated by salicylic acid and methyl jasmonate, two signaling molecules involved in plant immunity. In addition to SlCaM2, SlCaM1 was highly responsive to salicylic acid and methyl jasmonate. However, SlCaM2 exhibited a more rapid and stronger response than SlCaM1. Overexpression of SlCaM2 in tomato fruit enhanced resistance to Botrytis-induced decay, whereas reducing its expression resulted in increased lesion development. These results indicate that calmodulin is a positive regulator of plant defense in fruit by activating defense pathways including salicylate- and jasmonate-signaling pathways, and SlCaM2 is the major calmodulin gene responsible for this event.
Keywords: calcium signaling, plant defense, salicylic acid, jasmonic acid, postharvest decay
1. Introduction
Calcium is a universal second messenger involved in growth, development and mediating responses to a variety of abiotic and biotic stresses in plants [1,2,3]. Cellular changes in calcium are captured by calcium sensors containing the EF-hand motif. Calmodulin (CaM) is a ubiquitous calcium sensor in plants, and plays an important role in almost all aspects of cell activity [4,5,6]. In contrast to animals which have one or a few CaM genes encoding identical isoforms, plants have multiple genes encoding more diversified isoforms. In all plants examined, CaM genes, even genes encoding the same isoform, are differentially expressed in response to numerous external stimuli such as touch, heat shock, cold, light, pathogens, and to phytohormones. In Arabidopsis, seven CaM genes encode four highly conserved isoforms. A loss-of-function mutant in Arabidopsis AtCaM2 affects pollen germination [7]. The atcam3 knockout mutant exhibits reduced thermo-tolerance after heat treatment, whereas overexpression of AtCaM3 significantly increases thermo-tolerance [8]. In soybean, specific CaM isoforms SCaM-4 and SCaM-5, are highly induced either by a fungal elicitor or pathogen attack, whereas three other SCaMs show no response to these stimuli [9]. Transgenic tobacco plants overexpressing SCaM-4 and SCaM-5 display spontaneous lesions and constitutive expression of systemic acquired resistance-associated genes. Thus, the level of individual CaM proteins is differentially regulated in plants upon exposure to various stimuli.
Tomato (Solanum lycopersicum L.) is the second most important vegetable crop, and the total worldwide production in 2012 was 161.8 million tons with a farm gate value of $80 billion. However, over 25% of fresh produce including tomato fruit are lost after harvest due to the mechanical damage during handling, transportation, and decay [10]. Previous studies on the function of tomato CaMs have focused on their role in vegetative tissues. Bergey and Ryan (1999) reported an accumulation of CaM mRNA and CaM protein in tomato leaves after wounding or systemin treatment, suggesting that it plays a role in plant defense [11]. Zhao et al. (2013) reported that there are six CaM genes in tomato encoding for four isoforms [12]. SlCaMs in leaves were highly responsive to a variety of biotic and abiotic stimuli. Silencing SlCaM2 and SlCaM6 altered expression of defense-related genes and reduced resistance to pathogens. However, there is a gap in the literature concerning the importance of CaM in the ripening of fleshy fruit, as well as in response to stresses that can be encountered during postharvest handling and storage. In this study, we report an expression analysis of CaM gene family in response to postharvest stresses, and characterization of the functional significance of a specific CaM gene responsible for disease resistance in tomato fruit.
2. Results
2.1. SlCaMs Are Responsive to Mechanical Wounding
To study the effect of wounding on SlCaMs expression, mature green stage fruit were selected because this is the specific stage that is routinely harvested by the tomato industry, Without wounding, the most abundantly expressed genes were SlCaM1 and SlCaM5 (Figure 1). After wounding, the expression of all SlCaMs were stimulated within one hour after treatment and peaked following 2–4 h. Among them, SlCaM2 showed the most profound stimulation. Its expression increased more than 10-fold in one hour, and peaked at 32-fold within two hours. Wounding also increased the expression of SlCaM3, SlCaM4 and SlCaM6 2–4 fold, albeit at lower levels. However, wounding had little effect on the expression of SlCaM1 and SlCaM5. SlPR2b and SlLAP-A1, two genes known to be induced by wounding [13,14] were used as a positive control, and their expression was triggered by wounding as expected. These results collectively suggest that SlCaMs in tomato fruit are wound-responsive.
Figure 1.
Expression of SlCaMs in wounded tomato fruit. Transcription levels of SlCaMs were measured by RT-qPCR. Relative gene expression levels are shown following normalization with actin transcript values. Error bars represent standard error of the mean. For each gene, different letters indicate statistically significant differences among mean values (p < 0.05). The results are based on at least three repeats in three independent experiments.
2.2. Pathogen Infection Triggers Calmodulin Gene Expression
Wounding is a prerequisite for most fungal postharvest pathogens that cause decay during storage. To investigate the effects of pathogen infection on SlCaMs expression, wounded tomato fruit were inoculated with the necrotrophic fungal pathogen, Botrytis cinerea. The growth of the fungus was observed two days postinoculation. The inoculated wounds displayed extensive water soaking, mycelial growth, and necrosis. In contrast, the control treatments (mock inoculation), wounds containing water only, were asymptomatic. Additionally, the expression levels of SlCaMs in response to pathogen infection were investigated. Since wounding triggered SlCaMs gene expression, much of the increased SlCaMs in early time points after both mock and pathogen-inoculation may have resulted from wounding (Figure 2). However, the pathogen-treatment had a more profound and prolonged stimulation of all SlCaMs than the mock inoculation. After 24 h of treatment, expression differences between pathogen- and mock inoculation were more distinguishable. For instance, SlCaM2 exhibited the most dramatic stimulation in response to pathogen infection and mock inoculation immediately after treatment, suggesting that this stimulatory effect resulted mainly from physical wounding. However, following 24 h inoculation, the wound effect on SlCaM2 expression declined, and the pathogen effect was evident. Similarly, pathogen treatment enhanced the expression of SlCaM1, SlCaM3, SlCaM4 and SlCaM5 24 h post inoculation. SlPR2b was stimulated by 87–106 fold after 1 h of treatments mainly due to the effect of wounding. However, it was increased over 13,600 fold at 24 h post inoculation. Interestingly, the expression of SlPR1 was remarkably high after 24 h post inoculation. These results suggest that SlCaMs could be involved in signaling events during fungal infection by B. cinerea.
Figure 2.
Expression of SlCaMs in response to fungal infection. Tomato fruit at the mature-green stage were mechanically wounded and immediately treated with water (mock inoculation) or inoculated with Botrytis cinerea conidia. The wounded and wounded-plus-inoculated areas were excised after 0 to 48 h of incubation at 20 °C. Total RNA samples for RT-PCR were isolated from pericarp tissue and transcript levels of SlCaMs genes were determined by RT-qPCR. Relative gene expression levels are shown following normalization with actin transcript values. For each gene, different letters indicate statistically significant differences among mean values (p < 0.05). The results are based on at least three repeats in three independent experiments.
2.3. Calmodulin Genes Are Salicylic Acid-Responsive
Salicylic acid (SA) is a key signaling molecule for the activation of genes involved in systemic acquired resistance to both biotic and abiotic stresses [13,15]. Treating harvested fruits with SA can help reduce decay incidence by activating defense genes such as PR-1 and PR-2 [16,17,18,19,20]. To determine whether SA affects the expression of SlCaMs, fruits were treated with salicylic acid for different time periods ranging from 0 to 48 h. Previously, it was observed that SlPR1, a marker of SA-regulated gene expression, showed the highest induction at 4 mM [21], and thus this concentration of SA was utilized in the following experiments. All SlCaMs were upregulated by SA (Figure 3). There were two peaks for the expression of SlCaM3, SlCaM4 and SlCaM5. The first peak (minor) occurred one hour after treatment, and second peak (major) appeared at or after 24 h. This pattern was similar to that of the SA-responsive gene SlPR1. In comparison, only one peak was observed for SlCaM1 and SlCaM6 after 8 or 24 h of treatment. However, the highest induction was observed after 24 h of treatment for all CaMs.
Figure 3.
SlCaMs expression levels in response to salicylic acid treatment. Transcription levels of SlCaMs genes were investigated by quantitative real time RT-qPCR. Mature green stage fruit were treated with 4 mM salicylic acid for different time periods as indicated. Relative gene expression levels are shown following normalization with actin transcript values. Error bars represent the standard error of the mean. For each gene, different letters indicate statistically significant differences among the means (p < 0.05). The results are based on at least three repeats in three independent experiments.
2.4. Methyl Jasmonate Stimulates Calmodulin Gene Expression
Jasmonic acid (JA) is another signal molecule that regulates plant responses to wounding/insect stress and necrotrophic pathogen attack [13,22]. To investigate the expression patterns of SlCaMs in response to JA, fruits were treated with 20 μM methyl jasmonate (MeJA), the methyl ester of JA. The expression of all SlCaMs increased after applying MeJA (Figure 4). The stimulatory response for SlCaM2, SlCaM3 and SlCaM6 was detected one hour after treatment. However, significant changes were evident 4 h post treatment for SlCaM1, and at 8 h post treatment for SlCaM3, SlCaM4 and SlCaM5. The most JA-responsive genes were SlCaM1 and SlCaM2. It is interesting to note that the expression of SlCaM2 exhibited a wave-like pattern in response to MeJA. The first peak appeared at one hour, the second at 8 h, and the third at 48 h, which was similar to the expression pattern of the JA-responsive gene SlPR2b. These results suggest that SlCaM2 is both a JA early responsive and late responsive gene. Taken together, SlCaMs positively respond to JA in tomato fruit, which is opposite to JA’s effect on those genes in leaf tissue. Interestingly, the expression of all six SlCaMs in tomato leaves was inhibited by MeJA treatment, suggesting that there is tissue differential expression for SlCaMs’ response to JA [12].
Figure 4.
SlCaMs gene expression in response to methyl jasmonate treatment. Transcription levels of SlCaMs genes were investigated by quantitative real time RT-qPCR. Mature green stage fruit were treated with 20 μM methyl jasmonate for different periods of time. Relative gene expression levels are shown following normalization with actin transcript values. Error bars represent standard error of the mean. For each gene, different letters indicate statistically significant differences among mean values (p < 0.05). The results are based on at least three repeats in three independent experiments.
2.5. Overexpression of the SlCaM2 Gene Reduces Symptoms Incited by Botrytis Cinerea
Since SlCaM2 was the only gene highly responsive to wounding and pathogen infection, as well as SA and MeJA, it was selected for further functional analysis in planta. To quickly assess transgene expression in fruit, we selected the agroinjection method to transiently express SlCaM2 in the early mature-green stage tomato fruit. We introduced SlCaM2-sense and antisense constructs into tomato fruit via Agrobacterium tumefaciens. Forty-eight hours after injection, the expression level of SlCaM2 in control (vector alone) was ~2–3 fold higher than non-transgenic fruit (WT) (Figure 5A), suggesting that Agrobacterium itself could stimulate the expression of the endogenous SlCaM2 expression. However, as compared to empty vector alone, the expression level of SlCaM2 in the sense fruit was over five fold higher 48 h after injection. In contrast, the expression in the antisense fruit was reduced 4–5 times as compared to the vector only control. These results demonstrate that the transient Agrobacterium-mediated transformation methodology was a viable choice to study candidate gene function in tomato fruits.
Figure 5.
Expression level of SlCaM2 in tomato fruit in relation to B. cinerea infection. Mature green stage fruits were agroinjected with A. tumefaciens carrying different constructs. pDF28F, empty vector (control); 35S:SlCaM2-S, pDL28F carrying SlCaM2 in the sense orientation; 35S:SlCaM2-A, pDL28F carrying SlCaM2 in the antisense orientation. (A) Examination of expression levels of SlCaM2 in different transgenic fruits. 48 h after agroinjection, a piece of pericarp tissue from each fruit was used for RT-qPCR. The results are based on at least three repeats in three independent experiments. For each gene, different letters indicate statistically significant differences among mean values (p < 0.05). (B) Pathogen resistance and susceptibility test shows that overexpression of SlCaM2 enhanced resistance to B. cinerea. The fruits agroinjected with different constructs were inoculated into a wound with water (mock) or B. cinerea conidia, and put in a moisture saturated container to observe decay development. The photos were taken 72 h post inoculation.
At 48 h post agroinjection, B. cinerea conidial suspensions or water were pipetted into wounds (via nail punctures) on transgenic fruit, and monitored for decay development. In the first 24 h, no obvious symptoms were observed. At 2 days postinoculation, control and antisense fruit started to display water soaking and necrosis, while the pathogen inoculated wounds in sense fruit showed some slight necrosis. Three days postinoculation, the control fruit exhibited severe decay, as lesion development was evident at the inoculation site which included mycelial proliferation, accompanied by soft watery circular lesions that were delineated by healthy tissue. The antisense fruit had similar symptoms of decay compared to the control (Figure 5B). However, sense fruit showed limited necrosis and limited water-soaking. All the mock inoculated fruit were asymptomatic at the inoculation sites. These results indicate that increased expression of SlCaM2 enhanced resistance to B. cinerea, and ultimately limited fungal growth, lesion development, and colonization in tomato fruit.
3. Discussion
Fleshy fruits are an important part of the human diet, providing fiber, minerals, nutrients and various other substances beneficial to human health. Nearly a quarter of all fresh fruits and vegetables in the U.S. market are lost after harvest due to damage caused by abiotic and biotic stresses such as wounding and pathogen infection [10]. The importance of calcium in fruit ripening and postharvest handling has been recognized for many years. Calcium is most frequently associated with delayed ripening maintaining fruit quality (particularly firmness), and preventing decay through the strengthening of cell walls by cross-linking de-esterified pectic acid residues [23,24,25,26,27,28,29,30]. However, it is well-recognized that calcium mediated signaling is important for plant responses to a wide variety of stresses including mechanical touch and pathogen attack [1,2,3,31]. Intracellular calcium changes in response to those stimuli are perceived and decoded by calcium sensors including CaM [4,5,6]. Further, CaM genes themselves respond to the biotic and abiotic signals. In tomato, wounding or systemin increased the accumulation of CaM in leaves [11]. Zhao et al. (2013) reported that SlCaMs in tomato leaves were highly responsive to a variety of biotic and abiotic stimuli [12]. Silencing of SlCaM2 and SlCaM6 led to the reduced resistance to tobacco rattle virus and Pythium aphanidermatum. However, it did not affect the resistance to Pseudomonas syringae and Xanthomonas oryzae. In this study, we found that six SlCaMs, especially SlCaM2, in tomato fruits were upregulated by mechanical wounding, necrotrophic fungal infection, SA and JA. It is important to note that SlCaMs genes respond to JA in leaves and fruits very differently. Thus, there may be tissue specificities for SlCaMs expression in response to stresses that accompany functional changes in different tissues.
SA and JA are two major signal molecules that mediate plant defense responses. In general, the SA-dependent pathway is activated by biotrophic pathogens, while the JA pathway is triggered by necrotrophs and herbivore attack/wounding [13,22,32,33]. The interactions between those two pathways can be antagonistic or synergistic [34,35]. It has been reported that the necrotrophic pathogens such as Botrytis cinerea can produce an exopolysaccharide, which acts as an elicitor of SA pathway in tomato [36,37]. We observed that SA-responsive gene SlPR1was remarkably stimulated by Botrytis infection which supported their findings (Figure 2). It has been well documented that the synthesis of SA and SA signaling are under extensive regulation by calcium signaling [38,39,40,41,42]. Cross-talk between the JA signaling pathway and calcium signaling also occurs [43,44]. A calcium/CaM-regulated transcription factor AtSR1/CAMTA3 has been shown to be involved in both SA- and JA-dependent pathways [45,46]. Analysis of the AtSR1/CAMTA3 gene knockout mutant showed enhanced resistance to both biotrophic and necrotrophic pathogens [41,47]. Previously, the expression patterns of SlSRs, the orthologs of AtSRs/CaMTAs in tomato, were analyzed. All of them displayed a positive response to both SA and MeJA in tomato fruit [21]. Therefore SlSRs could be candidate targets for SlCaMs in controlling disease resistance. In addition, there are quite a few other CaM-target proteins involved in SA-signaling that respond both positively and negatively [38,39,40,41,42]. Considering six SlCaM genes encoding four isoforms, the regulation of wounding and disease resistance in tomato fruit by calcium/CaM is hypothesized to be complex. Nevertheless, SlCaM2 will be a first choice for further expression and functional analysis studies in tomato fruits. Introducing SlCaM2 into tomato, by classical breeding or through molecular means, might enhance the tolerance/resistance to mechanical injury, pathogens, and other stresses leading to the availability of high quality fresh fruit for consumption.
4. Experimental Section
4.1. Plant Materials
Tomato plants (S. lycopersicum cv. Moneymaker) were grown in a greenhouse at 28 °C with a 16 h/8 h (light/dark) cycle. Fruit were harvested at the mature green stage (MG), as defined by USDA-ARS criteria [48], when the fruits were physiologically mature but not yet ripe. In the industry, tomatoes are often harvested at this stage for packing and shipment, and subsequently treated with ethylene to promote ripening prior to sale. The greenhouse-grown MG fruit were held under ambient conditions overnight to reduce harvest shock prior to treatment.
4.2. Mechanical Injury, Methyl Jasmonate and Salicylic Acid Treatments
Wounding was executed by manually cutting fruit pericarp into one inch pieces with a sharp knife at room temperature. The fruit pieces were put in a plastic box with the wet towel to maintain high humidity for the indicated time period. For SA treatment, fruits were immersed in 4 mM SA solution for 0 to 48 h. For MeJA treatment, fruits were sealed in a jar with 20 μM MeJA. After each treatment, pericarp samples were immediately frozen in liquid nitrogen and stored at −80 °C.
4.3. Pathogen Infection and Decay Assay
Fruits were mechanically injured and infected by inoculation with a conidial suspension of the fungal pathogen B. cinerea strain 22B which was isolated from naturally infected apple fruit [49]. The fungus was propagated via single spore isolate and maintained on Potato Dextrose Agar. The inoculation was done essentially as described previously [21]. Briefly, fruit were punctured (3 mm depth, 2 mm diameter) at six sites around the equator of each fruit; 3 sites with 10 µL of conidial suspension (1 × 104 conidia/mL), and the other three with 10 µL of sterile Tween20-treated water for mock inoculation. After inoculation, the fruit were stored in plastic sealed containers with moist towels to maintain high humidity and kept at 20 °C. Pericarp tissue samples were obtained from inoculated fruits by using a cork borer to isolate the tissue immediately surrounding the inoculated area at different intervals after treatment. The pericarp tissue was collected from fruit at the different time points, frozen in liquid nitrogen and stored at −80 °C.
4.4. RNA Extraction and RT-qPCR
Total RNA was isolated from frozen tissue using RNeasy Plant Mini Kit following the manufacturer’s instruction (Qiagen, Valencia, CA, USA). Reverse transcription and qPCR were performed as described [21]. Briefly, one μg of total RNA was used to synthesize cDNA with iScript™ kit (Bio-RAD, Hercules, CA, USA), RT-qPCR analysis of cDNA was performed on a CFX96 Real-time System (Bio-RAD). Gene specific primers listed in Table 1 were designed with the Primer3 software [50]. The efficiency coefficient E was calculated for all primer pairs individually by plotting the relationship between Cq value (threshold cycle) and log[cDNA]. All reactions were performed in triplicate from three independent samples. Cq was used for relative quantification of the input target number. Relative fold difference (N) was the number of the treated target gene copies relative to the untreated control gene copies and is calculated as follows: N = 2ΔCq. ΔCq was the difference in threshold cycles for SlCaMs targets and the actin internal reference. Relative gene expression (fold changes) was calculated based on N with the lowest value as 1. Student’s t test (p < 0.05) was used to determine the significant difference of relative expression of individual genes among different treatments and controls (Microsoft Excel 2007).
Table 1.
Primers used for qPCR and cloning.
Primer Name | Oligonucleotides | Gene ID |
---|---|---|
SlCaM1-a | CCAGAGTTCCTTAACCTGATGG | Solyc01g008950 |
SlCaM1-b | CTTTTCGCCTAGGTTTGTCATC | |
SlCaM2-a | TCTGAGGAGGAGTTGAAAGAGG | Solyc10g081170 |
SlCaM2-b | TCAACATCAGCTTCCCTAATCA | |
SlCaM3-a | GATGGTAATGGAACCATCGACT | Solyc10g077010 |
SlCaM3-b | CATCAGTGAGCTTCTCACCAAG | |
SlCaM4-a | TCAGATCTCGGAGTTCAAAGAAG | Solyc11g072240 |
SlCaM4-b | CAGGTTAAGGAACTCAGGGAAGT | |
SlCaM5-a | TTAACTTGATGGCTCGGAAGAT | Solyc12g099990 |
SlCaM5-b | ACGAATCATCTCGTCAACCTCT | |
SlCaM6-a | ATCACTTGGTCAGAATCCCACT | Solyc03g098050 |
SlCaM6-b | AGCTGCAGAAATAAAGCCATTC | |
SlPR1-a | CTGTGAAGATGTGGGTTGATGAG | NM-001247429 |
SlPR1-b | TCTCCAGTTACCTGGTGGATCAT | |
SlPR2b-a | TCTTGCCCCATTTCAAGTTC | M80608 |
SlPR2b-b | TGCACGTGTATCCCTCAAAA | |
SlLAPA1-a | TGTCGCAGCATGTGAAAATATG | Solyc12g010020 |
SlLAPA1-b | AGCACCAGTTAATGTTGCCAGA | |
SlActin-a | GAAATAGCATAAGATGGCAGACG | X55749 |
SlActin-b | ATACCCACCATCACACCAGTAT | |
SlCaM2-S1 * | ggtggtaccATGGCGGATCAGCTGACGG | |
SlCaM2-S2 * | ggaggatccCTTGGCCATCATGACCTTAAC | |
SlCaM2-A1 * | ggtggtaccCTTGGCCATCATGACCTTAAC | |
SlCaM2-A2 * | ggaggatccATGGCGGATCAGCTGACGG |
* Primers used for cloning full length SlCaM2. The underlined portion indicates the restriction enzyme site.
4.5. Construction of Ti Plasmids Carrying Sense- and Antisense-SlCaM2 Gene
The full length tomato SlCaM2 was amplified from a mixture of fruit tissues by Pfx DNA polymerase, and subcloned to TA cloning Kit (Life Technology, Grand Island, NY, USA) using gene specific primers (Table 1). The nucleotide sequences of the positive clones were confirmed by sequencing. The full length of SlCaM2 was subcloned into pDL28F, a derivative of pCambia1300 [41] in the sense- and antisense- orientations in the sites of Kpn I and BamH I downstream of 35S promoter, and introduced into Agrobacterium tumefaciens strain GV3101. The positive clones were verified by PCR using gene-specific primers.
4.6. Fruit Agroinjection
Agroinjection of tomato fruit was carried as described [51]. Briefly, agrobacterium cultures were grown overnight from individual colonies at 28 °C in YEB medium plus selective antibiotics, transferred to induction medium (0.5% beef extract, 0.1% yeast extract, 0.5% peptone, 0.5% sucrose, 2 mM MgSO4, 20 μM acetosyringone, 10 mM MES, pH 5.6) plus antibiotics, and grown again overnight. The next day, cultures were resuspended with infiltration medium (10 mM MgCl2, 10 mM MES, 200 μM acetosyringone, pH 5.6 with OD600 of 1.0), and incubated at room temperature with gentle agitation (20 rpm) for a minimum of 2 h. Cultures were injected into the early mature green fruit using a syringe with a 0.5- × 16-mm needle. The needle was introduced into the fruit tissue through the stylar apex and blossom end. Because of differences in fruit size, the injection was terminated when the solution started running off the injection site.
5. Conclusions
Calmodulin, a ubiquitous calcium receptor in the eukaryotic cell, plays an important role in almost all aspects of cell activity in plants [4,5,6]. Previous studies have suggested that calmodulins in tomato vegetative tissues respond to a variety of biotic and abiotic stimuli, such as wounding or systemin treatment [11] and pathogen attack [12]. We have observed that the expression levels of six SlCaMs in mature green tomato fruit are stimulated by mechanical injury and B. cinerea infection. Among the six genes, SlCaM2 was the most responsive to both pathogen infection and wounding. Further, expressions of all SlCaMs were upregulated by SA and MeJA which occurs 24 and 8 h after treatment, respectively. However, SlCaM2 also had a detectable peak as early as one hour after treatment by SA and MeJA. In general, SlCaMs in tomato fruit are early wound-responsive genes, but late responsive genes to pathogen attack, JA and SA. SlCaMs may regulate the wound response and disease resistance via SA- and/or JA-dependent signaling in fruit. Based on its gene expression level, SlCaM2 is the major CaM gene in tomato fruit that responds to mechanical injury and pathogen attack. Transient expression of SlCaM2 into mature green tomato fruit significantly increases resistance to B. cinerea. Conversely, reducing its expression facilitates pathogen growth in the host. Since SlCaM2 is an SA-responsive gene, it will be interesting to test whether increasing its expression also confers resistance to biotrophic pathogens (i.e., Cladosporium fulvum). Moreover, it will be of great utility to identify target(s) of SlCaM2 to improve overall fruit quality by strengthening tolerance to wounding and concomitantly increasing disease resistance to fungal postharvest plant pathogens.
Acknowledgments
We thank Ernest Paroczay and Ziying Zou for their excellent technical support, Verneta Gaskins for assisting with the pathogen infection assays and Liqun Du for providing pDL28F plasmid. Use of a company or product name by the U.S. Department of Agriculture does not imply approval or recommendation of the product to the exclusion of others that may also be suitable. This research was funded by USDA-ARS NP306 project no. 1245-43000-012-00D.
Author Contributions
H. Peng performed gene expression experiments and statistical analysis of the expression data, and helped to evaluate the data. W. Jurick designed and performed pathogen inoculation and decay experiments. T. Yang established all the experiments, analyzed data and wrote the manuscript. H. Peng and W. Jurick edited the manuscript.
Conflicts of Interest
The authors declare no conflict of interest.
References
- 1.Dodd A.N., Kudla J., Sanders D. The language of calcium signaling. Annu. Rev. Plant Biol. 2010;61:593–620. doi: 10.1146/annurev-arplant-070109-104628. [DOI] [PubMed] [Google Scholar]
- 2.Batistic O., Kudla J. Analysis of calcium signaling pathways in plants. BBA Gen Subj. 2012;1820:1283–1293. doi: 10.1016/j.bbagen.2011.10.012. [DOI] [PubMed] [Google Scholar]
- 3.DeFalco T.A., Bender K.W., Snedden W.A. Breaking the code: Ca2+ sensors in plant signalling. Biochem. J. 2010;425:27–40. doi: 10.1042/BJ20091147. [DOI] [PubMed] [Google Scholar]
- 4.Reddy A.S.N., Ali G.S., Celesnik H., Day I.S. Coping with stresses: Roles of calcium- and calcium/calmodulin-regulated gene expression. Plant Cell. 2011;23:2010–2032. doi: 10.1105/tpc.111.084988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Yang T., Poovaiah B.W. Calcium/calmodulin-mediated signal network in plants. Trends Plant Sci. 2003;8:505–512. doi: 10.1016/j.tplants.2003.09.004. [DOI] [PubMed] [Google Scholar]
- 6.Bouche N., Yellin A., Snedden W.A., Fromm H. Plant-specific calmodulin-binding proteins. Annu. Rev. Plant Biol. 2005;56:435–466. doi: 10.1146/annurev.arplant.56.032604.144224. [DOI] [PubMed] [Google Scholar]
- 7.Landoni M., de Francesco A., Galbiati M., Tonelli C. A loss-of-function mutation in calmodulin2 gene affects pollen germination in Arabidopsis thaliana. Plant Mol. Biol. 2010;74:235–247. doi: 10.1007/s11103-010-9669-5. [DOI] [PubMed] [Google Scholar]
- 8.Zhang W., Zhou R.G., Gao Y.J., Zheng S.Z., Xu P., Zhang S.Q., Sun D.Y. Molecular and genetic evidence for the key role of AtCaM3 in heat-shock signal transduction in Arabidopsis. Plant Physiol. 2009;149:1773–1784. doi: 10.1104/pp.108.133744. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Heo W.D., Lee S.H., Kim M.C., Kim J.C., Chung W.S., Chun H.J., Lee K.J., Park C.Y., Park H.C., Choi J.Y., et al. Involvement of specific calmodulin isoforms in salicylic acid-independent activation of plant disease resistance responses. Proc. Natl. Acad. Sci. USA. 1999;96:766–771. doi: 10.1073/pnas.96.2.766. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hodges R.J., Buzby J.C., Bennett B. Postharvest losses and waste in developed and less developed countries: Opportunities to improve resource use. J. Agric. Sci. 2011;149:37–45. doi: 10.1017/S0021859610000936. [DOI] [Google Scholar]
- 11.Bergey D.R., Ryan C.A. Wound- and systemin-inducible calmodulin gene expression in tomato leaves. Plant Mol. Biol. 1999;40:815–823. doi: 10.1023/A:1006247624823. [DOI] [PubMed] [Google Scholar]
- 12.Zhao Y., Liu W., Xu Y.P., Cao J.Y., Braam J., Cai X.Z. Genome-wide identification and functional analyses of calmodulin genes in Solanaceous species. BMC Plant Biol. 2013;13 doi: 10.1186/1471-2229-13-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Robert-Seilaniantz A., Grant M., Jones J.D.G. Hormone crosstalk in plant disease and defense: More than just jasmonate-salicylate antagonism. Annu. Rev. Phytopathol. 2011;49:317–343. doi: 10.1146/annurev-phyto-073009-114447. [DOI] [PubMed] [Google Scholar]
- 14.Chao W.S., Gu Y.Q., Pautot V., Bray E.A., Walling L.L. Leucine aminopeptidase RNAs, proteins, and activities increase in response to water deficit, salinity, and the wound signals systemin, methyl jasmonate, and abscisic acid. Plant Physiol. 1999;120:979–992. doi: 10.1104/pp.120.4.979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Vlot A.C., Dempsey D.A., Klessig D.F. Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 2009;47:177–206. doi: 10.1146/annurev.phyto.050908.135202. [DOI] [PubMed] [Google Scholar]
- 16.Asghari M., Aghdam M.S. Impact of salicylic acid on post-harvest physiology of horticultural crops. Trends Food Sci. Technol. 2010;21:502–509. doi: 10.1016/j.tifs.2010.07.009. [DOI] [Google Scholar]
- 17.Tornero P., Gadea J., Conejero V., Vera P. Two PR-1 genes from tomato are differentially regulated and reveal a novel mode of expression for a pathogenesis-related gene during the hypersensitive response and development. Mol. Plant Microbe Interact. 1997;10:624–634. doi: 10.1094/MPMI.1997.10.5.624. [DOI] [PubMed] [Google Scholar]
- 18.Uquillas C., Letelier I., Blanco F., Jordana X., Holuigue L. NPR1-independent activation of immediate early salicylic acid-responsive genes in Arabidopsis. Mol. Plant Microbe Interact. 2004;17:34–42. doi: 10.1094/MPMI.2004.17.1.34. [DOI] [PubMed] [Google Scholar]
- 19.Van Loon L.C., Rep M., Pieterse C.M.J. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006;44:135–162. doi: 10.1146/annurev.phyto.44.070505.143425. [DOI] [PubMed] [Google Scholar]
- 20.Rohwer C.L., Erwin J.E. Jasmonate-induced changes in polyphenol oxidase, peroxidase, and proteinase inhibitors in horticultural species. Hortscience. 2006;41:1072–1072. [Google Scholar]
- 21.Yang T.B., Peng H., Whitaker B.D., Jurick W.M. Differential expression of calcium/calmodulin-regulated SlSRs in response to abiotic and biotic stresses in tomato fruit. Physiol. Plantarum. 2013;148:445–455. doi: 10.1111/ppl.12027. [DOI] [PubMed] [Google Scholar]
- 22.Kazan K., Manners J.M. Jasmonate signaling: Toward an integrated view. Plant Physiol. 2008;146:1459–1468. doi: 10.1104/pp.107.115717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Saftner R.A., Bai J.H., Abbott J.A., Lee Y.S. Sanitary dips with calcium propionate, calcium chloride, or a calcium amino acid chelate maintain quality and shelf stability of fresh-cut honeydew chunks. Postharvest. Biol. Technol. 2003;29:257–269. doi: 10.1016/S0925-5214(03)00041-3. [DOI] [Google Scholar]
- 24.Abbott J.A., Conway W.S., Sams C.E. Postharvest calcium-chloride infiltration affects textural attributes of apples. J. Am. Soc. Hortic. Sci. 1989;114:932–936. [Google Scholar]
- 25.Park S., Cheng N.H., Pittman J.K., Yoo K.S., Park J., Smith R.H., Hirschi K.D. Increased calcium levels and prolonged shelf life in tomatoes expressing Arabidopsis H+/Ca2+ transporters. Plant Physiol. 2005;139:1194–1206. doi: 10.1104/pp.105.066266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ritenour M.A., Stoffella P.J., He Z.L., Narciso J.A., Salvatore J.J. Postharvest calcium chloride dips of whole tomato fruit reduce postharvest decay under commercial conditions. Hortscience. 2006;41:1016–1017. [Google Scholar]
- 27.Saftner R.A., Conway W.S., Sams C.E. Postharvest calcium infiltration alone and combined with surface coating treatments influence volatile levels, respiration, ethylene production, and internal atmospheres of “Golden Delicious” apples. J. Am. Soc. Hortic. Sci. 1999;124:553–558. [Google Scholar]
- 28.Poovaiah B.W., Shekhar V.C. Effects of calcium infiltration of golden delicious apples on fruit firmness and senescence. Hortscience. 1978;13:357–357. [Google Scholar]
- 29.Sams C.E., Conway W.S., Abbott J.A., Lewis R.J., Benshalom N. Firmness and decay of apples following postharvest pressure infiltration of calcium and heat-treatment. J. Am. Soc. Hortic. Sci. 1993;118:623–627. [Google Scholar]
- 30.Conway W.S., Sams C.E. The effects of postharvest infiltration of calcium, magnesium, or strontium on decay, firmness, respiration, and ethylene production in apples. J. Am. Soc. Hortic. Sci. 1987;112:300–303. [Google Scholar]
- 31.Lecourieux D., Raneva R., Pugin A. Calcium in plant defence-signalling pathways. New Phytol. 2006;171:249–269. doi: 10.1111/j.1469-8137.2006.01777.x. [DOI] [PubMed] [Google Scholar]
- 32.Nimchuk Z., Eulgem T., Holt B.F., 3rd, Dangl J.L. Recognition and response in the plant immune system. Annu. Rev. Genet. 2003;37:579–609. doi: 10.1146/annurev.genet.37.110801.142628. [DOI] [PubMed] [Google Scholar]
- 33.Fu Z.Q., Dong X. Systemic acquired resistance: Turning local infection into global defense. Annu. Rev. Plant Biol. 2013;64:839–863. doi: 10.1146/annurev-arplant-042811-105606. [DOI] [PubMed] [Google Scholar]
- 34.Mur L.A.J., Kenton P., Atzorn R., Miersch O., Wasternack C. The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol. 2006;140:249–262. doi: 10.1104/pp.105.072348. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Koornneef A., Leon-Reyes A., Ritsema T., Verhage A., den Otter F.C., van Loon L.C., Pieterse C.M.J. Kinetics of salicylate-mediated suppression of jasmonate signaling reveal a role for redox modulation. Plant Physiol. 2008;147:1358–1368. doi: 10.1104/pp.108.121392. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Abd el Rahman T., el Oirdi M., Gonzalez-Lamothe R., Bouarab K. Necrotrophic pathogens use the salicylic acid signaling pathway to promote disease development in tomato. Mol. Plant Microbe Interact. 2012;25:1584–1593. doi: 10.1094/MPMI-07-12-0187-R. [DOI] [PubMed] [Google Scholar]
- 37.El Oirdi M., Abd el Rahman T., Rigano L., el Hadrami A., Rodriguez M.C., Daayf F., Vojnov A., Bouarab K. Botrytis cinerea manipulates the antagonistic effects between immune pathways to promote disease development in tomato. Plant Cell. 2011;23:2405–2421. doi: 10.1105/tpc.111.083394. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Wang L., Tsuda K., Truman W., Sato M., Nguyen L.V., Katagiri F., Glazebrook J. CBP60g and SARD1 play partially redundant critical roles in salicylic acid signaling. Plant J. 2011;67:1029–1041. doi: 10.1111/j.1365-313X.2011.04655.x. [DOI] [PubMed] [Google Scholar]
- 39.Zhang Y., Xu S., Ding P., Wang D., Cheng Y.T., He J., Gao M., Xu F., Li Y., Zhu Z., et al. Control of salicylic acid synthesis and systemic acquired resistance by two members of a plant-specific family of transcription factors. Proc. Natl. Acad. Sci. USA. 2010;107:18220–18225. doi: 10.1073/pnas.1005225107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Wang L., Tsuda K., Sato M., Cohen J.D., Katagiri F., Glazebrook J. Arabidopsis CaM binding protein CBP60g contributes to MAMP-induced SA accumulation and is involved in disease resistance against Pseudomonas syringae. PLoS Pathogens. 2009;5:e1000301. doi: 10.1371/journal.ppat.1000301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Du L.Q., Ali G.S., Simons K.A., Hou J.G., Yang T.B., Reddy A.S.N., Poovaiah B.W. Ca2+/calmodulin regulates salicylic-acid-mediated plant immunity. Nature. 2009;457:1154–1158. doi: 10.1038/nature07612. [DOI] [PubMed] [Google Scholar]
- 42.Poovaiah B.W., Du L.Q., Wang H.Z., Yang T.B. Recent advances in calcium/calmodulin-mediated signaling with an emphasis on plant-microbe interactions. Plant Physiol. 2013;163:531–542. doi: 10.1104/pp.113.220780. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Leon J., Rojo E., Titarenko E., Sanchez-Serrano J.J. Jasmonic acid-dependent and -independent wound signal transduction pathways are differentially regulated by Ca2+/calmodulin in Arabidopsis thaliana. Mol. Genet. Gen. 1998;258:412–419. doi: 10.1007/s004380050749. [DOI] [PubMed] [Google Scholar]
- 44.Dombrowski J.E., Bergey D.R. Calcium ions enhance systemin activity and play an integral role in the wound response. Plant Sci. 2007;172:335–344. doi: 10.1016/j.plantsci.2006.09.011. [DOI] [Google Scholar]
- 45.Qiu Y.J., Xi J., Du L.Q., Suttle J.C., Poovaiah B.W. Coupling calcium/calmodulin-mediated signaling and herbivore-induced plant response through calmodulin-binding transcription factor AtSR1/CAMTA3. Plant Mol. Biol. 2012;79:89–99. doi: 10.1007/s11103-012-9896-z. [DOI] [PubMed] [Google Scholar]
- 46.Laluk K., Prasad K.V.S.K., Savchenko T., Celesnik H., Dehesh K., Levy M., Mitchell-Olds T., Reddy A.S.N. The calmodulin-binding transcription factor signal responsive1 is a novel regulator of glucosinolate metabolism and herbivory tolerance in Arabidopsis. Plant Cell Physiol. 2012;53:2008–2015. doi: 10.1093/pcp/pcs143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Galon Y., Nave R., Boyce J.M., Nachmias D., Knight M.R., Fromm H. Calmodulin-binding transcription activator (CAMTA) 3 mediates biotic defense responses in Arabidopsis. FEBS Lett. 2008;582:943–948. doi: 10.1016/j.febslet.2008.02.037. [DOI] [PubMed] [Google Scholar]
- 48.Sargent S.A., Moretti C.L. Agricultural Handbook Number 66 (HB66) USDA-ARS; USA: [(accessed on 11 August 2014)]. Tomato. Draft-Updated August 2014. Available online: http://www.ba.ars.usda.gov/hb66/tomato.pdf. [Google Scholar]
- 49.Yan H.J., Jurick W.M., II, Lou Y.G., Gaskins V.L., Kim Y.-K. First report of pyrimethanil resistance in Botrytis cinerea from stored apples in pennsylvania. Plant Dis. 2014;98:999. doi: 10.1094/PDIS-11-13-1120-PDN. [DOI] [PubMed] [Google Scholar]
- 50.Untergrasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B.C., Remm M., Rozen S.G. Primer 3—New capabilities and interfaces. Nucleic Acids Res. 2012;40:e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Orzaez D., Mirabel S., Wieland W.H., Granell A. Agroinjection of tomato fruits. A tool for rapid functional analysis of transgenes directly in fruit. Plant Physiol. 2006;140:3–11. doi: 10.1104/pp.105.068221. [DOI] [PMC free article] [PubMed] [Google Scholar]