Abstract
Citrobacter rodentium is a natural mouse pathogen widely used as a model for enteropathogenic and enterohemorrhagic Escherichia coli infections in humans. While C. rodentium causes self-limiting colitis in most inbred mouse strains, it induces fatal diarrhea in susceptible strains. The physiological pathways as well as the genetic determinants leading to susceptibility have remained largely uncharacterized. Here we use a forward genetic approach to identify the R-spondin2 gene (Rspo2) as a major determinant of susceptibility to C. rodentium infection. Robust induction of Rspo2 expression during infection in susceptible mouse strains causes a potent Wnt-mediated proliferative response of colonic crypt cells, leading to the generation of an immature and poorly differentiated colonic epithelium with deficiencies in ion-transport components. Our data demonstrate a previously unknown role of R spondins and Wnt signaling in susceptibility to infectious diarrhea and identify Rspo2 as a key molecular link between infection and intestinal homeostasis.
Introduction
Enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic Escherichia coli (EHEC) are closely related human-specific diarrheal pathogens that are important causes of morbidity and mortality worldwide, especially in young children1,2. EPEC and EHEC cause characteristic Attaching and Effacing (A/E) lesions in the infected intestine with tight attachment of bacteria to enterocytes, effacement of microvilli structures and profound remodeling of intestinal epithelium and mucosae3,4. Despite evidence of variability in disease severity and clinical outcome of EPEC and EHEC infections5,6, little is known about the mechanisms that regulate host susceptibility to these important pathogens. The mouse-specific pathogen C. rodentium is recognized as a good model for EPEC and EHEC7 and can be used to study the genes implicated in host response to A/E pathogens8. Following C. rodentium infection, the inbred strains C3H/HeJ8 (hereafter called C3), C3H/HeOuJ9 (hereafter called C3Ou), and FVB10 display high levels of mortality while C57BL/6 (B6) mice develop self-limiting colitis9. Transcriptome analysis in total colonic samples from resistant or susceptible infected mice identified a common pathogenic mechanism in C3Ou and FVB mice that implicates decreased levels of expression of the major colonic HCO3−/Cl− exchanger Slc26a3 and the carbonic anhydrase IV (Car4) together with fluid loss in feces and perturbations in electrolyte absorption11. Accordingly, susceptible animals can be rescued by intensive fluid therapy12. We previously reported a genome-wide search carried out in cohorts of F2 progeny of susceptible C3Ou or C3 and resistant B6 mice that led to the identification of a major genetic locus on chromosome 15 controlling mortality during C. rodentium infection, which we called Cri113. Further genotype segregation analyses in F2 (B6 x FVB)14 populations implicate Cri1 as the common genetic cause of susceptibility of C3, C3Ou and FVB mice. Generation of congenic mice with an introgressed segment of chromosome 15 from resistant B6 genome on the susceptible C3Ou genomic background (C3Ou.B6-Cri1) confirmed the effect of Cri1 with full survival of congenic animals and revealed that susceptibility to C. rodentium infection was independent of the bacterial load carried by the host during disease13.
Here, we perform genetic, physical, bioinformatic and functional dissection of the Cri1 locus and identify pathological Rspo2-mediated Wnt activation as a major contributor to mortality following C. rodentium infection in mice. R-spondins have been implicated in intestinal morphogenesis, proliferation and carcinogenesis: our data demonstrate a previously unknown role for these proteins in the response to intestinal infection.
Results
Cri1 mediates susceptibility of AKR/J and B6.C3Ou-Cri1 mice
In addition to C3, C3Ou, and FVB mice, we noted that the AKR/J strain exhibited innate susceptibility to C. rodentium infection, with a mortality rate of 66% by day 30 post-infection (Supplementary Fig. S1). To assess whether susceptibility of AKR/J mice was conferred by the Cri1 locus, we generated an F2 (B6 x AKR/J) population, infected with C. rodentium, and monitored survival. Mice were genotyped at rs3683812, a SNP marker located at the peak of Cri1. Mice homozygous or heterozygous for AKR/J alleles at this marker suffered 63% and 58% mortality respectively, whereas mice homozygous for B6 alleles displayed 4% mortality, clearly demonstrating a role for Cri1 in the susceptibility of AKR/J mice following C. rodentium infection (Supplementary Fig. S2). Thus, Cri1 is the common genetic cause of susceptibility of the only four inbred mouse strains known to be hyper-susceptible to C. rodentium infection (C3, C3Ou, FVB, and AKR).
As described in the introduction, generation of congenic mice with an introgressed segment of chromosome 15 from resistant B6 genome on the susceptible C3Ou genomic background (C3Ou.B6-Cri1) confirmed the effect of Cri1 with full survival of congenic animals. To test the effect of Cri1 on the B6 background, we introgressed of a region of chromosome 15 containing Cri1 from the susceptible C3Ou genome on the resistant B6 background (B6.C3Ou-Cri1). 45% of congenic animals succumbed to infection between days 13 and 28 post-infection (Supplementary Fig. S3a–b). Thus, despite modifying effects of the background genome, the genetic origin of Cri1 is a major determinant of C. rodentium infection outcome.
Implication of Rspo2 in Cri1-mediated susceptibility
Two sub-congenic lines, derived from resistant C3Ou.B6-Cri1 congenic mice and characterized by recombinations within Cri1, were used to refine the localization of the Cri1 locus (Fig 1a). Mice from the sub-congenic A line (congenic region 41.20 – 68.76 Mb.) were resistant to infection (100% survival 30 days post infection), whereas in the sub-congenic B line (congenic region 45.16–62.47 Mb), the introgression of segments from the resistant B6 genome had no effect on survival, leading to 92% mortality of this strain after 14 days of C. rodentium infection. These results unambiguously localize Cri1 to a ~4 Mb interval (Fig 1a, b).
To identify the genetic determinant within this interval, we prioritized the region of overlap of the 95% confidence intervals defined by our previous genome wide analyses13 (Fig 1c). Haplotype analysis of this prioritized region identified a common and specific haplotype block shared by susceptible mice and absent from resistant mouse strains that encompasses only five genes: the proximal region of Rspo2 (including the first two exons), Eif3e, Gm10373, Ttc35 and Tmem74 (Sup Fig 4). We performed sequencing analyses of these five prioritized candidate genes and found no coding differences between susceptible and resistant strains. Expression of all the candidate genes was determined by qPCR in colonic samples from susceptible C3Ou mice or resistant C3Ou.B6-Cri1 mice left uninfected or at several time points after infection (Fig 1d). We found the Rspo2 gene to be rapidly, strongly, and continuously induced during infection in susceptible C3Ou mice whereas no upregulation of Rspo2 transcript was observed in resistant congenic mice. None of the other candidates were differentially regulated in C3ou vs. C3Ou.B6-Cri1 mice, nor were the genes Angpt1, Abra and Oxr1, which are located centromeric to Rspo2, outside of the prioritized haplotype, but still within the minimal interval delineated by genetic and physical mapping (Fig 1d). We further examined Rspo2 expression during C. rodentium infection in resistant B6 mice as well as in susceptible AKR and FVB mice and found that upregulation of Rspo2 during infection is a common and specific feature of all mouse strains displaying Cri1-mediated susceptibility to C. rodentium infection (Fig 1e) including the B6.C3Ou-Cri1 susceptible mice (Supplementary Fig. S3c).
Rspo2 expression in colonic subepithelial stromal cells
Rspo2 encodes a member of the R-Spondin family of secreted proteins (R-spondin 1-4) involved in β-catenin activation through the canonical Wnt pathway15. R-spondins were initially described as mitogens for epithelial cells of the mouse gastrointestinal tract15,16. Recent work has revealed an important role for R-Spondin proteins in the maintenance of intestinal stem cells in vitro via their interaction with Lgr5 receptors17, and transcriptionally-activating gene fusions involving RSPO2 and RSPO3 have been found associated with 10% of colon tumours in humans18. However, the cellular source of R-Spondin and the mechanisms that regulate R-Spondin expression within the intestine remain largely uncharacterized.
To investigate the cellular source of Rspo2 during C. rodentium infection, we performed reciprocal bone marrow chimera experiments with susceptible C3Ou and resistant C3Ou.B6-Cri1 congenic mice. We found that the radio-resistant (non-hematopoietic) compartment conferred both mortality following infection and Rspo2 induction in the chimeric mice (Fig 2a–b). This is consistent with previous work11, suggesting that Cri1-mediated susceptibility is not associated with disregulation of the immune response.
We next used in situ hybridization (ISH) on formalin-fixed, paraffin embedded (FFPE) colon sections from infected C3Ou and C3Ou.B6-Cri1 mice to localize Rspo2-expressing cells. Rspo2 expression was only readily detectable in infected susceptible C3Ou mice (Fig 3a) where evident labeling of cells within the Lamina Propria was observed (Fig 3b). Combined ISH and immunohistochemistry revealed that Rspo2 transcripts were expressed in a cell population including α-smooth muscle actin (α-SMA)- positive intestinal myofibroblasts but excluding Gr1+ infiltrating neutrophils (Fig 3c–d). Together, these results provide evidence that during C. rodentium infection of susceptible mice, Rspo2 expression is induced in subepithelial stromal cells, but not in intestinal epithelial cells or hematopoietic immune cells.
Activation of Wnt signaling in the colon of susceptible mice
Histological analysis of H&E stained FFPE sections showed a significant impact of the Cri1 locus on the kinetics of C. rodentium-induced epithelial hyperplasia (Fig 4a). At 3 and 6 days post-infection, crypt lengths were significantly increased in C3Ou compared to C3Ou.B6-Cri1 mice (Fig 4a). Using PCNA staining to monitor cellular proliferation, we also noted qualitative differences in epithelial proliferation (Fig 4b). By day 6 post-infection, proliferative cells were observed throughout the entire extent of the colonic epithelium in susceptible C3Ou mice with no non-proliferating differentiated compartment observable. In contrast, in resistant congenic mice, the boundary between the proliferative compartment and the differentiated epithelium was well-maintained and proliferation was delayed (Fig 4b).
Wnt signaling was strongly activated upon infection in susceptible mice but not in resistant mice. Although C3Ou and C3Ou.B6-Cri1 mice had similar levels and membranous localization of β-catenin prior to infection, C3Ou mice displayed a striking cytoplasmic accumulation of total and activated β-catenin during infection which was not observed in C3Ou.B6-Cri1 mice (Fig 4c–g). As further evidence of β-catenin activation, we found the Wnt target genes encoding c-Myc, cyclinD1 and the matrix metallopeptidase 7 to be specifically induced in susceptible animals (Fig 4h–j). Treatment of resistant congenic mice during C. rodentium infection with recombinant R-Spondin 2 protein induced β-catenin activation and a proliferative response as compared to control infected and BSA treated animals, and similar to what is observed in susceptible mice (Fig 4k). Overall, these observations demonstrate that Cri1-mediated susceptibility is associated with functional activation of Wnt signaling and a proliferative response, through Rspo2 induction in infected mice.
Loss of intestinal differentiation in susceptible mice
Wnt/β-catenin signaling has a key role in colon homeostasis, allowing maintenance of pluripotent colonic crypt stem cells and the continuous generation of undifferentiated transient amplifying precursors which differentiate as they migrate up the crypts. This gives rise to differentiated absorptive epithelial cells and goblet cells, which are continually sloughed off and replaced every three to four days in mice. Wnt signaling is normally restricted to the proliferative compartment that comprises the bottom third of the colonic crypts: as the cells reach the midcrypt region, Wnt signaling is downregulated to allow cell cycle arrest and differentiation19. Because strong Wnt signaling is known to inhibit colonic epithelial differentiation19,20, and because loss of function of colonic epithelium has been proposed as a mechanism for C. rodentium susceptibility11,12, we hypothesized that Rspo2 induction in susceptible mice would lead to critical perturbations in the differentiation of the large intestinal epithelium. Indeed, a pronounced loss of colonic goblet cells was observed in susceptible animals, as indicated by Alcian blue staining (Fig 3a) and by qPCR analysis of markers of differentiated goblet cells (Fig 3b). Although there was a loss of goblet cells observed in resistant mice, it was minor and delayed compared to what was seen in susceptible mice (Fig 3a–b). The markers of terminally differentiated enterocytes Slc26a3 and Car4 were also found to be dramatically downregulated in susceptible mice (Fig 3c–d). Slc26a3 (previously known as Dra: Down Regulated in Adenocarinomas) encodes the major colonic Cl−/HCO3− exchanger which is exclusively expressed in differentiated enterocytes10,21,22, and together with carbonic anhydrase IV (Car4) forms a functional unit for intestinal electroneutral absorption of chloride23. Importantly, downregulation of Car4 has been independantly linked to lethality after C. rodentium infection11,12 and to excessive Wnt signaling in colonic crypts20. Consistent with these works, we found a dramatic loss of Car4 expression at the mRNA and protein levels, and a 1000 fold downregulation of Slc26a3 transcript in infected susceptible C3Ou mice. The resistant congenic mice C3Ou.B6-Cri1 maintained a significantly higher expression of Slc26a3 and Car4 than the parental C3Ou mice (Fig 3c–d). Mutations in Slc26a3 in humans and mice cause congenital chloride-losing diarrhea24,25, thus providing a link between the consequences of Rspo2 induction and diarrheal disease.
To demonstrate a direct link between activation of Wnt signaling and Cri1 mediated susceptibility to infection, we treated infected susceptible mice with recombinant DKK-1, a well-known antagonist of Wnt signaling. Notably, DKK-1 treatment decreased C. rodentium-induced β-catenin accumulation and activation (Fig 3e), increased levels of goblet cells (Fig 3f–g) and increased Slc26a3 and Car4 expression (Fig h–i) compared to mock-treated infected C3Ou mice. Daily DKK-1 treatment of susceptible mice throughout the course of infection significantly increased survival compared with mock-treated infected mice (40% vs 10% survival; mean survival time 15 days vs 11 days; P value < 0.04) (Fig 3j). Thus, inhibition of Wnt signalling through DKK-1 administration counterbalances the C. rodentium-induced Wnt activation in susceptible mice leading to longer survival in treated animals.
Discussion
Mouse forward genetics is a powerful tool for the identification of genes and pathways important in biological process and has been very valuable for the characterization of key players in bacterial sensing, early response to infection and intestinal inflammation26,27. Here, we describe a single gene that naturally regulates susceptibility to enteric infection by C. rodentium in inbred mouse strains and uncover an unexpected link between bacterial sensing and intestinal homeostasis. Our data leads us to propose a model where C. rodentium induces mucosal Rspo2 expression in susceptible mice, inducing proliferation of intestinal precursors and inhibiting differentiation of mature absorptive enterocytes and goblet cells, ultimately leading to the generation of a poorly differentiated epithelium and to fatal colitis (Fig 6).
We previously measured colon weights in susceptible and resistant congenic mice on day 9 of C. rodentium infection and concluded that Cri1 did not impact intestinal hyperplasia at that time point13. However, data we present here directly measuring crypt heights and cellular phenotypes throughout the course of infection demonstrates that intestinal proliferation following C. rodentium infection is, in fact, kinetically and qualitatively distinct in resistant and susceptible mice. Furthermore, we hypothesize that it is not hyperplasia per se, but rather, the loss of differentiated intestinal function that ultimately leads to death in susceptible strains.
Genetic dissection of the Cri1 locus allowed us to define a critical interval, containing Rspo2, that controls C. rodentium infection outcome. We also unambiguously associate mortality with upregulation of Rspo2 expression. However, the mechanisms that regulate Rspo2 expression in susceptible mice remain to be characterized. The minimal genetic interval for Cri1 contains a haplotype block specific to susceptible mouse strains and containing the proximal region of Rspo2 including the entire intergenic region between Eif3e and Rspo2. We hypothesize that the genetic difference(s) underlying Rspo2 induction and susceptibility to infection localize to this region and confer differences in transcriptional regulation between resistant and susceptible mice. Identification of the specific genetic variations within this region that impact on Rspo2 transcriptional regulation is an important subject for further studies and will provide additional corroboration of the underlying mechanism of susceptibility in these mice.
Tight regulation of the Wnt signaling pathway is critical to ensure normal function of the intestine, and maintaining a proper balance is key to intestinal health. Here we show that induction of robust Wnt signaling during intestinal infection is strongly correlated with mortality in susceptible mice. Conversely, stringent blockade of Wnt signaling through treatment of mice with a DKK1-expressing adenovirus markedly inhibited proliferation in the small intestine and colon, leading to progressive architectural degeneration, ulceration, and death28. This suggests that the balance between too much and not enough Wnt signaling is a fine one, a concept that may be reflected in the relatively modest degree of rescue observed when we treated infected susceptible mice with recombinant DKK-1.
Constitutive activation of Wnt signaling constitutes the primary transforming event in colorectal cancer29. Recent findings have highlighted a critical role for the R-spondins in colonic carcinogenesis18 but to our knowledge a role for R-spondins in susceptibility to enteric infections has never been described. Our findings also provide a potential hypothesis for how the response to specific commensal or pathogenic bacteria may participate in the development of colorectal cancer. Furthermore, our own analysis of the data from the 1st International Inflammatory Bowel Disease Genetics Consortium meta-analyses30,31 reveals strong associations of RSPO3 with both Crohn’s disease and ulcerative colitis (Supplementary Table S1–2), providing some evidence that R-spondins may have a broader role in linking infection or inflammation with intestinal homeostasis.
Mesenchymal-epithelial interactions orchestrate hedgehog (Hh), bone morphogenetic protein (Bmp), and Wnt signaling in the intestinal crypts and are critical for proper morphogenesis of intestinal architecture and for appropriate maintenance of the intestinal stem cell niche32. Mesenchymal cells of the intestinal lamina propria are also emerging as important players in immune function, and subepithelial myofibroblasts in particular are known to participate in innate33 and adaptive immunity in the gut34. Here we describe a new cross talk between the mesenchyme and the closely opposed epithelial compartment, critical for host tolerance against enteric pathogens, through R-Spondin 2 signaling. Our work illustrates a novel pathological pathway leading to fatal diarrhea and highlights a major role for intestinal mesenchyme in enteric infection outcome.
Lastly, while A/E pathogens still represent a clinical challenge with few therapeutic options, our work suggests that targeting the R-Spondin/Wnt signaling pathway could represent a new approach to treat A/E pathogen-induced diarrhea.
Methods
Mice
Breeding and experimental procedures were carried out in accordance with the Canadian Council on Animal Care and approved by our local ethical committee. C57BL/6J, C3H/HeOuJ, FVB/NJ and AKR/J mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). All animals were maintained in a specific pathogen-free facility at McGill University. The congenic mice were produced according to standard procedures for introgression of C57BL/6J c15 allele onto the C3H/HeOuJ genome (C3Ou.B6-Cri1) or introgression of C3H/HeOuJ allele into C57BL/6J genome (B6.C3Ou-Cri1). Briefly, F1 mice were backcrossed to the parental strain. The resulting N2 mice with the desired segment of chr15 were selected by genotyping and used for subsequent backcrossing to the parental strain. Males and females (backcross generation N9) that inherited the intact derived congenic segment were intercrossed. Then, the offspring were genotyped to identify homozygotes for the desired segment, which were then intercrossed to maintain the line. To produce congenic sub-lines, F1 hybrids, made by crossing the congenic line to the recipient strain, were backcrossed to the recipient strain. Littermates issued from these backcrosses, characterized by recombination events within the Cri1 locus, were selected by genotyping polymorphic SNP markers. The selected recombinant mice were then backcrossed again to the recipient strain. Males and female mice issued from this backcross (heterozygous for the reduced introgressed region) were intercrossed to fix the recombinant chromosome in the homozygous state. The Cri-1 homozygous offspring were selected for brother-sister mating and foundation of the new congenic sub-lines.
Genotyping
DNA was extracted from biopsies of mouse tails with overnight digestion in lysis buffer and proteinase K, followed by a chloroform extraction. The complete list of genetic markers used for genotyping of congenic lines is included in Supplementary Table 1. In-house PCRs done for mouse genotyping were sent to Genome Quebec (Montreal, QC, Canada) for sequencing. PCR was performed using standard touchdown PCR methods with primers obtained from the Mouse Genome Informatics website (www.informatics.jax.org).
In vivo C. rodentium infection
Five-week-old male or female mice were inoculated with C. rodentium strain DBS100. Bacteria were grown overnight in 3 ml Luria-Bertani (LB) medium shaking at 37°C. Mice were infected by oral gavage of 0.1 ml of LB medium containing 2–3×108 CFUs of C.rodentium. The infectious dose was verified by plating of serial dilutions. For survival analysis, animals were monitored daily and moribund animals were euthanized by CO2 when clinical endpoints were achieved13. Animals were euthanized on experimental days 3, 6, 9 or 13 and their colons isolated and processed for histological examination and immunostaining or snap-frozen for RNA/protein isolation. In some experiments, mice were daily iv. injected with human recombinant R-spondin 2 protein (250 μg.ml−1 in PBS, R&D systems) from d3 to d5 after infection. For treatment with recombinant DKK1, mice were injected with DKK1 (iv. 25μg/day from d3 to d10 post infection and ip. 50μg/day from d11 to day 20). Production of recombinant DKK1 is described in Supplementary Methods.
Bone marrow chimeras
For bone marrow (BM) chimera experiments, recipient mice were lethally irradiated (950 rad/9.5 Gy) 24h before reconstitution with BM from the indicated donor line. BM was aseptically harvested from tibia and femur of the respective donor strain, and 5–10 × 106 cells were injected into the tail vein of the irradiated recipients. Mice received antibiotics (Baytril) in the drinking water during the following 2 weeks after bone marrow transfer and were allowed to reconstitute for a total of 8 weeks before being infected with C. rodentium. Chimerism ≥90% was validated by genotyping cell-sorted CD45+ splenocyte and tail DNA of chimeric mice with the polymorphic marker D15MIT229.
Histopathology and immunofluorescence
Distal colon sections were fixed in 10% buffered formalin, paraffin embedded, sectioned at 5 μm, and subsequently stained with hematoxylin and eosin (H&E) or Alcian blue (AB) using current procedures and visualized with a Zeiss axioscope microscope. Proliferative responses in infected tissues were scored in a blinded fashion by an expert veterinary pathologist. The average depth of 30 well-oriented colonic crypts was measured for each mouse. ImageJ software (Rasband, WS, ImageJ, rsb.info.nih.gov/ij) was used to quantify differences in Alcian blue staining between samples. To standardize measurements, all images were taken immediately after staining using identical camera settings. Immunofluorescence was performed on paraffin sections. The slides were de-paraffinized with xylene twice for 5 minutes. The sections were rehydrated in ethanol 100% twice 5 minutes, followed by 90%, 70% ethanol and water, 5 minutes each. The slides were then incubated for 10 minutes in boiling 0.1 M citrate buffer (pH 6,0) for antigen retrieval. PBS 0.2 Tween 20 was used as wash buffer. After blocking in PBS 10% FCS 1% BSA for 1 hour at 37°C, tissues were incubated with primary antibodies against PCNA (Abcam, Cat #ab2426), β-catenin (BD, Cat# 610154), active β-catenin (Millipore, Cat# 05-665), CAR4 (R&D system, Cat# AF2414), at a dilution of 1:100 in PBS 1% BSA for 1 hour at 37°C. This step was followed by a 1 hour incubation with either Alexa-488 coupled goat anti rabbit, Alexa-488 coupled goat anti mouse, Alexa-488 coupled donkey anti goat respectively. Tissues were counterstained with 1:100 4′,6′-diamidino-2-phenylindole (DAPI) for DNA staining (Sigma) and mounted using ProLong Gold Antifade reagent (Invitrogen). Sections were viewed on a Zeiss AxioImager microscope and images were obtained using a Zeiss AxioCam HRn camera operating through AxioVision software.
Quantitative real-time PCR
Mice were euthanized at indicated time points by CO2 asphyxiation. The penultimate centimeter of colon was dissected and immediately snap frozen in liquid nitrogen. Samples were then stored at −80C until processed. RNA from all tissue samples was isolated using Trizol reagent (Invitrogen, Carlsbad, CA) according to manufacturer’s directions. Samples were DNase treated using TURBO Dnase (Ambion). cDNA was synthesized with SuperScript III Reverse Transcriptase (Invitrogen), using an Eppendorf PCR thermal cycler and random primers (Invitrogen). The purity of the samples was assessed spectrophotometrically; all samples had OD260/280 ratio between 1.8 and 2.0. Expression levels of the genes within Cri1 locus were assessed with TaqMan Gene Expression Assays (Applied Biosystems) on Applied Biosystems StepOne Plus Real-Time PCR system. For other genes, SYBR Green PCR reaction mix (10μl) was composed of 5 μl LightCycler 480 SYBR Green I master (Roche), 4.5 μl of diluted cDNA, and a final concentration of 1 μM of each primer. Sequences of primers are in Supplementary Table S1. Primers were designed with sequences spanning exon-exon junctions or with a separation of at least one intron on the corresponding genomic DNA. Correct efficiency of primers was controlled by PCR reactions performed on serial dilutions of cDNA. PCR reactions were done using a Light Cycler 480 system (Roche).
Immunoblotting
Colonic tissues samples were homogenized in B150 lysis buffer (20 mM Tris-HCl pH 8.0, 150 mM KCl, 10% glycerol, 5 mM MgCl2, and 0.1% NP40) supplemented with Complete-mini protease inhibitor (Roche). Equal protein aliquots were subjected to SDS-PAGE (10% acrylamide) under reducing condition and proteins were transferred to a 0.2 mm PVDF membrane (Bio-Rad). Blots were blocked with 5% skim milk overnight at 4°C, incubated with primary antibody against β-catenin (1:1000) (Cell Signaling, Cat# 9562), active β-catenin (Millipore, Cat# 05-665), CyclinD1 (Thermo Scientific, Cat# RM 9104) or β-actin (1:10.000) (Sigma, Cat# A 1978) for 1 hour at room temperature. Detections were done with appropriate horseradish peroxidase-conjugated secondary antibody and a chemiluminescent substrate (Millipore).
In Situ Hybridization
ISH was performed using 35SUTP-labeled riboprobes synthesized in vitro from the Rspo2 DNA template (NM_172815.3) with forward T7 primer: GCGCTATAATACGACTCACTATAGGGAGATAGCTCAGGCAGCGAGAAACTTCA and reverse SP6: GCATTAATTTAGGTGACACTATAGAAGCGGCTGCAACCATTGTCCTTCGAACA. RNA probes were synthesized in vitro from a DNA template of 950 nts, antisense and sense with SP6 and T7 RNA polymerase activities, respectively and radiolabeled with 35S-UTP (>1.000 Ci/mmol; Cat. #NEG039H, PerkinElmer LAS Canada, Inc.). 5 μm FFPE sections were treated with Proteinase K (0.1 mg/ml) for 10–15 minutes. 35S-labeled cRNA antisense and sense probes were used. Sections were hybridized overnight at 55°C in 50% deionized formamide, 0.3 M NaCl, 20 mM Tris- HCl, pH 7.4, 5 mM EDTA, 10 nM NaPO4, 10% dextran sulfate, 1 x Denhardt’s, subjected to stringent washing at 65°C in 50% formamide, 2× SSC, and 10 mM DTT, followed by washing in PBS before treatment with 20 μg/ml RNAse A at 37°C for 30 minutes. After washes in 2× SSC and 0.1× SSC for 10 minutes at 37°C, the slides were dehydrated, opposed to x-ray film for 5 days and then subjected to emulsion autoradiography. The autoradiography was revealed by treatment with D19 (Kodak) and sodium thiosulfate. We used frozen tissues cut into 6 μm sections for the combined ISH and immunocytochemistry (ICC). Tissues were divided into 2 groups: first group with ICC and second group without ICC. In addition to fixation in 4% formaldehyde, both groups were treated with triethanolamine/acetic anhydride, washed and dehydrated with ethanol series and then submitted to a classical procedure. For subsequent ICC, tissue was treated with 3% H2O2 in water for 10 minutes to remove non-specific background, again washed with PBS and then pre-treated using heat-mediated antigen retrieval with sodium citrate buffer (pH=6) for 20 minutes. Primary antibodies anti Gr-1 (Ebioscience, Cat #14-5931-81) and anti α-SMA (Abcam, Cat #ab5694) were diluted 1:100 in 1% BSA/PBS and incubated overnight at 4°C. Immunoreaction was revealed using anti-rabbit- (or anti-rat) biotinylated second antibody (1:250) followed by HRP (Vector). The staining appears brown under lightfield illumination. Tissue was then lightly stained with cresyl violet and mounted under cover slips.
Statistics
Statistic differences between pairs of survival curves of mice grouped by genotype were calculated using log-rank tests. Gene expression data were analyzed by the Mann-Whitney test. *, P< 0.05; **, P<0.01; ***, P<0.001
Supplementary Material
Acknowledgments
This work was supported by a CIHR Operating Grant awarded to SG (MOP-89817). ST and AT were supported by CIHR studentships. ED was supported by a Fellowship from CIHR/Canadian Association of Gastroenterology. SG is a Canada Research Chair. We thank Rusty Jones and Jorg Fritz (McGill University) for helpful discussions for the bone marrow chimera experiments.
Footnotes
Supplementary Information is available.
Author Contributions: OP, ST, LZ, ED, AT, KY, EK, SD, YD and MMM performed experiments. OP, ST, ED, MMM, DM, AMM and SG designed the experiments and analyzed the data. OP and SG wrote the paper. All authors discussed the results and commented on the manuscript.
Conflict of interest statement: The authors declare no conflict of interest.
References
- 1.Chen HD, Frankel G. Enteropathogenic Escherichia coli: unravelling pathogenesis. FEMS Microbiol Rev. 2005;29:83–98. doi: 10.1016/j.femsre.2004.07.002. [DOI] [PubMed] [Google Scholar]
- 2.Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142–201. doi: 10.1128/cmr.11.1.142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.McDaniel TK, Jarvis KG, Donnenberg MS, Kaper JB. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci U S A. 1995;92:1664–1668. doi: 10.1073/pnas.92.5.1664. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Wales AD, Woodward MJ, Pearson GR. Attaching-effacing bacteria in animals. J Comp Pathol. 2005;132:1–26. doi: 10.1016/j.jcpa.2004.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Fagundes-Neto U, Kallas MR, Patricio FR. Morphometric study of the small bowel mucosa in infants with diarrhea due to enteropathogenic Escherichia coli strains. Hepatogastroenterology. 1997;44:1051–1056. [PubMed] [Google Scholar]
- 6.Karch H. The role of virulence factors in enterohemorrhagic Escherichia coli (EHEC)--associated hemolytic-uremic syndrome. Semin Thromb Hemost. 2001;27:207–213. doi: 10.1055/s-2001-15250. [DOI] [PubMed] [Google Scholar]
- 7.Mundy R, MacDonald TT, Dougan G, Frankel G, Wiles S. Citrobacter rodentium of mice and man. Cell Microbiol. 2005;7:1697–1706. doi: 10.1111/j.1462-5822.2005.00625.x. [DOI] [PubMed] [Google Scholar]
- 8.Barthold SW, Osbaldiston GW, Jonas AM. Dietary, bacterial, and host genetic interactions in the pathogenesis of transmissible murine colonic hyperplasia. Lab Anim Sci. 1977;27:938–945. [PubMed] [Google Scholar]
- 9.Vallance BA, Deng W, Jacobson K, Finlay BB. Host susceptibility to the attaching and effacing bacterial pathogen Citrobacter rodentium. Infect Immun. 2003;71:3443–3453. doi: 10.1128/IAI.71.6.3443-3453.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Borenshtein D, Nambiar PR, Groff EB, Fox JG, Schauer DB. Development of fatal colitis in FVB mice infected with Citrobacter rodentium. Infect Immun. 2007;75:3271–3281. doi: 10.1128/IAI.01810-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Borenshtein D, et al. Diarrhea as a cause of mortality in a mouse model of infectious colitis. Genome Biol. 2008;9:R122. doi: 10.1186/gb-2008-9-8-r122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Borenshtein D, et al. Decreased expression of colonic Slc26a3 and carbonic anhydrase iv as a cause of fatal infectious diarrhea in mice. Infect Immun. 2009;77:3639–3650. doi: 10.1128/IAI.00225-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Diez E, et al. Identification and characterization of Cri1, a locus controlling mortality during Citrobacter rodentium infection in mice. Genes Immun. 2011;12:280–290. doi: 10.1038/gene.2010.76. [DOI] [PubMed] [Google Scholar]
- 14.Teatero SA, et al. The Cri1 locus is the common genetic cause of susceptibility to Citrobacter rodentium infection in C3H and FVB mouse strains. Gut Microbes. 2011;2:173–177. doi: 10.4161/gmic.2.3.16297. [DOI] [PubMed] [Google Scholar]
- 15.Kim KA, et al. R-Spondin proteins: a novel link to beta-catenin activation. Cell Cycle. 2006;5:23–26. doi: 10.4161/cc.5.1.2305. [DOI] [PubMed] [Google Scholar]
- 16.Kim KA, et al. Mitogenic influence of human R-spondin1 on the intestinal epithelium. Science. 2005;309:1256–1259. doi: 10.1126/science.1112521. [DOI] [PubMed] [Google Scholar]
- 17.de Lau W, et al. Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling. Nature. 2011;476:293–297. doi: 10.1038/nature10337. [DOI] [PubMed] [Google Scholar]
- 18.Seshagiri S, et al. Recurrent R-spondin fusions in colon cancer. Nature. 2012;488:660–664. doi: 10.1038/nature11282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.van de Wetering M, et al. The beta-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell. 2002;111:241–250. doi: 10.1016/s0092-8674(02)01014-0. [DOI] [PubMed] [Google Scholar]
- 20.van den Brink GR, et al. Indian Hedgehog is an antagonist of Wnt signaling in colonic epithelial cell differentiation. Nat Genet. 2004;36:277–282. doi: 10.1038/ng1304. [DOI] [PubMed] [Google Scholar]
- 21.Byeon MK, et al. The down-regulated in adenoma (DRA) gene encodes an intestine-specific membrane glycoprotein. Oncogene. 1996;12:387–396. [PubMed] [Google Scholar]
- 22.Schweinfest CW, Henderson KW, Suster S, Kondoh N, Papas TS. Identification of a colon mucosa gene that is down-regulated in colon adenomas and adenocarcinomas. Proc Natl Acad Sci U S A. 1993;90:4166–4170. doi: 10.1073/pnas.90.9.4166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kato A, Romero MF. Regulation of electroneutral NaCl absorption by the small intestine. Annu Rev Physiol. 2011;73:261–281. doi: 10.1146/annurev-physiol-012110-142244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hoglund P, et al. Mutations of the Down-regulated in adenoma (DRA) gene cause congenital chloride diarrhoea. Nat Genet. 1996;14:316–319. doi: 10.1038/ng1196-316. [DOI] [PubMed] [Google Scholar]
- 25.Schweinfest CW, et al. slc26a3 (dra)-deficient mice display chloride-losing diarrhea, enhanced colonic proliferation, and distinct up-regulation of ion transporters in the colon. J Biol Chem. 2006;281:37962–37971. doi: 10.1074/jbc.M607527200. [DOI] [PubMed] [Google Scholar]
- 26.Brandl K, Beutler B. Creating diseases to understand what prevents them: genetic analysis of inflammation in the gastrointestinal tract. Curr Opin Immunol. 2012;24:678–685. doi: 10.1016/j.coi.2012.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Gruenheid S, Gros P. Forward genetic dissection of innate response to infection in inbred mouse strains: selected success stories. Clin Exp Immunol. 2010;162:393–401. doi: 10.1111/j.1365-2249.2010.04249.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Kuhnert F, et al. Essential requirement for Wnt signaling in proliferation of adult small intestine and colon revealed by adenoviral expression of Dickkopf- 1. Proc Natl Acad Sci U S A. 2004;101:266–271. doi: 10.1073/pnas.2536800100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Barker N, et al. Crypt stem cells as the cells-of-origin of intestinal cancer. Nature. 2009;457:608–611. doi: 10.1038/nature07602. [DOI] [PubMed] [Google Scholar]
- 30.Anderson CA, et al. Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. Nat Genet. 2011;43:246–252. doi: 10.1038/ng.764. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Franke A, et al. Genome-wide meta-analysis increases to 71 the number of confirmed Crohn’s disease susceptibility loci. Nat Genet. 2010;42:1118–1125. doi: 10.1038/ng.717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Powell DW, Pinchuk IV, Saada JI, Chen X, Mifflin RC. Mesenchymal cells of the intestinal lamina propria. Annu Rev Physiol. 2011;73:213–237. doi: 10.1146/annurev.physiol.70.113006.100646. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Pang G, Couch L, Batey R, Clancy R, Cripps A. GM-CSF, IL-1 alpha, IL-1 beta, IL-6, IL-8, IL-10, ICAM-1 and VCAM-1 gene expression and cytokine production in human duodenal fibroblasts stimulated with lipopolysaccharide, IL-1 alpha and TNF-alpha. Clin Exp Immunol. 1994;96:437–443. doi: 10.1111/j.1365-2249.1994.tb06048.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Roberts AI, Nadler SC, Ebert EC. Mesenchymal cells stimulate human intestinal intraepithelial lymphocytes. Gastroenterology. 1997;113:144–150. doi: 10.1016/s0016-5085(97)70089-1. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.