Skip to main content
American Journal of Translational Research logoLink to American Journal of Translational Research
. 2016 Feb 15;8(2):1055–1063.

The mechanism of cytoskeleton protein β-actin and cofilin-1 of macrophages infected by Mycobacterium avium

Jianjun Wang 1, Yongliang Yao 1, Jianhong Wu 1, Zhiyong Deng 1, Tao Gu 1, Xin Tang 1, Yang Cheng 1, Guangxin Li 2
PMCID: PMC4846948  PMID: 27158391

Abstract

Cytoskeleton proteins and their regulation proteins could be influenced seriously in Mycobacterium tuberculosis infection host cells leading to the apoptosis of host cells. Macrophages infected by Mycobacterium avium were detected from cell morphology and genome levels to analyze changes of the cytoskeleton of M. avium infection macrophages. Then the expression of β-actin, cofilin-1 proteins in M. avium infected macrophages were analyzed by western blotting, and the apoptosis of M. avium infection macrophages were tested by flow cytometry. Results indicated that the morphology and genomic DNA of M. avium infection macrophages were not damaged significantly. Meanwhile, β-actin gene and its proteins in M. avium infection macrophages were both decreased, but its regulatory protein cofilin-1 was expressed conversely. Furthermore, macrophages could be induced to apoptosis due to M. avium infection by cytoskeleton changes. These findings contributed us to understand that macrophages infected by M. avium could be lead to apoptosis by regulating cytoskeleton protein β-actin or its regulatory protein cofilin-1.

Keywords: Macrophage, M. avium, β-actin, cofilin-1

Introduction

Mycobacterium tuberculosis (MTB) is a facultative intracellular pathogen which could cause tuberculosis, and tuberculosis has been the respiratory infectious disease which harm to human health seriously around the world [1]. Macrophages are the main immune cells that kill mycobacterium, and they also are able to present specific antigens of M. tb to T lymphocytes, in the immune system [2]. After Mycobacterium tuberculosis invade bodies, macrophages could produce all kinds of cytokines such as IL-2, IL-6, IL-10, IFN-γ and TNF-α to be used against mycobacterium [3-5]. Studies show that TNF-α and IFN-γ were the two most important cytokines to kill or inhibit M. tb, and to induce an inflammatory response [6-8]. Above all, the phagocytosis of macrophages is the most important function to kill Mycobacterium tuberculosis that Mycobacterium tuberculosis in macrophages could be hydrolyzed by intracellular lysosomal hydrolase leading to the loss of the proliferation activity [9,10]. However, if Mycobacterium tuberculosis could not be eliminated by the immune system of bodies, they will incubate to parasitize in macrophages, then they would induce the apoptosis of macrophages through a variety of mechanisms, when the immune function of macrophages is weak or untreated with drugs [11].

Actin proteins are the structural component of microfilament to constitute the cytoskeleton of cells, and the expression levels of actin proteins were related to the morphology of cells closely [12,13]. As actin is necessary for the scaffolding of endosomes during phagosome-endosome interactions, the correlation between the disruption of actin by M. tb and the delay in phagosomal maturation has been observed [14,15]. Previous studies have showed that if cells were induced to be apoptosis, actin filament will be broken and the network structure of actin proteins also will been destroyed, suggesting that actin proteins may be one of modulators during the early stage of apoptosis [16]. Cofilin-1 is a widely distributed intracellular actin-modulating protein that binds and depolymerizes filamentous actin and inhibits the polymerization of monomeric actin in a pH-dependent manner [17]. The skeleton of M. tb infection macrophages would be influenced by the invasion of M. tb leading to the death of macrophages and the propagation of M. tb.

This paper focuses on studies of cytoskeletal protein β-actin and its regulatory proteins cofilin-1 in M. tb infection macrophages to explore the mechanisms of cytoskeleton proteins of macrophages in the process of cells apoptosis induced by M. tb.

Materials and methods

M. avium growth

Mycobacterium avium sp. Paratuberculosis (M. avium.spp called M. avium in this paper) was obtained from the Center for Disease Control of Shanghai. Bacteria were grown on Middlebrooks 7H9 plates as previously described [18] for 4 weeks, at 37°C. They were harvested by scraping, with 0.9% NaCl as vehicle, and concentrations were calculated according to 0.5 McFarland Standards method, then were concentrated to 7.5×109/mL.

Macrophage cultures

The human acute monocytic leukemia cell line THP-1 was purchased from the Center for Type Culture Collection of Shanghai Academy of Sciences. Cells were cultured in wells or flasks at 37°C under 5% CO2, in RPMI 1640-GlutaMAX™ containing 10% (v/v) fetal bovine serum (Hyclone company, USA), 100 U/mL penicillin, 0.1 mg/mL streptomycin and 0.25 μg/mL amphotericin B. Differentiation of these cells into macrophage-like cells was induced with 0.1 mM Phorbol 12-myristate 13-acetate (PMA) (Sigma, USA) for 12 h. Then were divided into control group and experimental group randomly, control group, stimulated with blank medium, and experimental groups infected with M. avium (M. avium: macrophages = 10:1) for 48 h.

Exosomes isolation

Macrophages cell culture supernatants were centrifuged at 3,000 g for 15 minutes to remove cells and cell debris, then supernatants were transferred to sterile tubes. The ExoQuick Exosome Precipitation Solution (System Biosciences (SBI), Mountain View, CA, USA) was added to cell culture supernatants, the tubes mixed by inverting, then refrigerated for 30 minutes. ExoQuick/biofluid mixture was centrifuged at 1,500 g for 30 minutes, then the supernatant aspirated. Spin down residual ExoQuick solution was added and centrifuged at 1,500 g for 5 minutes and all traces of fluid removed by aspiration. Finally, exosome pellets were resuspended in 1/10 of the original volume using nuclease-free water. The exosomes pellets were mixed with 25 μl of 9% sucrose containing protease inhibitors and stored at -80°C until use. All procedures were carried out at 4°C.

Exosomes identification by transmission electron microscopy (TEM)

Exosomes pellets were resuspended and fixed in phosphate buffer containing 2% glutaraldehyde and then loaded on Formar/carbon-coated electron microscopy grids. The samples were contrasted in uranyl acetate and viewed with Hitachi H-600 TEM microscope at 70,000 magnification.

Reverse transcription PCR (RT-PCR)

The primers designed according to the cDNA sequences of β-actin and GAPDH obtained from the NCBI database. were used: GAPDH, F 5’ GGATTTGGTCGTATTGGGCG 3’ and R 5’ CCTGGAAGATGGTGATGGGATT 3’; β-actin, F 5’ TGACGGTCAGGTCATCACTATCGGCAATGA 3’ and R 5’ TTGATCTTCATGGTGATAGGAGCGAGGGCA 3’. All primers were synthetized by Invitrogen (New York, US).

RT-PCR assays were performed using the Eppendorf PCR system (Eppendorf, Germany). Total RNA was isolated from macrophages using TRIzol reagent and quantified spectrophotometrically. The cDNA was synthesized using M-MLV reverse transcriptase (Superscript-Invitrogen, Carlsbad, CA, USA). A reaction mixture containing 5 μL RNA (200 ng/μL), 12 μL 5×M-MLV RT Buffer, 6 μL 2.5 mM dNTP mixs, 1 μL RNase inhibitor (30 U/μL), 4 μL M-MLV Reverse Transcriptase (5 U/μL), 3 μL Oligo dT(18) primer (500 ng/μL) and 14 μL DEPC water was incubated at 37°C for 1 h. For RT-PCR, 2.0 μL cDNA, 0.5 μL forward primer and 0.5 μL reverse primer, 2 μL 2.5 mM dNTP mixs, 0.5 μL DNA polymerase (10 U/μL), 4 μL 5×Buffer and 10.5 μL ddH2O were added into the system and amplified for 30 cycles under the following cycling conditions, 94°C denaturation 2 min, 28× (94°C for 20 s; 55°C, 30 s; 72°C for 20 s) extension at 72°C for 5 min.

Western blotting

For western blotting, equal concentration of protein from M. avium infection macrophages cell lysates or M. avium non-infection macrophages, as quantitated by the Micro BCA Protein Assay, were loaded on 10% SDS-PAGE gels, electrophoresed, and transferred onto polyvinylidene difluoride membrane (Milipore, Bedford, MA). The membranes were probed for β-actin or cofilin-1 (1:500 dilution) (Yi Sen Biotechnology Company, Shanghai China). Immune-detected protein bands were quantified with Image J and statistically analyzed by ANOVA software.

Flow cytometry analysis

Macrophages cultured in six well plates were infected with M. avium for 48 h, then harvested and washed twice with PBS containing 0.2% BSA. Macrophages were then incubated with Annexin-V-FITC antibodies or PI dye liquor (Yi Sen Biotechnology Company, Shanghai China) for 30 min in dark, on ice. After macrophages washed with PBS twice, cells were pelleted and resuspended to 1×106 cells/mL with PBS-0.2% BSA. Cell sorting and analysis were performed on a FACS (Beckman MOFLO XDP, USA).

DNA fragmentation analysis by hoechst 33258 staining

Macrophages cells were treated with control blank and M. avium for 48 h , centrifuged at 1000 rpm for 10 min and washed with PBS. The cells were then stained with Hoechst 33258 (50 μg/mL) (Yi Sen Biotechnology Company, Shanghai China) and incubated at 37°C for 30 min in dark. Then cells were washed and resuspended with PBS and examined under fluorescence microscope (magnification, ×400) (Nikon, Tokyo, Japan) and analyzed by DP2-BSW software. The apoptotic cells showed shrinkage and condensation of chromatin.

Statistical analysis

Triplicates were performed in each experiment for each condition or group. Data were analyzed by SPSS 16.0 and are presented as means ± SEM of at least 3 independent experiments. Differences within each group were subjected to t-test or q-test. Statistically significant differences (*P≤0.05) between the groups being compared are indicated by asterisks.

Results

Macrophage infected with M. avium

THP-1 cells were cultured for 48 h, then induced into macrophages with 0.1 mM PMA. Macrophages were treated with PBS or M. avium for 48 h, then the morphology of macrophages was observed by microscope (Figure 1A). At the same time, the genomic DNA of macrophages was extracted by the genomic DNA Extraction Kit (TianGen Company, Beijing) to detect DNA fragments (Figure 1B). Results of experiments indicated that the morphology of macrophages was influenced by M. avium, but the genomic DNA of M. avium infection macrophages was still undegraded.

Figure 1.

Figure 1

Analysis of the morphology (×40) and the genomic DNA of M. avium infection macrophages. A: a: THP-1 cells; b: THP-1 cells differentiated into macrophages with PMA were treated with PBS; c: THP-1 cells differentiated into macrophages were infected with M. avium. B: 1: Hind-III Marker; 2: The gDNA of THP-1 cells; 3: The gDNA of macrophages treated with PBS; 4: The gDNA of M. avium infection macrophages.

Exosomes characterization by transmission electron microscopy

Transmission electron microscopy observation of phosphotungstic-stained, purified exosomes obtained from macrophages infected with M. avium revealed an homogenous population of morphologically typical vesicles of 30 to 100 nm diameter (Figure 2), similar in appearance and size to those in published reports [19,20]. This indicated that the vesicles purified were actually exosomes and not apoptotic bodies or others.

Figure 2.

Figure 2

Exosomes secreted from M. avium infection macrophages were observed by TEM (×100 000), shown by arrows. Bar: 100 nm.

The expression of β-actin and cofilin-1 genes

After macrophages infected with M. avium for 48 h, the β-actin and cofilin-1 mRNAs of M. avium infection macrophages were detected by RT-PCR to analyze the effect of M. avium infection to β-actin and cofilin-1 genes in macrophages (Figure 3). Results showed that the β-actin mRNA level of M. avium infection macrophages was down regulated significantly (*P<0.05), but the expression of cofilin-1 show an opposite results compared with control groups (*P<0.05).

Figure 3.

Figure 3

The expression of β-actin and cofilin-1 mRNAs in M. avium infection macrophages analyzed by RT-PCR methods. A: Results of β-actin and cofilin-1 mRNA analyzed by RT-PCR; B: Results of the quantitative analysis about the expression of β-actin and cofilin-1 mRNAs analyzed by SPSS 16.0 stastical software, GAPDH as a standard calibration (n = 3, compared with the control groups, * P<0.05).

Western blotting analysis

Proteins of β-actin and cofilin-1 in M. avium infection macrophages or β-actin and cofilin-1 proteins in exosomes secreted from M. avium non-infection or infetion macrophages, were analyzed by western blotting (Figure 4). Above data manifested that β-actin proteins in M. avium infection macrophages or in exosomes secreted from M. avium infection macrophages were decreased remarkably (*P<0.05), but the cofilin-1 proteins which is the regulatory protein of β-actin was increased observably (*P<0.05).

Figure 4.

Figure 4

Analysis of β-actin and cofilin-1 proteins by western blotting. A: Western blotting results of β-actin in M. avium infection macrophages (c) or in exosomes secreted from M. avium infection macrophages (e), and cofilin-1 in M. avium infection macrophages. B: Results of stastical analysis, GAPDH as quantitative correction (mean ± SEM, 3 independent experiments). Statistical analysis by SPSS 16.0, with asterisks indicating the pairs of values compared for which significant differences were observed (*P≤0.05).

Apoptosis analysis of macrophages infected with M. avium

Macrophages were infected with M. avium for 48 h, then were stained with Hoechst 33258 to be used for DNA fragmentation analysis. The examination showed that M. avium significantly increased the percentage of cleaved nuclei to 33% compared to 4% in control group (Figure 5). Thus, M. avium significantly induces the apoptosis of macrophages cells (*P<0.05).

Figure 5.

Figure 5

Influence of M. avium on the apoptosis of macrophages cells. A: a: Macrophages cells were treated with control medium. b: Macrophages cells were infected with M. avium. Nuclear morphological changes were observed by Hoechst 33258 staining and fluorescence microscope. Arrows indicated the condensed and fragmented nuclei. Histograms showed number of cleaved nuclei (apoptotic cells) counted microscopically from 100 nuclei. B: Results of apoptosis macrophages infected with M. avium were analyzed by SPSS 16.0, (mean ± SEM, 3 independent experiments), with brackets indicating the pairs of values compared for which significant differences were observed (*P≤0.05).

Flow cytometry

Macrophages were collected to be incubated with FITC-labeled Annexin-V antibodies, and PI dye liquor, after macrophages infected with M. avium for 48 h. Then macrophages were detected by Flow cytometry to analyze the apoptosis of M. avium infection macrophages (Figure 6). Testing results show that apoptosis cells of macrophages increased obviously after cells infected with M. avium (*P<0.05).

Figure 6.

Figure 6

Analysis of apoptosis macrophages infected with M. avium by flow cytometry. A: Results of M. avium infection macrophages detected by Flow cytometry; B: Results of apoptosis macrophages analyzed by SPSS 16.0 statistical software. (mean ± SEM, 3 independent experiments), with brackets indicating the pairs of values compared for which significant differences were observed (*P≤0.05).

Discussion

Macrophage is one kind of the main immune cells to kill the invaded Mycobacterium tuberculosis in bodies, as well, macrophages are major places that M. tb incubated [21]. Once M. tb infected macrophages, their thick lipid would prevent lysosomal enzymes killing themselves, and propagate in macrophages massively. After that the cytoskeleton of macrophages would be damaged by M. tb severely to lead to apoptosis or necrosis, then, M. tb also would be released from maceophages to invade surrounding macrophages leading to the infection of M. tb further [22]. In this study, the morphology of M. avium infection macrophages unchanged significantly, and the genomic DNA in M. avium infection macrophages undegraded either. Actin proteins are essential component of the cytoskeleton, with critical roles in a wide range of cellular processes, including cell migration, cell division, and the regulation of gene expression. These functions are attributed to the ability of actins to form filaments that can rapidly assemble and disassemble according to the needs of the cell. β-actin is one of six isoforms expressed in cytoplasm ubiquitously, and regulate cell migration, gene expression and controls cell growth [23]. M. avium destroyed the cytoskeletal structure and inhibited the metabolism of macrophages leading to lossing a variety of cytoskeletal proteins and affecting the killing functions of macrophages [24]. In M. tb infection macrophages, cells themselves are also trying to regulate cytoskeletal associated proteins to maintain the stability of the cytoskeleton by a series of regulation proteins [25]. Exosomes secreted from M. avium infection macrophages were analyzed by two-dimensional electrophoresis and mass spectrometry, and two actin isoforms were down-regulated and cofilin-1 was up-regulated among the cytoskeletal proteins of M. avium infection macrophages [26]. Nevertheless, reports have showed that M. tuberculosis and M. marinum, but not M. avium, are ejected from the cell through an actin-based structure, the ejectosome. This conserved nonlytic spreading mechanism requires a cytoskeleton regulator from the host and an intact mycobacterial ESX-1 secretion system [27]. Different lipids were found to stimulate or inhibit actin assembly by LBPs and mycobacterial phagosomes in vitro. In addition, selected lipids activated actin assembly and phagosome maturation in infected macrophages, resulting in a significant killing of M. tuberculosis and M. avium [28]. In this study, we found that β-actin genes decreased in M. avium infection macrophages, and its proteins in M. avium infection macrophages or in exosomes secreted from M. avium infection macrophages were also decreased.

Cofilin-1 has actin depolymerizing and severing activity [29]. Since cofilin is essential for cytokinesis, endocytosis and other cellular processes that require actin filament turnover [30,31], it can be speculated that the transfer of cofilin-1 from infected to non-infected cells via exosomes could result in an enhanced capacity of the recipient cells for actin filament turnover. Cofilin-1 in exosomes secreted from M. avium infected macrophages was increased significantly, but actin protein expressed on the contrary, suggesting that the cytoskeletal proteins of macrophages were dilapidated and the synthesis or processing of actin fiber were blocked by M. avium [32]. The results suggest that in the process of infection, M. tuberculosis evades the bactericidal mechanisms possibly by secretion of certain proteins or factors which affect the host-cell actin [33]. In the present study, cofilin-1 protein increased significantly in M. avium infection macrophages. At the same time, our studies also showed that M. avium could inhibit the expression of β-actin cytoskeletal proteins to promote the expression of regulatory proteins cofilin-1 to disrupt the cytoskeleton of macrophages leading to the apoptosis of host cells.

However, the specific mechanism of β-actin and cofilin-1 proteins in M. avium infection macrophages, and the roles of them on the invasion of M. avium are still needed to be studied further.

Acknowledgements

This work was supported by Science and Technology Project of Jiangsu Province in China (NO: KS1425) and by Medical science and technology development fund of Jiangsu University in China (JLY20140047).

Disclosure of conflict of interest

None.

References

  • 1.Ottenhoff TH, Doherty TM, van Dissel JT, Bang P, Lingnau K, Kromann I, Andersen P. First in humans: a new molecularly defined vaccine shows excellent safety and strong induction of long-lived Mycobacterium tuberculosis-specific Th1-cell like responses. Hum Vaccin. 2010;6:1007–1015. doi: 10.4161/hv.6.12.13143. [DOI] [PubMed] [Google Scholar]
  • 2.Da Silva CA, Hartl D, Liu W, Lee CG, Elias JA. TLR-2 and IL-17A in chitin-induced macrophage activation and acute inflammation. J Immunol. 2008;181:4279–4286. doi: 10.4049/jimmunol.181.6.4279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Benoit M, Desnues B, Mege JL. Macrophage polarization in bacterial infections. J Immunol. 2008;181:3733–37399. doi: 10.4049/jimmunol.181.6.3733. [DOI] [PubMed] [Google Scholar]
  • 4.Flannagan RS, Cosio G, Grinstein S. Antimicrobial mechanisms of phagocytes and bacterial evasion strategies. Nat Rev Microbiol. 2009;7:355–366. doi: 10.1038/nrmicro2128. [DOI] [PubMed] [Google Scholar]
  • 5.Gordon S. Alternative activation of macrophages. Nat Rev Immunol. 2003;3:23–35. doi: 10.1038/nri978. [DOI] [PubMed] [Google Scholar]
  • 6.Sugimura K, Ohno T, Kimura Y, Kimura T, Azuma I. Arginine deiminase gene of an AIDS-associated mycoplasma, Mycoplasma incognitus. Microbiol Immunol. 1992;36:667–670. doi: 10.1111/j.1348-0421.1992.tb02069.x. [DOI] [PubMed] [Google Scholar]
  • 7.Boer MC, Prins C, van Meijgaarden KE, van Dissel JT, Ottenhoff TH, Joosten SA. Mycobacterium bovis BCG Vaccination Induces Divergent Proinflammatory or Regulatory T Cell Responses in Adults. Clin Vaccine Immunol. 2015;22:778–788. doi: 10.1128/CVI.00162-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zurita-Salinas CS, Palacios-Boix A, Yanez A, Gonzalez F, Alcocer-Varela J. Contamination with Mycoplasma spp. induces interleukin-13 expression by human skin fibroblasts in culture. FEMS Immunol Med Microbiol. 1996;15:123–128. doi: 10.1111/j.1574-695X.1996.tb00062.x. [DOI] [PubMed] [Google Scholar]
  • 9.Cao Z, Yao Q, Zhang S. MiR-146a activates WAVE2 expression and enhances phagocytosis in lipopolysaccharide-stimulated RAW264.7 macrophages. Am J Transl Res. 2015;7:1467–1474. [PMC free article] [PubMed] [Google Scholar]
  • 10.Seto S, Matsumoto S, Tsujimura K, Koide Y. Differential recruitment of CD63 and Rab7-interacting-lysosomal-protein to phagosomes containing Mycobacterium tuberculosis in macrophages. Microbiol Immunol. 2010;54:170–174. doi: 10.1111/j.1348-0421.2010.00199.x. [DOI] [PubMed] [Google Scholar]
  • 11.Dao DN, Kremer L, Guérardel Y, Molano A, Jacobs WR Jr, Porcelli SA, Briken V. Mycobacterium tuberculosis lipomannan induces apoptosis and interleukin-12 production in macrophages. Infect lmmun. 2004;72:2067–2074. doi: 10.1128/IAI.72.4.2067-2074.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lemieux MG, Janzen D, Hwang R, Roldan J, Jarchum I, Knecht DA. Visualization of the actin cytoskeleton: Different F-actin-binding probes tell different stories. Cytoskeleton (Hoboken) 2013;17:157–169. doi: 10.1002/cm.21160. [DOI] [PubMed] [Google Scholar]
  • 13.Hestvik AL, Hmama Z, Av-Gay Y. Mycobacterial manipulation of the host cell. FEMS Microbiol Rev. 2005;29:1041–1050. doi: 10.1016/j.femsre.2005.04.013. [DOI] [PubMed] [Google Scholar]
  • 14.Guerin I, Chastellier C. Pathogenic mycobacteria disrupt the macrophage actin filament network. Infect Immun. 2000;68:2655–2662. doi: 10.1128/iai.68.5.2655-2662.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Guerin I, de Chastellier C. Disruption of the actin filament network affects delivery of endocytic contents marker to phagosomes with early endosome characteristics: the case of phagosomes with pathogenic mycobacteria. Eur J Cell Biol. 2000;79:735–749. doi: 10.1078/0171-9335-00092. [DOI] [PubMed] [Google Scholar]
  • 16.Franklin-Tong VE, Gourlay CW. A role for actin in regulating apoptosis/programmed cell death: evidence spanning yeast, plants and animals. Biochem J. 2008;413:389–404. doi: 10.1042/BJ20080320. [DOI] [PubMed] [Google Scholar]
  • 17.Hotulainen P, Paunola E, Vartiainen MK, Lappalainen P. Actin-depolymerizing factor and cofilin-1 play overlapping roles in promoting rapid F-actin depolymerization in mammalian nonmuscle cells. Mol Biol Cell. 2005;16:649–664. doi: 10.1091/mbc.E04-07-0555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Giri PK, Schorey JS. Exosomes derived from M. Bovis BCG infected macrophages activate antigen-specific CD4+ and CD8+ T cells in vitro and in vivo . PLoS One. 2008;6:e2461. doi: 10.1371/journal.pone.0002461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Delcayre AL, Pecq JB. Exosomes as novel therapeutic nanodevices. Curr Opin Mol Ther. 2006;8:31–38. [PubMed] [Google Scholar]
  • 20.Vlassov AV, Magdaleno S, Setterquist R, Conrad R. Exosomes: Current knowledge of their composition, biological functions, and diagnostic and therapeutic potentials. Biochim Biophys Acta. 2012;1820:940–948. doi: 10.1016/j.bbagen.2012.03.017. [DOI] [PubMed] [Google Scholar]
  • 21.Siegel RM. Caspases at the crossroads of immune-cell life and death. Nat Rev Immunol. 2006;6:308–317. doi: 10.1038/nri1809. [DOI] [PubMed] [Google Scholar]
  • 22.Bermudez LE, Parker A, Goodman JR. Growth within macrophages increases the efficiency of Mycobacterium avium in invading other macrophages by a complement receptor independent pathway. Infect Immun. 1997;65:1916–1925. doi: 10.1128/iai.65.5.1916-1925.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bunnell TM, Burbach BJ, Shimizu Y, Ervasti JM. β-Actin specifically controls cell growth, migration, and the G-actin pool. Mol Biol Cell. 2011;22:4047–4058. doi: 10.1091/mbc.E11-06-0582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Erik CH, Eric JR. Bacterial Growth and Cell Division: a Mycobacterial Perspective. Microbiol Mol Biol Rev. 2008;72:126–156. doi: 10.1128/MMBR.00028-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang J, Wang Z, Yao Y, Wu J, Tang X, Gu T, Li G. The fibroblast growth factor-2 arrests Mycobacterium avium sp. paratuberculosis growth and immunomodulates host response in macrophages. Tuberculosis (Edinb) 2015;95:505–514. doi: 10.1016/j.tube.2015.04.006. [DOI] [PubMed] [Google Scholar]
  • 26.Wang JJ, Chen C, Xie PF, Pan Y, Tan YH, Tang LJ. Proteomic analysis and immune properties of exosomes released by macrophages infected with Mycobacterium avium . Microbes Infect. 2014;16:283–291. doi: 10.1016/j.micinf.2013.12.001. [DOI] [PubMed] [Google Scholar]
  • 27.Hagedorn M, Rohde KH, Russell DG, Soldati T. Infection by tubercular mycobacteria is spread by nonlytic ejection from their amoeba hosts. Science. 2009;323:1729–1733. doi: 10.1126/science.1169381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Anes E, Kühnel MP, Bos E, Moniz-Pereira J, Habermann A, Griffiths G. Selected lipids activate phagosome actin assembly and maturation resulting in killing of pathogenic mycobacteria. Nat Cell Biol. 2003;5:793–802. doi: 10.1038/ncb1036. [DOI] [PubMed] [Google Scholar]
  • 29.Paavilainen VO, Bertling E, Falck S, Lappalainen P. Regulation of cytoskeletal dynamics by actin-monomer-binding proteins. Trends Cell Biol. 2004;14:386–394. doi: 10.1016/j.tcb.2004.05.002. [DOI] [PubMed] [Google Scholar]
  • 30.Wang J, Yao Y, Xiong J, Wu J, Tang X, Li G. Evaluation of the inflammatory response in macrophages stimulated with exosomes secreted by Mycobacterium avium-infected macrophages. Biomed Res Int. 2015:658421. doi: 10.1155/2015/658421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Theriot JA. Accelerating on a treadmill: ADF/cofilin promotes rapid actin filament turnover in the dynamic cytoskeleton. J Cell Biol. 1997;136:1165–1168. doi: 10.1083/jcb.136.6.1165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wang J, Chen C, Xie P, Pan Y, Tan Y, Tang L. Changes of cytokines and protein expression of macrophages stimulated with exosome from macrophages by Mycobacterium avium infection. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2013;29:123–126. [PubMed] [Google Scholar]
  • 33.Xu YZ, Bai HT, Hu ZY, Chen JP, Chunyu LJ, Wei Y, Wang HH. Rearrangement and altered expression of actin in macrophages induced by Mycobacterium tuberculosis . Zhonghua Jie He He Hu Xi Za Zhi. 2003;26:30–33. [PubMed] [Google Scholar]

Articles from American Journal of Translational Research are provided here courtesy of e-Century Publishing Corporation

RESOURCES