Skip to main content
NCBI home page
Cold Spring Harbor Molecular Case Studies logoLink to Cold Spring Harbor Molecular Case Studies
. 2016 Jan;2(1):a000448. doi: 10.1101/mcs.a000448

Long-term changes of bacterial and viral compositions in the intestine of a recovered Clostridium difficile patient after fecal microbiota transplantation

Felix Broecker 1,2,6,7, Jochen Klumpp 3,7, Markus Schuppler 3, Giancarlo Russo 4, Luc Biedermann 5, Michael Hombach 1, Gerhard Rogler 5, Karin Moelling 1,2
PMCID: PMC4849847  PMID: 27148577

Abstract

Fecal microbiota transplantation (FMT) is an effective treatment for recurrent Clostridium difficile infections (RCDIs). However, long-term effects on the patients’ gut microbiota and the role of viruses remain to be elucidated. Here, we characterized bacterial and viral microbiota in the feces of a cured RCDI patient at various time points until 4.5 yr post-FMT compared with the stool donor. Feces were subjected to DNA sequencing to characterize bacteria and double-stranded DNA (dsDNA) viruses including phages. The patient's microbial communities varied over time and showed little overall similarity to the donor until 7 mo post-FMT, indicating ongoing gut microbiota adaption in this time period. After 4.5 yr, the patient's bacteria attained donor-like compositions at phylum, class, and order levels with similar bacterial diversity. Differences in the bacterial communities between donor and patient after 4.5 yr were seen at lower taxonomic levels. C. difficile remained undetectable throughout the entire timespan. This demonstrated sustainable donor feces engraftment and verified long-term therapeutic success of FMT on the molecular level. Full engraftment apparently required longer than previously acknowledged, suggesting the implementation of year-long patient follow-up periods into clinical practice. The identified dsDNA viruses were mainly Caudovirales phages. Unexpectedly, sequences related to giant algae–infecting Chlorella viruses were also detected. Our findings indicate that intestinal viruses may be implicated in the establishment of gut microbiota. Therefore, virome analyses should be included in gut microbiota studies to determine the roles of phages and other viruses—such as Chlorella viruses—in human health and disease, particularly during RCDI.

Keywords: recurrent infection of the gastrointestinal tract

INTRODUCTION

Clostridium difficile is the leading cause of hospital-acquired infectious diarrhea (Lo Vecchio and Zacur 2012). This bacterium capitalizes on antibiotic disruption of the normal microbiota to colonize the intestine, causing disease mainly by secreted toxins (Lo Vecchio and Zacur 2012). Recent years have seen an increase in lethal C. difficile infections and the emergence of strains with increased toxin production and antibiotic resistance (McDonald et al. 2005; Warny et al. 2005; Razavi et al. 2007; Lessa et al. 2012).

The failure of antibiotics to fully eliminate C. difficile leads to recurrent disease episodes in ∼30% of patients (Johnson 2009). This fueled the investigation of fecal microbiota transplantation (FMT) as an alternative treatment option, whereby patients are instilled with healthy donor feces to replenish intestinal microbiota that prevent the growth of C. difficile. FMT has shown impressive success rates of ∼90% against RCDIs and no severe adverse effects (Gough et al. 2011; Cammarota et al. 2014; O'Horo et al. 2014). A recent controlled clinical trial demonstrated the superiority of FMT to antibiotics for RCDI treatment (van Nood et al. 2013). FMT led to increased donor-like intestinal bacterial diversities within 2 wk (van Nood et al. 2013). Knowledge about the long-term effects of FMT, however, is presently not available. In addition, previous studies mainly focused on bacteria. Because viruses, especially phages, are the most abundant intestinal entities with the ability to influence microbial communities (Barr et al. 2013; Virgin 2014), they may well be relevant to C. difficile infection and the microbial changes following FMT. This is also suggested by recent findings that phages play a causative role in inflammatory bowel disease (IBD), which, similar to RCDI, is characterized by pathologically altered gut microbiota (Norman et al. 2015).

We recently reported on a recovered RCDI patient whose fecal bacteria were of chimeric composition of the patient and the healthy sister donor up to 7 mo post-FMT (Broecker et al. 2013), suggesting that stable attainment of intestinal microbial communities may take longer time periods. Here, we followed up this patient until 4.5 yr post-FMT, characterized fecal bacterial communities by 16S rRNA gene sequencing at various time points, and further analyzed previously reported viromes (Broecker et al. 2013) in comparison to the donor.

RESULTS

Patient History

Details on the patient history have been published (Broecker et al. 2013). Briefly, the female patient was 51 years old when admitted to the University Hospital of Zurich with her sixth episode of RCDI, suffering from severe diarrhea and weight loss. Stool samples tested positive for C. difficile by standard toxin A and B immunoassays, selective agar cultures, and agglutination assays. The first episode of C. difficile infection occurred 2 yr before hospital admission after 7 mo of multiple antibiotic treatment against a complicated jawbone infection.

Multiple rounds of treatments against RCDI with the recommended antibiotics metronidazole and vancomycin, partly in conjunction with the probiotic Saccharomyces cerevisiae, were only temporally successful but lead to recurrence after cessation. A therapeutic trial with intravenous immunoglobulins did not induce significant clinical responses. Finally, FMT was performed with donor feces from the patient's sister that tested negative for a variety of bacterial and viral pathogens. A suspension of donor feces in sterile 0.9% sodium chloride solution was applied intra-anally to the patient. Before the treatment, the patient was given vancomycin to suppress growth of pathogenic C. difficile as well as loperamide to prevent diarrhea. Following FMT, the patient reported changes in bowel movements and intermittent obstipation, both of which ceased within 10 wk. Ever since, the patient has remained free of symptoms for almost 5 yr now.

Bacterial Communities of the Patient Were Highly Variable up to 7 mo Post-FMT and Similar to the Donor after 4.5 yr at the Phylum Level

A total of six fecal samples of the patient after FMT and the stool donor were collected at various time points and subjected to 16S rRNA gene sequencing (Fig. 1A). The specimens included two long-term samples of the donor and the patient (D4 and P4, respectively), both collected 4.5 yr post-FMT. Four additional samples, one donor sample at the time of FMT (D0) and three patient samples 6–7 mo after the treatment (P1–P3), have been previously analyzed by metagenomic sequencing (Broecker et al. 2013). In the present study, targeted 16S rRNA gene sequencing was also applied to the latter samples to make them comparable to samples D4 and P4. A summary of the sequencing yields and accuracies is provided in Table 1.

Figure 1.

Figure 1.

Open in a new tab

Analysis of fecal microbiota. (A) Sample description. Fecal samples of the donor and the patient were collected at the indicated time points and subjected to metagenomic and/or 16S rRNA gene sequencing. FMT, fecal microbiota therapy. (B) Bacterial compositions at the phylum level are shown as pie charts. The inlay graph shows bacterial diversities inferred by Shannon indices as bars. (C) Bacterial compositions at the class, order, and family levels (from top to bottom) are shown as stacked bar graphs. Only taxa supported by at least 1% of total reads at each level are shown. (D) Relative abundances of the five most dominant bacterial genera in samples D0, D4, and P4 are shown as bar graphs. Dialister and Faecalibacterium genera were solely represented by the indicated species in each sample. The respective family names are given in parentheses. (E) Viral compositions of Caudovirales families are shown as pie charts.

Table 1.

Summary of 16S rRNA gene-sequencing data

Sample Date of sampling Polymerase reads Polymerase read bases Polymerase read mean length Polymerase read quality (%) Subreads Subread mean length Subread N50 Reads of Insert Reads of Insert mean quality (%) Mean number of passes Reads of Insert mean length
D0 Apr 2010 61,513 1,060,087,040 17,233 84.2 742,956 1385 1391 33,448 99.1 17.1 1382
D4 Oct 2014 54,085 824,162,488 15,238 84.2 567,136 1411 1410 28,777 99.1 15.4 1383
P1 Nov 1, 2010 70,286 1,241,608,906 17,665 82.9 842,749 1432 1384 32,708 98.8 16.3 1374
P2 Nov 12, 2010 75,817 1,253,948,163 16,539 83.7 866,330 1405 1404 40,813 99.1 15.6 1373
P3 Nov 25, 2010 95,559 1,693,054,916 17,717 83.6 1,108,225 1485 1414 45,181 99.1 15.6 1373
P4 Oct 2014 70,821 1,211,747,960 17,110 83.3 835,552 1408 1400 38,562 99.1 16.2 1374
Open in a new tab

Taxonomic analysis of the donor samples at the time of FMT (D0) and 4.5 yr later (D4) revealed bacterial communities dominated by the Bacteroidetes phylum (D0: 65% and D4: 83%), followed by Firmicutes (34% and 15%) (Fig. 1B). Remaining bacteria accounted for <2% in these two samples. In contrast, the patient samples P1–P3 collected 6–7 mo post-FMT were mainly composed of up to 85% (P1) of phylum Firmicutes. In this timespan, bacterial communities underwent extensive fluctuations. For instance, Bacteroidetes comprised 2% (P1), then 35% (P2), and finally 8% (P3) of all bacteria. The phylum Chlamydiae, barely detectable in the donor, constituted up to 12% (P3) of the patient's bacteria. In contrast to P1–P3, the patient sample 4.5 yr post-FMT (P4) mainly contained Bacteroidetes (77%) followed by Firmicutes (21%) and <2% remaining bacteria.

Bacterial diversities were estimated by calculating the Shannon diversity indices for all samples at the species level. The Shannon indices showed a high degree of variability even in the healthy donor, where an about twofold increase from the time point of FMT (D0) to 4.5 yr afterward (D4) was observed (Fig. 1B). In the patient samples, a trend toward increasing diversity from the time period covered by samples P1–P3 to 4.5 yr post-FMT (P4) was observed that may, however, have been due to the fact that samples P1–P3 could not be fully resolved down to the species level. At this time point, the bacterial diversities in the samples from patient (P4) and donor (D4) were highly similar.

Bacterial Communities of the Patient Were Similar to Those of the Donor after 4.5 yr up to the Order Level but Showed Differences at Lower Taxonomic Levels

More detailed insights into the bacterial communities were gained at lower taxonomic levels. In all six samples, bacteria of the Bacteroidetes phylum were exclusively assigned to the order Bacteroidales (Bacteroidia class) (Fig. 1C). The Firmicutes phylum stratified into the four orders Lactobacillales (Bacilli class), Clostridiales (Clostridia class), Erysipelotrichales (Erysipelotrichia class), and Selenomonadales (Negativicutes class). At the order level, bacterial communities of D4 and P4 remained highly similar.

At the family level, some differences between these two samples became apparent. For instance, the families Porphyromonadaceae and Rikenellaceae, both of the Bacteroidales order as well as the Lachnospiraceae family of the Clostridiales order, were more abundant in D4 than in P4.

Only samples D0, D4, and P4 were compared in more detail at the genus level, because samples P1–P3 provided only full taxonomic information up to the family level. The relative abundances of the five most dominant genera in samples D0, D4, and P4, including two that were only represented by a single species, are shown in Figure 1D. Fractions of Bacteroides spp., Dialister invisus, and Parabacteroides spp. were roughly similar between samples D4 and P4, whereas Alistipes spp. and Faecalibacterium prausnitzii were more abundant in D4. Most interestingly, we did not identify any sequences assigned to C. difficile species in any of the analyzed samples (data not shown).

Communities of dsDNA Viruses Were Variable and Consisted Mainly of Caudovirales Phages

The analysis of viral dsDNA sequences reported earlier (Broecker et al. 2013) revealed the presence of 22 viruses throughout samples D0, P1, P2, and P3 (Table 2). In each sample, eight to 11 different viruses were identified, mainly belonging to the Caudovirales order (tailed dsDNA phages) that contains the viral families Myo-, Podo-, and Siphoviridae. Most viruses, 14 of 22, were identified uniquely in either sample. Three phages, the Erwinia phage vB_EamP-L1 (Podoviridae) and the two Bacteroides phages B124-14 and B40-8 (Siphoviridae), were consistently detected in all four samples and each contained phages of all three Caudovirales groups. Of these, Podoviridae were consistently most abundant. Myo- and Siphoviridae showed highly variable abundances (Fig. 1E). The patient sample P3 contained sequences related to the Paramecium bursaria Chlorella virus 1 (PBCV-1) that infects eukaryotic algae (Table 2; Van Etten 2003).

Table 2.

List of identified intestinal viruses

Virus NCBI nucleotide accession number Genome size (bp) Number of annotated ORFs Present in D0? Present in P1? Present in P2? Present in P3?
Myoviridae Enterobacteria phage RB16 NC_014467.1 176,788 271 Yes Yes
Enterobacteria phage RB43 NC_007023.1 180,500 292 Yes Yes
Klebsiella phage KP15 NC_014036.1 174,436 258 Yes
Bacillus phage BCP78 NC_018860.1 156,176 227 Yes
Bacillus phage SP10 NC_019487.1 143,986 236 Yes
Streptococcus phage EJ-1 NC_005294.1 42,935 73 Yes
Podoviridae Erwinia phage vB_EamP-L1 NC_019510.1 39,282 51 Yes Yes Yes Yes
Escherichia phage TL-2011b NC_019445 44,784 57 Yes Yes Yes
Bacillus phage ϕ29 NC_011048 19,282 27 Yes
Siphoviridae Bacteroides phage B124-14 NC_016770 47,159 68 Yes Yes Yes Yes
Bacteroides phage B40-8 NC_011222 44,929 46 Yes Yes Yes Yes
Clostridium phage ϕCP34O NC_019508 38,309 52 yes
Lactococcus phage 936 sensu lato KC182544 27,302 49 Yes
Lactococcus phage ϕ41 n.a. n.a. n.a. Yes
Listeria phage 2389 n.a. n.a. n.a. Yes
Listeria phage B025 NC_009812.1 42,653 65 Yes
Rhodococcus phage ReqiPepy6 NC_023735 76,797 107 Yes
Unclassified Caudovirales Sinorhizobium phage PBC5 NC_003324 57,416 83 Yes Yes Yes
Unclassified phages Clostridium phage D-1873 n.a. n.a. n.a. Yes Yes
Tetrasphaera phage TJE1 NC_019930 49,219 66 Yes
Unclassified dsDNA viruses Paramecium bursaria Chlorella virus 1 NC_000852.5 330,611 802 Yes
Clostridium phage ϕSM101 NC_008265.1 38,092 53 Yes
Open in a new tab

NCBI, National Center for Biotechnology Information; ORFs, open reading frames; n.a., not available.

DISCUSSION

FMT has been shown to be a promising treatment option for RCDI patients that leads to replenishment of the patients’ gut microbiota through application of donor feces (Gough et al. 2011; van Nood et al. 2013; Cammarota et al. 2014; O'Horo et al. 2014). Here, we investigated the long-term effects of FMT by analyzing fecal microbiota of a cured RCDI patient in comparison to the donor until 4.5 yr after the procedure.

To analyze the bacterial compositions, we chose 16S rRNA gene sequencing using SMRT (single-molecule real-time) sequencing on the Pacific Biosciences (PacBio) platform. Despite its known limitations regarding raw read quality, this sequencing method has been successfully used previously to resolve compositions of microbial communities (Marshall et al. 2012; Fichot and Norman 2013). In the present study, we used the latest chemistry (C6) that reinforces the main characteristics that make the PacBio platform attractive for microbial sequencing: the absence of sequence context-dependent error and GC-coverage biases (Carneiro et al. 2012; Quail et al. 2012) and, most importantly, the read length. As shown in Table 1, the generated reads were long enough to accurately cover full-length 16S rDNA fragments through the application of the Reads of Insert protocol, an update of the old circular consensus sequence (CCS). The resulting reads were first used as a query against the Silva ribosomal RNA gene database (Quast et al. 2013) using the BLAST algorithm (Altschul et al. 1990). Then, the MEGAN program (Huson et al. 2007) was used to build taxonomic landscapes of the bacterial communities. This workflow has been successfully used before to study microbial communities (Thomas et al. 2012; Li et al. 2013; Sharpton 2014) even of high diversity (Valverde and Mellado 2013). In the present study, both the high-quality scores of the Reads of Insert of >99% and the mean number of passes of at least 15.4 indicated reliable sequencing results (Table 1).

The bacterial composition of the donor was relatively stable and comparable at the time of FMT and 4.5 yr later (Fig. 1B), which is in accordance with the known temporal stability of adult intestinal microbiota (Zoetendal et al. 1998). At the phylum level, Bacteroidetes were most prominent, followed by Firmicutes, typical of healthy gut microbiota (Eckburg et al. 2005). The patient's fecal microbiota underwent extensive compositional fluctuations and were dominated by Firmicutes up to 7 mo post-FMT, suggesting ongoing adaptation processes of donor microbiota in the patient's intestine that may also reflect changes in nutrition over the observation period. This is in accordance with our and other groups’ recent findings that showed high degrees of bacterial variation in RCDI patients up to 7 mo post-FMT (Broecker et al. 2013; Weingarden et al. 2015). However, 4.5 yr post-FMT, the patient's bacteria have attained a donor-like composition at the phylum level, indicating full and stable engraftment of the donor's microbiota. The similarities between the donor's and patient's bacterial compositions remained up to the order level (Fig. 1C). Differences observed at lower taxonomic levels might reflect host-dependent adaptation processes or temporal fluctuations. Of note, four of the five most prominent genera identified in both donor samples as well as the patient sample after 4.5 yr, Alistipes, Bacteroides, Dialister, and Faecalibacterium (Fig. 1D), are known constituents of healthy fecal microbiota (Claesson et al. 2011; Joossens et al. 2011). This further indicated that FMT led to healthy and sustainable microbiota in the patient. Parabacteroides, another genus typical of healthy fecal microbiota (Claesson et al. 2011) was identified in both long-term samples but not in the donor at the time of FMT, perhaps reflecting temporal fluctuations in the healthy donor. One notable species detected in these three samples is Faecalibacterium prausnitzii (Fig. 1D). This species was also detected in the patient samples 6–7 mo post-FMT with abundances of <0.1% (data not shown). Faecalibacterium prausnitzii is recognized as one of the most important species of healthy individuals and normally constitutes >5% of the gut microbiota (Miquel et al. 2013). Lower than usual levels of F. prausnitzii have been associated with Crohn's disease (Sokol et al. 2008; Joossens et al. 2011). The low abundance of F. prausnitzii in the samples of the present study, especially of the patient, is intriguing. However, this may still reflect normal fluctuations, as there have not been any symptoms of Crohn's disease or other apparent complications in the patient.

The fact that the patient's clinical symptoms, which included severe diarrhea in the absence of antibiotic treatment against C. difficile (Broecker et al. 2013), resolved promptly after FMT suggests that gut microbiota were able to exert normal metabolic functions even before full engraftment. This may be explained by the fact that the patient's bacterial diversity even during the highly variable time period up to 7 mo post-FMT was already in the range of the healthy donor. In agreement with the absence of symptoms until today, C. difficile bacteria were undetectable in the samples of the patient, similar to the donor who tested negative for C. difficile before FMT (Broecker et al. 2013). This showed sustainable elimination of C. difficile bacteria from the patient's intestine and successful therapy on the molecular level. It is worth mentioning that the patient had to undergo two short-term antibiotic treatments for other indications with apparently no further consequences on the gut microbiota. The finding that the patient's fecal microbiota attained a highly donor-like composition after 4.5 yr suggests that long-term follow-up should be implemented into clinical practice. Moreover, this finding highlights the importance of selecting donor feces with a healthy microbiota composition. An even better source material for FMT could be prospectively freeze-stored own feces. The suitability of frozen feces for FMT has been demonstrated by a recent phase 1 clinical study, in which orally administered frozen capsules containing healthy fecal matter cured 90% of RCDI patients (Youngster et al. 2014).

Viral sequences were identified by metagenomic sequencing from the same DNA preparations that were used for 16S sequencing. The analysis of viral dsDNA sequences from a previous study (Broecker et al. 2013) revealed the presence of Caudovirales phages in all investigated samples of the donor and the patient (Table 2). Caudovirales have been shown before to be the dominant viruses in the human intestine, followed by ssDNA phages of the Microviridae family that we were unable to detect with the metagenomic sequencing approach (Lepage et al. 2008; Norman et al. 2015). Three phages were identified in all of the analyzed samples of the donor and the patient. One is the Podovirus Erwinia phage vB_EamP-L1 that infects Erwinia amylovora bacteria, the causal agent of fire blight in Rosaceae species including apple and pear trees (Born et al. 2014). As its host, E. amylovora, is not a normal constituent of intestinal microbiota, this phage was likely a food contaminant that survived the stomach passage. The other two universally detected phages were the Siphoviruses Bacteroides phages B124-14 and B40-8 that infect bacteria of the Bacteroides genus abundantly found in the gut of healthy humans (Ogilvie et al. 2012). We detected low and variable quantities of the Bacteroides genus in the patient 6–7 mo post-FMT. In percent of total reads, 0.3% (P1), 20.7% (P2), and 0.3% (P3) were assigned to Bacteroides (data not shown). Even though 16S rRNA gene sequencing did not fully resolve the genus level in these samples, they matched those of the Bacteroidaceae family that contained only Bacteroides spp. in samples D0, D4, and P4 (Fig. 1C). In contrast to P1–P3, both donor samples showed high abundances (57.7% and 61.2%, D0 and D4, respectively) of Bacteroides spp. similar to the patient sample 4.5 yr post-FMT (71.4%, P4) (Fig. 1D). The Bacteroides phages may have been transferred from the donor to the patient where they could have played a role in controlling Bacteroides populations during early stages through bacterial lysis, as suggested before (Lepage et al. 2008; Ogilvie et al. 2012; Norman et al. 2015).

The replication of phages is dependent on the presence of their bacterial host. Therefore, it is not surprising that we found extensive fluctuations in the virome when bacteria were also highly variable in the patient's samples up to 7 mo post-FMT. It has to be noted that the viral abundances presented in Figure 1E were produced by the metagenomic sequencing approach in which viruses with higher gene numbers could be overrepresented (Broecker et al. 2013). The Myoviridae may appear more abundant because of their larger average genomes and gene numbers (Table 2). The relatively small Podoviridae were therefore the most dominant Caudovirales phages among all samples. Phages are known to be able to regulate gut microbiota by bacterial lysis, horizontal gene transfer, and modulation of the intestinal immune system (Barr et al. 2013; Virgin 2014). It is thus tempting to speculate that they may have contributed to the bacterial population dynamics in the patient when the gut microbiota have not yet been fully established.

The identification of PBCV-1-related sequences in one of the patient's samples is intriguing because this virus has not yet been identified in the human intestine. PBCV-1 is a giant virus that contains about 800 open reading frames (ORFs), 400 protein-coding genes, and up to 16 tRNA genes. The related Acanthocystis turfacea Chlorella virus 1 (ATCV-1) has been identified recently in human nasopharyngeal samples where its presence correlated with reduced cognitive function (Yolken et al. 2014), showing that giant viruses may well be relevant for human health and disease. Sequences of Phycodnaviridae, the viral family harboring PBCV-1 and ATCV-1, have previously been reported to be present in the intestine of rodents (Phan et al. 2011). A possible role of PBCV-1 in the human intestine remains to be elucidated, but its presence may simply have resulted from the intake of Chlorella algae–contaminated freshwater (Van Etten 2003). The first identification of PBCV-1-related sequences in a human intestine, however, suggests that other unexpected viruses may be detected in future studies.

Phages are ∼10-fold more abundant than their prokaryotic hosts in the human gut where they may influence bacterial diversity and population structure (Lepage et al. 2008; Minot et al. 2013). The low number of eight to 11 phages identified per sample here may be an underrepresentation, perhaps attributable to the DNA isolation procedure (Broecker et al. 2013). Also, the sequencing approach did not allow for distinguishing integrated prophages from genomes of free virus particles (Broecker et al. 2013). The isolation of viral genetic material from viral particles in stool supernatants may be more suitable to characterize fecal virus communities (Lepage et al. 2008; Phan et al. 2011; Norman et al. 2015). It has been reported that phages in the gut may be liberated under pathologic conditions, like inflammation (Lepage et al. 2008), suggesting that low numbers may correlate with healthy gut microbiota.

Overall, our findings demonstrate the long-term efficacy of FMT for the treatment of RCDI on the molecular level. Highly diverse phage communities suggest a possible role of phages during engraftment of donor microbiota. In light of a recent study that showed a causative role of phages in the etiology of IBD (Norman et al. 2015), gut viruses may be relevant during C. difficile disease and response to FMT as well. This is the subject of ongoing comprehensive investigations of fecal viromes of RCDI and IBD patients treated with FMT at the University Hospital and the ETH Zurich.

METHODS

Metagenomic Sequencing

The metagenomic-sequencing data used to characterize viruses in samples D0, P1, P2, and P3 (Table 1) is from a previous publication (Broecker et al. 2013). Briefly, DNA was isolated from ∼0.2 g of frozen-stool samples with the QIAamp DNA Stool Mini Kit (QIAGEN), then treated with DNase-free RNase (Fermentas), and further purified by phenol/chloroform extraction. Barcoded libraries were generated with the NEBNext DNA sample prep kit (New England Biolabs) and sequenced on an Illumina Genome Analyzer IIx instrument in a 120-base paired-end multiplex run. Read sets were assembled to contiguous sequences with the CLC Genomic Workbench V5. ORFs of these contigs were predicted with GLIMMER3 (Salzberg et al. 1998). The ORFs were queried in the NR-PROT protein database (Benson et al. 2009) using BLASTP (Altschul et al. 1990). The first listed protein hit of each ORF was taxonomically assigned using MEGAN. For more details, refer to Broecker et al. (2013).

16S rRNA Gene Sequencing

Fecal DNA was isolated as described above in “Metagenomic Sequencing.” For samples D0, P1, P2, and P3, the same DNA preparations used previously for metagenomic sequencing (Broecker et al. 2013) and stored at −80°C were subjected to 16S rRNA gene sequencing. A broad-range 16S rDNA PCR was performed with the Phusion High-Fidelity PCR Master Mix (Finnzymes/NEB), using universal primers TPU-1 (AGAGTTTGATCMTGGCTCAG), 1387r (GGGCGGWGTGTACAAGGC), and one-tenth of primer Bif-8F (AGGGTTCGATTCTGGCTCAG) in order to amplify ∼1300 bp of the bacterial 16S rRNA genes. PCR cycling conditions were 3 min at 98°C (10 sec at 98°C 30 sec at 55°C, 45 sec at 72°C) × 24; 10 min at 72°C). Sequencing on the PacBio RS II was performed with SMRT cell libraries prepared with the DNA Template Prep Kit 2.0 (250 bp to <3 kb) (Pacific Biosciences p/n 001-540-726) and 1400-bp selected target size. Consensus sequences were generated with the Reads of Insert protocol by retaining only sequences with ≥90% accuracy and 1400 ± 100 bp length. The minimum number of passes was set to 3. A summary of the sequencing yields and accuracies is provided in Table 1.

Phylogenetic Analysis of 16S rRNA Gene Sequencing Data

Resulting Reads of Insert consensus sequences were analyzed in the release 115 of the SILVA database (Quast et al. 2013) using v2.2.29 of BLAST (Altschul et al. 1990). An e-value of 0.001 was imposed as threshold and 100 sequences were retained (‘-evalue 0.001 -max_target_seqs 100’). Output from the BLAST alignment was analyzed with v5.0 of the MEGAN program (Huson et al. 2007) with a threshold of at least five supporting reads for a taxonomic level to be reported as present. Bacterial diversities at the species level have been estimated by calculating Shannon indices (Etter 1999).

ADDITIONAL INFORMATION

Ethics Statement

Informed consent has been obtained from the study participants. This study was approved by the Institutional Review Board of the University Hospital Zurich.

Database Deposition and Access

The sequencing data have been deposited in the NCBI SRA database (http://www.ncbi.nlm.nih.gov/sra) under BioProject ID PRJNA292639 and SRA ID SRP062303. Accession numbers of individual samples are SRX1143098 (D0), SRX1142599 (P1), SRX1143096 (P2), SRX1143095 (P3), SRX1143099 (D4), and SRX1143097 (P4).

Acknowledgments

The authors thank the donor and patient for their cooperation and their strong support of this study. We are also grateful to Prof. Peter H. Seeberger, Max Planck Institute of Colloids and Interfaces, Potsdam, Germany, for generous support of F.B. We thank colleagues from the Max Planck Institute for Molecular Genetics, Berlin, Germany for their support of this work and access to laboratory infrastructures and in particular to the bioinformatics facilities. The excellent technical assistance of Monique Herensperger is gratefully acknowledged.

Author Contributions

F.B., J.K., and M.S. performed the laboratory experiments and coordinated the work with G.Ru. who generated the data at the Functional Genomics Centre, Zurich, Switzerland. M.H. was involved in guidance of the patient and the donor, G.Ro. and L.B. are the medical doctors responsible for the clinical and ethical aspects involved. K.M. initiated and coordinated the project. F.B., J.K., and K.M. wrote the manuscript with assistance from G.Ru.

Funding

We thank colleagues of the Institute of Medical Microbiology, University of Zurich, Switzerland and of the Institute of Food, Nutrition and Health, ETH Zurich, Zurich, Switzerland for their generous financial support. K.M. supplied some private funds.

Competing Interest Statement

The authors have declared no competing interest.

REFERENCES

  1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215: 403–410. [DOI] [PubMed] [Google Scholar]
  2. Barr JJ, Auro R, Furlan M, Whiteson KL, Erb ML, Pogliano J, Stotland A, Wolkowicz R, Cutting AS, Doran KS, et al. 2013. Bacteriophage adhering to mucus provide a non-host-derived immunity. Proc Natl Acad Sci 110: 10771–10776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW. 2009. GenBank. Nucleic Acids Res 37: 377–386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Born Y, Fieseler L, Klumpp J, Eugster MR, Zurfluh K, Duffy B, Loessner MJ. 2014. The tail-associated depolymerase of Erwinia amylovora phage L1 mediates host cell adsorption and enzymatic capsule removal, which can enhance infection by other phage. Environ Microbiol 16: 2168–2180. [DOI] [PubMed] [Google Scholar]
  5. Broecker F, Kube M, Klumpp J, Schuppler M, Biedermann L, Hecht J, Hombach M, Keller PM, Rogler G, Moelling K. 2013. Analysis of the intestinal microbiome of a recovered Clostridium difficile patient after fecal transplantation. Digestion 88: 243–251. [DOI] [PubMed] [Google Scholar]
  6. Cammarota G, Ianiro G, Gasbarrini A. 2014. Fecal microbiota transplantation for the treatment of Clostridium difficile infection: a systematic review. J Clin Gastroenterol 48: 693–702. [DOI] [PubMed] [Google Scholar]
  7. Carneiro M, Russ C, Ross M, Gabriel S, Nusbaum C, DePristo M. 2012. Pacific Biosciences sequencing technology for genotyping and variation discovery in human data. BMC Genomics 13: 375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Claesson MJ, Cusack S, O'Sullivan O, Greene-Diniz R, de Weerd H, Flannery E, Marchesi JR, Falush D, Dinan T, Fitzgerald G, et al. 2011. Composition, variability, and temporal stability of the intestinal microbiota of the elderly. Proc Natl Acad Sci 108Suppl 1: 4586–4591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, Gill SR, Nelson KE, Relman DA. 2005. Diversity of the human intestinal microbial flora. Science 308: 1635–1638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Etter W. 1999. Community analysis. In Numerical palaeobiology (ed. Harper DAT), pp. 285–360. John Wiley and Sons, Chichester, UK. [Google Scholar]
  11. Fichot EB, Norman RS. 2013. Microbial phylogenetic profiling with the Pacific Biosciences sequencing platform. Microbiome 1: 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gough E, Shaikh H, Manges AR. 2011. Systematic review of intestinal microbiota transplantation (fecal bacteriotherapy) for recurrent Clostridium difficile infection. Clin Infect Dis 53: 994–1002. [DOI] [PubMed] [Google Scholar]
  13. Huson DH, Auch AF, Qi J, Schuster SC. 2007. MEGAN analysis of metagenomic data. Genome Res 17: 377–386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Johnson S. 2009. Recurrent Clostridium difficile infection: a review of risk factors, treatments, and outcomes. J Infect 58: 403–410. [DOI] [PubMed] [Google Scholar]
  15. Joossens M, Huys G, Cnockaert M, De Preter V, Verbeke K, Rutgeerts P, Vandamme P, Vermeire S. 2011. Dysbiosis of the faecal microbiota in patients with Crohn's disease and their unaffected relatives. Gut 60: 631–637. [DOI] [PubMed] [Google Scholar]
  16. Lepage P, Colombet J, Marteau P, Sime-Ngando T, Doré J, Leclerc M. 2008. Dysbiosis in inflammatory bowel disease: a role for bacteriophages? Gut 57: 424–425. [DOI] [PubMed] [Google Scholar]
  17. Lessa FC, Gould CV, McDonald LC. 2012. Current status of Clostridium difficile infection epidemiology. Clin Infect Dis 55Suppl 2: S65–S70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Li A, Chu Y, Wang X, Ren L, Yu J, Liu X, Yan J, Zhang L, Wu S, Li S. 2013. A pyrosequencing-based metagenomic study of methane-producing microbial community in solid-state biogas reactor. Biotechnol Biofuels 6: 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lo Vecchio A, Zacur GM. 2012. Clostridium difficile infection: an update on epidemiology, risk factors, and therapeutic options. Curr Opin Gastroenterol 28: 1–9. [DOI] [PubMed] [Google Scholar]
  20. Marshall CW, Ross DE, Fichot EB, Norman RS, May HD. 2012. Electrosynthesis of commodity chemicals by an autotrophic microbial community. Appl Environ Microbiol 78: 8412–8420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. McDonald LC, Killgore GE, Thompson A, Owens RC Jr, Kazakova SV, Sambol SP, Johnson S, Gerding DN. 2005. An epidemic, toxin gene–variant strain of Clostridium difficile. N Engl J Med 353: 2433–2441. [DOI] [PubMed] [Google Scholar]
  22. Minot S, Bryson A, Chehoud C, Wu GD, Lewis JD, Bushman FD. 2013. Rapid evolution of the human gut virome. Proc Natl Acad Sci 110: 12450–12455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Miquel S, Martín R, Rossi O, Bermúdez-Humarán LG, Chatel JM, Sokol H, Thomas M, Wells JM, Langella P. 2013. Faecalibacterium prausnitzii and human intestinal health. Curr Opin Microbiol 16: 255–261. [DOI] [PubMed] [Google Scholar]
  24. Norman JM, Handley SA, Baldridge MT, Droit L, Liu CY, Keller BC, Kambal A, Monaco CL, Zhao G, Flehner P, et al. 2015. Disease-specific alterations in the enteric virome in inflammatory bowel disease. Cell 160: 447–460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Ogilvie LA, Caplin J, Dedi C, Diston D, Cheek E, Bowler L, Taylor H, Ebdon J, Jones BV. 2012. Comparative (meta)genomic analysis and ecological profiling of human gut-specific bacteriophage φB124-14. PLoS One 7: e35053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. O'Horo JC, Jindai K, Kunzer B, Safdar N. 2014. Treatment of recurrent Clostridium difficile infection: a systematic review. Infection 42: 43–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Phan TG, Kapusinszky B, Wang C, Rose RK, Lipton HL, Delwart EL. 2011. The fecal viral flora of wild rodents. PLoS Pathog 7: e1002218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Quail MA, Smith M, Coupland P, Otto TD, Harris SR, Connor TR, Bertoni A, Swerdlow HP, Gu Y. 2012. A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers. BMC Genomics 13: 341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, Peplies J, Glöckner FO. 2013. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res 41(Database issue): D590–D596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Razavi B, Apisarnthanarak A, Mundy LM. 2007. Clostridium difficile: emergence of hypervirulence and fluoroquinolone resistance. Infection 35: 300–307. [DOI] [PubMed] [Google Scholar]
  31. Salzberg SL, Delcher AL, Kasif S, White O. 1998. Microbial gene identification using interpolated Markov models. Nucleic Acids Res 26: 544–548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sharpton TJ. 2014. An introduction to the analysis of shotgun metagenomic data. Front Plant Sci 5: 209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sokol H, Pigneur B, Watterlot L, Lakhdari O, Bermúdez-Humarán LG, Gratadoux JJ, Blugeon S, Bridonneau C, Furet JP, Corthier G, et al. 2008. Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn's disease patients. Proc Natl Acad Sci 105: 16731–16736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Thomas T, Gilbert J, Meyer F. 2012. Metagenomics—a guide from sampling to data analysis. Microb Inform Exp 2: 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Valverde JR, Mellado RP. 2013. Analysis of metagenomic data containing high biodiversity levels. PLoS One 8: e58118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Van Etten JL. 2003. Unusual life style of giant chlorella viruses. Annu Rev Genet 37: 153–195. [DOI] [PubMed] [Google Scholar]
  37. van Nood E, Vrieze A, Nieuwdorp M, Fuentes S, Zoetendal EG, de Vos WM, Visser CE, Kuijper EJ, Bartelsman JF, Tijssen JG, et al. 2013. Duodenal infusion of donor feces for recurrent Clostridium difficile. N Engl J Med 368: 407–415. [DOI] [PubMed] [Google Scholar]
  38. Virgin HW. 2014. The virome in mammalian physiology and disease. Cell 157: 142–150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Warny M, Pepin J, Fang A, Killgore G, Thompson A, Brazier J, Frost E, McDonald LC. 2005. Toxin production by an emerging strain of Clostridium difficile associated with outbreaks of severe disease in North America and Europe. Lancet 366: 1079–1084. [DOI] [PubMed] [Google Scholar]
  40. Weingarden A, González A, Vázquez-Baeza Y, Weiss S, Humphry G, Berg-Lyons D, Knights D, Unno T, Bobr A, Kang J, et al. 2015. Dynamic changes in short- and long-term bacterial composition following fecal microbiota transplantation for recurrent Clostridium difficile infection. Microbiome 3: 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yolken RH, Jones-Brando L, Dunigan DD, Kannan G, Dickerson F, Severance E, Sabunciyan S, Talbot CC Jr, Prandovszky E, Gurnon JR, et al. 2014. Chlorovirus ATCV-1 is part of the human oropharyngeal virome and is associated with changes in cognitive functions in humans and mice. Proc Natl Acad Sci 111: 16106–16111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Youngster I, Russell GH, Pindar C, Ziv-Baran T, Sauk J, Hohmann EL. 2014. Oral, capsulized, frozen fecal microbiota transplantation for relapsing Clostridium difficile infection. JAMA 312: 1772–1778. [DOI] [PubMed] [Google Scholar]
  43. Zoetendal EG, Akkermans AD, de Vos WM. 1998. Temperature gradient gel electrophoresis analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities of active bacteria. Appl Environ Microbiol 64: 3854–3859. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cold Spring Harbor Molecular Case Studies are provided here courtesy of Cold Spring Harbor Laboratory Press

RESOURCES