Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 May 1.
Published in final edited form as: J Mol Neurosci. 2016 Jan 25;59(1):1–17. doi: 10.1007/s12031-015-0711-6

Neuronal Hemoglobin Expression and Its Relevance to Multiple Sclerosis Neuropathology

Nolan Brown 1,#, Kholoud Alkhayer 1,#, Robert Clements 1, Naveen Singhal 1, Roger Gregory 2, Sausan Azzam 3, Shuo Li 1,2, Ernest Freeman 1, Jennifer McDonough 1
PMCID: PMC4851882  NIHMSID: NIHMS754734  PMID: 26809286

Abstract

Multiple sclerosis (MS) is characterized by demyelination and progressive neurological disability. Previous studies have reported defects to mitochondria in MS including decreased expression of nuclear encoded electron transport chain subunit genes and inhibition of respiratory complexes. We previously reported increased levels of the hemoglobin β subunit (Hbb) in mitochondrial fractions isolated from postmortem MS cortex compared to controls. In the present study, we performed immunohistochemistry to determine the distribution of Hbb in postmortem MS cortex and identified proteins which interact with Hbb by liquid chromatography tandem mass spectrometry (LC-MS/MS). We found that Hbb was enriched in pyramidal neurons in internal layers of the cortex and interacts with subunits of ATP synthase, histones, and a histone lysine demethylase. We also found that Hbb is present in the nucleus and that expression of Hbb in SH-SY5Y neuroblastoma cells increased trimethylation of histone H3 on lysine 4 (H3K4me3), a histone mark that regulates cellular metabolism. These data suggest that Hbb may be a part of a mechanism linking neuronal energetics with epigenetic changes to histones in the nucleus and may provide neuroprotection in MS by supporting neuronal metabolism.

Keywords: Multiple sclerosis, Hemoglobin expression, Pyramidal neurons, Mass spectrometry, Mitochondrial genes, Histone methylation

Introduction

Multiple sclerosis (MS) is a neurodegenerative disease characterized by the demyelination and deterioration of neurons within the central nervous system (CNS) (Noseworthy et al. 2000). In MS, axonal and neuronal degeneration and inflammatory demyelination accumulate over time, resulting in progressive neurological disability (Bjartmar et al. 2000; De Stefano et al. 2001). Historically, MS was considered a white matter disease and the majority of research concerning MS was focused on understanding autoimmune demyelination. However, it has been established that cortical pathology, including extensive gray matter lesions and cortical atrophy, contribute to the progression of MS (Bo et al. 2006; Inglese et al. 2004; Fisher et al. 2008). The mechanisms involved in cortical pathology are not clear, but current hypotheses describe dysfunction of the mitochondria in the cortex in MS. In studies analyzing postmortem brain tissue, the expression of genes involved in mitochondrial respiration has been found to be altered in normal appearing gray matter (NAGM) in MS brains compared to NAGM in non-diseased brains (Dutta et al. 2006; Pandit et al. 2009; Witte et al. 2013). In a subsequent proteomic analysis of mitochondria in MS and control cortical tissue, hemoglobin β (Hbb) was found to be expressed in neurons and was more abundant in MS postmortem cortex compared to non-diseased cortex (Broadwater et al. 2011).

Until recently, erythrocytes were believed to be the only cell type to contain hemoglobin. The function of hemoglobin in red blood cells is to transport and exchange oxygen (O2) and carbon dioxide (CO2) in tissues. In red blood cells, hemoglobin exists as a heterotetramer of two hemoglobin α (Hba) and two hemoglobin β (Hbb) subunits. However, studies have now shown that various cell types other than erythrocytes, such as macrophages, epithelial cells, and neurons, also contain hemoglobin (Rahaman and Straub 2013). The discovery of Hba and/or Hbb expression in diverse cell types suggests that they have other roles in addition to their role in O2 and CO2 transport. Hemoglobins contain a heme-prosthetic group (Fe-protoporphyrin IX) which binds not only O2 and CO2 but also nitric oxide (NO), allowing them to also participate in redox and dioxygenase reactions (Reeder et al. 2010). In mesangial cells of the kidney, hemoglobin has been shown to act as an anti-oxidant (Nishi et al. 2008). Separate functions have also been described for the α and β subunits in some cell types. In macrophages, the hemoglobin β minor subunit is expressed without the α subunit and acts to scavenge NO (Liu et al. 1999). In vascular endothelial cells, Hba is expressed and has been shown to regulate NO release necessary for vasodilation when O2 concentrations are low (Straub et al. 2012). It is clear that hemoglobin has evolved to carry out diverse physiological functions in many different cell types. The role of hemoglobin in neurons in the CNS is still not clear. In order to better understand the function of Hbb and its potential role in providing neuroprotection in MS, we have analyzed the cortical distribution of Hbb by immunohistochemistry. We have also performed co-immunoprecipitation (Co-IP) experiments with an Hbb antibody followed by liquid chromatography tandem mass spectrometry (LC-MS/MS) to identify proteins interacting with Hbb in the MS cortex and in cultured primary neurons.

Methods

Immunofluorescent Staining

Postmortem MS and control cortical brain tissue was obtained under IRB protocol from the Rocky Mountain MS Center and the Human Brain and Spinal Fluid Resource Center at UCLA. For immunofluorescent staining, frozen tissue blocks were fixed in 4 % paraformaldehyde for 24 h and cut 30 μm thick using a vibratome. Cortical tissue from five MS and four control brains was analyzed. Donor and tissue characteristics including age, sex, postmortem interval (PMI), and brain region are shown in Table 1. Blocking buffer was prepared as 1× phosphate-buffered saline (PBS) with 0.5 % Triton X-100 and 3 % normal donkey serum. Samples were blocked in blocking buffer for 1 h and then primary antibodies were diluted in blocking buffer and applied to samples overnight at 4 °C. Primary antibodies were applied in the following concentrations: Hbb (Aviva Systems Biology, San Diego, CA) 1:250, neurofilament (SMI32) (Calbiochem, Billerica, MA) 1:500, and tyrosine hydroxylase (Santa Cruz Biotechnologies, Dallas, TX) 1:250. Secondary antibodies were also applied in blocking buffer at 4 °C for 2 h. All secondary antibodies were obtained from Invitrogen (Carlsbad, CA) and were applied at a concentration of 1:500. Secondary antibodies used are as follows: donkey anti-rabbit Alexafluor 488, donkey anti-goat Alexafluor 488, donkey anti-mouse Alexafluor 555, and donkey anti-goat Alexafluor 555. After incubation of secondary antibodies, samples were soaked in 10 mM cupric sulfate, 10 mM ammonium acetate buffer for 90 min to quench autofluorescence. Samples were mounted on microscope slides using Vectashield mounting medium for fluorescence with DAPI (Vector Laboratories, Burlingame, CA). Mounted samples were viewed with a Fluoview 1000 confocal microscope and imaged using the bundled software.

Table 1.

Donor and tissue characteristics

Sample Age (years) Sex PMI (h) Region of cortex
MS 1 79 F 7.0 Parietal
MS 2 69 M 12.0 Motor
*MS 3 63 F 23.0 Frontal
*MS 4 78 F 7.8 Parietal
*MS 5 79 F 7.4 Parietal
*MS 6 53 F 3.0 Parietal
*MS 7 61 F 6.0 Parietal
*MS 8 36 F 3.0 Parietal
C1 83 F 17.6 Motor
C2 74 M 13.4 Frontal
*C3 74 F 18.0 Frontal
*C4 67 M 22.0 Motor
*C5 74 F 4.5 Frontal
*C6 80 M 9.5 Parietal
*C7 59 F 19.5 Frontal
*C8 35 F 9.3 Parietal
Open in a new tab

Immunostaining with neurofilament (SMI32) allowed the visualization of the cortical layers in each tissue block analyzed. Only sections containing all layers of the cortex with neural projections streaming perpendicular to the pial surface were included. With SMI32 as a guide to ensure that all layers of the cortical section were analyzed, contiguous ×20 objective fields were imaged from the outer edge of the cortex to the white matter. Image stacks spanning the depth of the tissue sections were acquired and the fields were stitched together with Fluoview software to create a map of the cortex spanning from the pial surface to cortical layer VI. SMI32 and Hbb immunoreactive neurons were counted in the external and internal cortical layers for sections from five MS and four control brains with Image J (Rasband 1997).

Primary Neuronal Cultures

All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Kent State University. Primary neuronal cultures were isolated from E17 Sprague Dawley rat brains. Briefly, cerebral cortices were dissected from the whole fetal rat brain and meninges carefully removed. The rat cerebral cortex was mechanically dissociated in EMEM containing 10 % FBS using fire polished Pasteur pipettes and then passed through 70 μm pore-sized mesh. Cells were then pelleted by centrifugation of 100×g for 10 min at 4 °C and resuspended with neurobasal medium supplemented with B27 and N2. Cells were plated on poly-D-lysine-coated tissue culture dishes and maintained at 37 °C and 5 % CO2 in a humidified incubator. Primary neurons were cultured for 10 days before protein isolation. Media was changed after 3 days to eliminate any hemoglobin from blood contamination. Total protein was isolated for identification of hemoglobin interacting proteins by co-IP followed by LC-MS/MS. To confirm the presence of hemoglobin in our cultures, some cells were incubated on coverslips and immunostained with antibodies to hemoglobin (Pierce Biotechnology, Rockford, IL) and neurofilament (Chemicon, Temecula, CA) followed by the appropriate fluorescent secondary antibodies Alexafluor 488 or Alexafluor 555 (both from Invitrogen, Carlsbad, CA). Western blotting of protein isolated from our cultured rat primary neurons also confirmed the presence of a hemoglobin 16-kDa band (not shown). Immunostained cells were imaged with a Fluoroview 1000 confocal microscope.

Protein Extraction and Co-IP for Mass Spectrometry

For co-IP experiments, total protein was isolated from cortical gray matter tissue from an MS brain and from rat primary neuronal cultures. Tissue or cells were homogenized with a mini-homogenizer for 60 s in five volumes of extraction buffer. Extraction buffer consisted of 20 mM HEPES, pH 7.5, 100 mM NaCl, 0.05 % Triton X-100, 1 mM dithiothreitol (DTT), 5 mM sodium β-glycerophosphate, 0.5 mM sodium orthovanadate, 1 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 10 μg/mL aprotinin, 5 μg/mL leupeptin, and 2 μg/mL pepstatin. The samples were then spun at 12,000×g for 15 min at 4 °C. The supernatant was taken and spun again at 12,000×g for 10 min at 4 °C. The supernatant was kept as the protein sample. Co-IP was performed with the protein isolated using the Pierce™ Classic Magnetic IP/Co-IP Kit (Thermo Scientific, Waltham, MA). In order to form the Hbb and antibody immune complex, 1.0 mg of protein extract was incubated with 10 μg of an Hbb antibody (Aviva Systems Biology, San Diego, CA). Protein isolated from rat primary neurons was incubated with 10 μg of a hemoglobin antibody (Pierce Biotechnology, Rockford, IL). Protein was also immunoprecipitated with non-specific IgG as a control. The protein and antibodies were incubated for 2 h at room temperature, with the total reaction diluted to 500 μL in IP Lysis/Wash Buffer. IP Lysis/Wash Buffer consisted of 0.025 M Tris, 0.15 M NaCl, 0.001 M EDTA, 1 % NP40, and 5 % glycerol at pH 7.4. After complex formation, 25 μL of washed magnetic beads were added to the complex solution and incubated at room temperature for 1 h. The beads were washed with 500 μL IP Lysis/Wash Buffer and then with 500 μL of ultrapure water. The sample was eluted with 100 μL of low-pH elution buffer for 10 min at room temperature and then neutralized.

Eluted proteins from the Co-IP were resuspended in SDS-PAGE sample buffer and denatured at 95 °C for 5 min. The sample was run on a NuPAGE 4-12 % Bis Tris Gel (Invitrogen, Carlsbad, CA) and Coomassie stained to visualize protein bands. The gel was washed and destained in distilled water. The protein lane was cut out of the gel and destained with 500 μL of 1:1 ACN (acetonitrile) and 100 mM ABC (ammonium bicarbonate) solution for 2–6 h. Next, the gel piece was dehydrated and hydrated with 200 μL 100 % ACN and 200 μL 100 mM ABC, respectively. Disulfide bonds were then reduced with 10 mM DTT at 56 °C for 45 min, and free cysteines were alkylated with 55 mM IAA (iodoacetamide) in the dark at RT for 45 min. The gel piece was then swelled in 50 mM ABC containing freshly prepared 10 ng/μL trypsin (Promega, Madison, WI, sequencing-grade) and digested overnight at 37 °C. Subsequently, peptides were extracted 50 % ACN/25 mM ABC/5 % FA (formic acid) and dried in SpeedVac.

Reverse Phase LC-MS/MS Analysis and Protein Identification

For gel-based tandem mass spectrometry analysis, digested peptides were reconstituted with 0.1 % formic acid and analyzed by LC-MS/MS using an LTQ-Orbitrap Elites mass spectrometer (Thermo Scientific, Waltham, MA) equipped with a nanoAcquity™ Ultra-high pressure liquid chromatography system (Waters). The mobile phases included aqueous phase A (0.1 % FA in water) and organic phase B (0.1 % FA in 85 % ACN). Tryptic peptides were loaded onto a nanoACQUITY UPLC desalting trap column (180 μm × 20 mm nano column, 5 μm, 100 A°, Waters). Subsequently, peptides were resolved in a nanoACQUITY UPLC reversed phase column (75 μm × 250 mm nano column, 1.7 μm, 100 A°; Waters). Liquid chromatography was carried out using a gradient elution of 1–90 % of organic phase over 90 min at ambient temperature. Peptides were then introduced into the mass spectrometer via a nano-electrospray ion source at a flow rate of 0.3 μL/min. Full scan MS spectra were acquired at a resolution of 60,000 followed by 20 collision-induced dissociation (CID) fragmentations in a data-dependent manner. The dynamic exclusion list was confined to a maximum of 500 entries, with exclusion duration of 45 s and mass accuracy of 10 ppm for the precursor monoisotopic mass.

For protein identification, the LC-MS/MS raw files were acquired using the Thermo X-calibur software (Thermo Scientific, Waltham, MA) and searched by Mascot (version 2.3.01, Matrix Science) against the human Uniprot (71,434 sequences) database. Search settings were as follows: trypsin enzyme specificity; mass accuracy window for precursor ion, 10 ppm; mass accuracy window for fragment ions, 0.8 Da; variable modifications including carbamidomethylation of cysteines, one missed cleavage, and oxidation of methionine. The search results were then filtered using the cutoff criteria of p value ≤0.05.

Hbb Expression Construct and Transfections

Total RNA were extracted from approximately 50 mg human brain tissue using a SV total RNA isolation system (Promega, Madison, WI) according to manufacturer's instructions. The quantity and quality of RNA were checked with a ND1000 Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, DE). Reverse transcription to produce cDNA was performed with a Brilliant III ultrafast SYBR Green QRT-PCR kit (Agilent Technologies, Santa Clara, CA). Full-length human Hbb cDNA was amplified by PCR from human brain cDNA using the following primer pairs: Hbb F 5′ATCCTCGAGTGCTTCTGACACAACTGTGTTCACT 3′ and Hbb R 5′ ATCCCGGGTGGACAGCAAGAAAGCGAGCTT 3′. The resulting PCR product was cloned into pEGFP (Clontech Laboratories) and then subcloned into the XhoI and NheI sites of the pVitro2 mammalian expression vector (Invivogen, San Diego, CA). The constructed plasmid was confirmed by sequencing and the insert showed 100 % sequence similarity with the Hbb sequence from NCBI [hemoglobin β (NM_000518.4)].

Human SH-SY5Y neuroblastoma cells were cultured in 1:1 mixture of EMEM and F-12 medium (Sigma-Aldrich, St. Louis, MO) with 10 % FBS (MidSci, St. Louis, MO) in a 37 °C incubator with 5 % CO2. pVitro2 and pVitro2-Hbb constructs were purified and transfected into SH-SY5Y cells with TransIt Express transfection reagent (Mirus, Madison, WI) according to manufacturer's instructions. The pVitro2 and pVitro2-Hbb plasmids were incubated with the TransIt transfection reagent for 30 min to allow DNA complexes to form. The complexes were then added to SH-SY5Y cells already seeded on 100 mm culture plates to 80 % confluency and incubated for 48 h. After 48 h, protein was isolated and Western blotting was performed to measure levels of Hbb expression and histone methylation.

Western Blotting

Proteins were separated by SDS polyacrylamide gel electrophoresis on NuPage 4–12 % Bis-Tris gels (Invitrogen, Carlsbad, CA) and transferred to nitrocellulose. Blots were then incubated in primary antibody overnight and then in the appropriate HRP-conjugated secondary antibody for 2 h and immunoreactivity was detected with Luminol (Santa Cruz Biotechnologies, Dallas, TX). For quantitation of nuclear and mitochondrial Hbb protein levels in MS and control postmortem tissue, protein was isolated and fractionated according to the method of Pallotti and Lenaz (2007). Six MS and six control cortical gray matter tissue samples were analyzed (Table 1). The purity of fractions was determined by Western blotting with antibodies to the mitochondrial membrane protein aralar (BD Biosciences, Franklin Lakes, NJ) and the neuronal nuclear marker NeuN (Chemicon International, Temecula, CA). Western blots were also performed with an antibody to the astrocyte marker GFAP (not shown). Any samples exhibiting increased GFAP indicative of astrogliosis or a change in cellularity indicated by decreased NeuN were eliminated. Western blotting was performed with an antibody to Hbb (Aviva Systems Biology, San Diego, CA) and relative Hbb levels were determined after normalization to either NeuN for nuclear fractions or aralar for mitochondrial fractions. To confirm identification of Hbb interacting proteins, Western blots were performed with protein immunoprecipitated with antibodies to Hbb or non-specific IgG. Blots were incubated with antibodies to Hbb (Aviva Systems Biology, San Diego, CA), ATP5A1 (Novex Life Technologies, Waltham, MA), and histone H3 (Abcam, Cambridge, MA). To measure Hbb and H3K4me3 levels in transfected SH-SY5Y cells, blots were incubated with antibodies to either Hbb (Aviva Systems Biology, San Diego, CA) or histone H3 trimethylated on lysine 4 (H3K4me3) (Abcam, Cambridge, MA). Hbb levels were normalized to GAPDH (Millipore, Temecula, CA) and H3K4me3 was normalized to histone H3. Protein levels were determined by densitometry with Image J from at least two independent experiments. Statistical significance of changes in protein levels was determined with a Student's t test with p ≤ 0.05 considered significant.

Results

To understand the distribution of hemoglobin in the cortex and to determine whether this distribution is altered in MS, we performed immunofluorescent staining with antibodies to hemoglobin and the neuronal marker neurofilament (SMI32) in cortical sections obtained from five MS and four control brains (Table 1). A representative confocal image showing the subdivisions of the cortex ascertained by SMI32 immunostaining in motor cortex from an MS sample is shown in Fig. 1a. Representative confocal images showing colocalization of Hbb and SMI32 in neurons in MS cortical sections are shown in Fig. 1b. We did not find any statistically significant difference between MS and control brains in the overall percentage of Hbb + cells or in the cortical distribution of Hbb. We identified a total of 703 SMI32+ neurons from immunostained sections from the motor and parietal cortex across five MS brains and found that 33 % were also immunoreactive for Hbb. For control brains, 534 SMI32 positive neurons were identified across four brains and 172 also expressed Hbb (32 %). In addition, we found that Hbb expression was enriched in the internal layers of the cortex (layers IV–VI) compared to external layers (layers I–III) in both MS and control brains. For MS brains, 300 SMI32 positive neurons were identified in the external layers of the cortex, and 67 were also immunoreactive for Hbb (22 %). In the internal layers, 403 SMI32 positive neurons were identified and 167 expressed Hbb (42 %). For controls, in external layers, 49 of 197 SMI32 positive neurons expressed Hbb (25 %). In the internal layers, 337 SMI32 positive neurons were counted and 123 also expressed Hbb (36 %). Most Hbb containing neurons exhibited pyramidal cell morphology. Hbb expression was found to be localized predominantly in the cytoplasm of these cells, but nuclear staining was also detected as shown in Fig. 1c. Weak staining for Hbb was observed in the nucleus, but not in the nucleolus in pyramidal neurons in both MS and control cortical tissue. It has been reported that SMI32, which stains non-phosphorylated neurofilament-H, is a marker of dystrophic neurons and axons, and is indicative of axonal damage. In our hands we did not observe a difference in neurofilament staining with SMI32 or with the SMI31 antibody which stains phosphorylated neurofilament in postmortem tissue. We also stained tissue blocks with SMI31 and Hbb and obtained similar results (data not shown).

Fig. 1.

Fig. 1

Open in a new tab

Cortical distribution of Hbb expressing pyramidal neurons in MS cortex. a Representative confocal image from MS motor cortex immunostained with antibodies to neurofilament (SMI32) and Hbb. Sequential ×20 confocal images were acquired from the pial surface extending through cortical layer VI and stitched into a single image. Cortical layers were visualized by SMI32 staining shown in grayscale. Scale bar represents 100 μm. b Panel shows the boxed region in A at higher magnification. SMI32 and Hbb immunoreactivity can be seen in pyramidal neurons denoted by arrows. SMI32 and Hbb channels are shown in grayscale and the merged image on the right shows colocalization of SMI32 (red fluorescence) and Hbb (green fluorescence). SMI32 and Hbb positive cells were counted in cortical tissue sections from five MS brains. We found that on average 33 % of SMI32+ cells were also immunoreactive for Hbb. In external layers of the cortex (layers I–III), 22 % of SMI32+ neurons were Hbb+. In cortical layers IV–VI, the internal cortical layers, 42 % of SMI32 neurons also expressed Hbb. c Hbb expression is observed in the nucleus but not in the nucleolus (denoted by arrows) in pyramidal cells. d Representative confocal image showing an MS cortical section immunostained with antibodies to TH (red fluorescence) and Hbb (green fluorescence). Arrows denote TH positive axons appearing to contact cell bodies of Hbb positive cells. Scale bar represents 30 μm

In addition to SMI32 and Hbb labeling, sections of MS and control brains were stained for tyrosine hydroxylase (TH) and Hbb (Fig. 1d). TH catalyzes the rate limiting step of the formation of catecholamines, which include the neurotransmitters dopamine, adrenaline, and noradrenaline. TH has also been localized within interneurons, and thus can be used as a histochemical marker for interneurons (Benavides-Piccione and DeFelipe 2007). These TH positive interneurons do not synthesize catecholamines, but appear to be GABAergic. An abundance of TH labeled neurons was found in the MS samples, each with morphologies consistent with interneurons. TH labeled neurons did not appear to contain Hbb; however, some TH labeled neurons were observed to form what appeared to be synapses to cells which did contain Hbb (Fig. 1d). TH labeled neurons appeared to contact the cell bodies of Hbb expressing neurons as opposed to dendrites, suggesting these TH expressing neurons are GABAergic inhibitory interneurons, as inhibitory synapses often target cell bodies instead of dendrites. Benavides-Piccione and DeFelipe (2007) state that the most common cell type targeted by interneurons are pyramidal cells.

We did not observe any significant changes in the numbers of neurons expressing Hbb in MS cortex compared to controls. To determine whether levels of Hbb protein were changed between MS and control brains, we performed Western blotting with mitochondrial and nuclear protein isolated from six MS and six control cortical gray matter samples as shown in Fig. 2. The relative purity of protein fractions was determined by Western blotting with antibodies to the mitochondrial membrane protein aralar and the neuronal nuclear marker NeuN. A representative Western blot demonstrating purity of fractionation is shown in Fig. 2a for a subset of samples. Consistent with our previous study, we found that mean Hbb levels were increased by 29 % in mitochondrial fractions isolated from MS cortical samples compared to controls (Broadwater et al. 2011) (Fig. 2b, d). We also measured levels of Hbb in nuclear fractions and found that Hbb levels were reduced on average by 38 % in MS nuclear fractions compared to controls (Fig. 2c, d).

Fig. 2.

Fig. 2

Open in a new tab

The subcellular localization of Hbb is altered in MS samples. a Representative Western blot demonstrating the purity of mitochondrial and nuclear fractions isolated from control and MS postmortem cortical gray matter. Nuclear (N) and mitochondrial (M) fractions isolated from control and MS samples were blotted with antibodies to the neuronal nuclear marker NeuN and the mitochondrial marker aralar. b Representative Western blots for Hbb and aralar in mitochondrial fractions isolated from MS cortical samples compared to controls. c Representative Western blots for Hbb and NeuN show decreased Hbb in MS nuclear fractions compared to controls. d Quantitation shows that average Hbb levels are increased in mitochondrial fractions and decreased in nuclear fractions isolated from MS cortical gray matter compared to controls. Error bars represent SEM. *p < 0.05

We then performed co-IP experiments with an antibody to Hbb and total cell extracts from motor cortex from an MS brain to identify proteins which interact with Hbb. Fifteen proteins including Hbb itself were identified by LC-MS/MS (p ≤ 0.05). Table 2 describes the proteins identified which coimmunoprecipitated with Hbb. All peptide sequences assigned are listed, with their respective observed and expected peptide masses and ion scores. The accession number for each protein is listed with their respective exponentially modified protein abundance index (emPAI), queries matched, and mass. The emPAI is a semi-quantitative estimate of the relative abundance of proteins in the sample. It is the number of peptides per protein normalized by the theoretical number of peptides. Proteins low in abundance will have low emPAI scores. Five of the Hbb interacting proteins identified in the postmortem sample were mitochondrial, including ATP synthase subunits alpha and beta (ATP5A1 and ATP5B), mitochondrial malate dehydrogenase (MDH2), ADP/ATP translocase 4 (SLC25A31), and a mitochondrial phosphate carrier (SLC25A3), suggesting that Hbb is associated with mitochondria. We also identified several histone proteins including histone H3 (HIST2H3A) and lysine-specific demethylase 8 (KDM8), which is a histone demethylase, suggesting that Hbb may be involved in regulating histone methylation. Western blotting confirmed that Hbb eluted after immunoprecipitation with the Hbb antibody as expected (Fig. 3) but Hbb did not elute after immunoprecipitation with a non-specific IgG antibody. Other Hbb interacting proteins identified by co-IP followed by LC-MS/MS including ATP5A1 and histone H3 were also confirmed by Western blot as shown in Fig. 3.

Table 2.

Proteins interacting with Hbb identified by co-IP followed by mass spectrometry

Protein
1 P62805 Mass, 11360 Score, 626 Matches, 30(30) Sequences, 6(6) emPAI, 7.38
Histone H4 Homo sapiens GN=HIST1H4A
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
6197 714.3464 713.3391 713.3385 39 0.00043 R.TLYGFGG.-
9328 495.2934 988.5722 988.5706 49 0.00011 K.VFLENVIR.D
10541 567.7756 1133.5366 1133.5353 44 0.00036 R.DAVTYTEHAK.R
10865 590.8145 1179.6144 1179.6135 61 8.7e–006 R.ISGLIYEETR.G
11693 663.3817 1324.7488 1324.7463 47 0.00015 R.DNIQGITKPAIR.R
11698 663.8536 1325.6926 1325.6901 50 9.1e–005 K.TVTAMDVVYALK.R
2 Q6FI13 Mass, 14087 Score, 535 Matches, 19(19) Sequences, 6(6) emPAI, 3.55
Histone H2A type 2-A Homo sapiens GN=HIST2H2AA3
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
7540 419.2148 836.4150 836.4140 27 0.018 R.KGNYAER.V
7851 425.7671 849.5196 849.5184 34 0.00064 R.HLQLAIR.N
8013 431.2011 860.3876 860.3875 22 0.037 R.NDEELNK.L
8951 472.7695 943.5244 943.5240 66 4.5e–006 R.AGLQFPVGR.V
13753 644.3956 1930.1650 1930.1615 68 1.9e–007 K.VTIAQGGVLPNIQAVLLPK.K
15856 983.8522 2948.5348 2948.5317 64 3.3e–006 R.VGAGAPVYMAAVLEYLTAEILELAGNAAR.D
3 P16104 Mass, 15135 Score, 379 Matches, 16(16) Sequences, 6(6) emPAI, 3.14
Histone H2A.x Homo sapiens GN=H2AFX
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
7851 425.7671 849.5196 849.5184 34 0.00064 R.HLQLAIR.N
8013 431.2011 860.3876 860.3875 22 0.037 R.NDEELNK.L
8463 449.2010 896.3874 896.3876 22 0.019 K.ATQASQEY.-
8951 472.7695 943.5244 943.5240 66 4.5e–006 R.AGLQFPVGR.V
14651 1136.1930 2270.3714 2270.3726 53 5.6e–006 K.LLGGVTIAQGGVLPNIQAVLLPK.K
15814 972.5350 2914.5832 2914.5804 75 1.3e–007 R.VGAGAPVYLAAVLEYLTAEILELAGNAAR.D
4 P68871 Mass, 15988 Score, 508 Matches, 17(17) Sequences, 7(7) emPAI, 2.84
Hemoglobin subunit beta Homo sapiens GN=HBB
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
8849 466.7641 931.5136 931.5127 29 0.016 K.SAVTALWGK.V
9039 476.7588 951.5030 951.5025 24 0.032 M.VHLTPEEK.S
10637 575.3421 1148.6696 1148.6666 40 0.00042 K.VVAGVANALAHK.Y
11403 637.8672 1273.7198 1273.7183 34 0.0028 R.LLVVYPWTQR.F
11629 657.8362 1313.6578 1313.6575 72 6e–007 K.VNVDEVGGEALGR.L
12030 689.8539 1377.6932 1377.6929 36 0.0034 K.EFTPPVQAAYQK.V
14036 1037.9760 2073.9374 2073.9354 92 5.2e–009 R.FFESFGDLSTPDAVMGNPK.V
5 Q5QNW6 Mass, 13912 Score, 496 Matches, 29(29) Sequences, 7(7) emPAI, 6.23
Histone H2B type 2-F Homo sapiens GN=HIST2H2BF
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
4201 585.2880 584.2807 584.2806 18 0.033 K.YTSSK.-
7272 408.7325 815.4504 815.4501 34 0.0055 R.EIQTAVR.L
7404 414.7150 827.4154 827.4137 38 0.00088 K.HAVSEGTK.A
9047 477.3063 952.5980 952.5957 20 0.026 R.LLLPGELAK.H
10795 390.2040 1167.5902 1167.5884 48 0.00016 K.QVHPDTGISSK.A
11347 633.3250 1264.6354 1264.6339 36 0.0029 R.KESYSVYVYK.V
13282 888.4092 1774.8038 1774.8018 (79) 1.1e–007 K.AMGIMNSFVNDIFER.I
6 Q71DI3 Mass, 15379 Score, 273 Matches, 16(16) Sequences, 3(3) emPAI, 1.22
Histone H3.2 Homo sapiens GN=HIST2H3A
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
6224 715.4102 714.4029 714.4024 32 0.0088 K.DIQLAR.R
7467 416.2508 830.4870 830.4861 64 4.9e–006 K.STELLIR.K
7833 850.4313 849.4240 849.4232 50 0.00012 R.EIAQDFK.T
7 P25705 Mass, 59714 Score, 185 Matches, 6(6) Sequences, 3(3) emPAI, 0.17
ATP synthase subunit alpha, mitochondrial Homo sapiens GN=ATP5A1
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
9641 513.8013 1025.5880 1025.5869 28 0.0095 K.AVDSLVPIGR.G
12779 788.3994 1574.7842 1574.7788 77 2.6e–007 R.ILGADTSVDLEETGR.V
12923 812.9507 1623.8868 1623.8832 50 8.8e–005 R.TGAIVDVPVGEELLGR.V
8 P40926 Mass, 35481 Score, 169 Matches, 2(2) Sequences, 1(1) emPAI, 0.09
Malate dehydrogenase, mitochondrial Homo sapiens GN=MDH2
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
13347 897.0498 1792.0850 1792.0822 97 2e–010 K.VAVLGASGGIGQPLSLLLK.N
9 P06576 Mass, 56525 Score, 101 Matches, 2(2) Sequences, 1(1) emPAI, 0.06
ATP synthase subunit beta, mitochondrial Homo sapiens GN=ATP5B
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
13877 994.5219 1987.0292 1987.0262 68 2.2e–006 R.AIAELGIYPAVDPLDSTSR.I
10 Q9H0C2 Mass, 34999 Score, 99 Matches, 3(3) Sequences, 2(2) emPAI, 0.20
ADP/ATP translocase 4 Homo sapiens GN=SLC25A31
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
7931 428.7490 855.4834 855.4814 24 0.017 K.TAVAPIER.V
12294 723.8759 1445.7372 1445.7343 60 1.6e–005 R.YFPTQALNFAFK.D
11 P10412 Mass, 21852 Score, 90 Matches, 7(7) Sequences, 3(3) emPAI, 0.53
Histone H1.4 Homo sapiens GN=HIST1H1E
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
7180 406.2014 810.3882 810.3872 25 0.02 K.GTGASGSFK.L
9215 487.3066 972.5986 972.5968 31 0.0036 R.SGVSLAALKK.A
10346 554.2881 1106.5616 1106.5608 45 0.0005 K.ALAAAGYDVEK.N
12 Q00325 Mass, 40069 Score, 47 Matches, 2(2) Sequences, 1(1) emPAI, 0.08
Phosphate carrier protein, mitochondrial Homo sapiens GN=SLC25A3
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
11909 681.3629 1360.7112 1360.7099 44 0.00063 R.IQTQPGYANTLR.D
13 P69905 Mass, 15248 Score, 41 Matches, 2(2) Sequences, 1(1) emPAI, 0.22
Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
12621 510.5836 1528.7290 1528.7270 33 0.0048 K.VGAHAGEYGAEALER.M
14 Q8N371 Mass, 47240 Score, 24 Matches, 2(2) Sequences, 1(1) emPAI, 0.07
Lysine-specific demethylase 8 Homo sapiens GN=KDM8
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
7597 421.7583 841.5020 841.5021 22 0.038 K.LEKTVPR.L
15 P0C0S8 Mass, 14083 Score, 92 Matches, 3(3) Sequences, 2(2) emPAI, 0.54
Histone H2A type 1 Homo sapiens GN=HIST1H2AG
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
9506 472.7698 943.5250 943.5240 39 0.0024 R.AGLQFPVGR.V
15653 972.5334 2914.5784 2914.5804 61 3.9e–006 R.VGAGAPVYLAAVLEYLTAEILELAGNAAR.D
16 Q5QNW6 mass, 13912 score, 34 matches, 3(3) sequences, 2(2) emPAI, 0.55
Histone H2B type 2-F Homo sapiens GN=HIST2H2BF
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
8107 408.7327 815.4508 815.4501 33 0.0074 R.EIQTAVR.L
9609 477.3055 952.5964 952.5957 18 0.025 R.LLLPGELAK.H
Open in a new tab

Fig. 3.

Fig. 3

Open in a new tab

Confirmation of proteins interacting with Hbb that were identified by mass spectrometry. Western blotting shows that Hbb, ATP5A1, and histone H3 were pulled down in the IP experiment with the Hbb antibody but not with the non-specific IgG antibody. Arrows denote bands for Hbb (16 kDa), ATP5A1 (55 kDa), and histone H3 (13 kDa) on separate blots. Because this protein was immunoprecipitated with an Hbb antibody, IgG heavy and light chains (IgG-H and IgG-L) are present at 50 and ~25 kDa

Because the protein isolated from the human postmortem cortical sample would contain protein not only from neurons but also from other cell types that express hemoglobin including red blood cells, vascular endothelial cells, and macrophages, we repeated the co-IP combined with LC-MS/MS with total protein isolated from cultured rat primary neurons. It has been reported previously that primary neurons express hemoglobin (Schelshorn et al. 2009). To confirm that our cultured neurons expressed hemoglobin, we first performed immunofluorescent staining with hemoglobin and neurofilament antibodies. Confocal images in Fig. 4 show that hemoglobin (Hb) and neurofilament (NF) are co-expressed in these cells. Neuron-specific hemoglobin interacting proteins identified by LC-MS/MS are shown in Table 3 and are consistent with those identified in the human postmortem cortical gray matter sample. Hemoglobin interacting proteins in rat primary neurons overlapped with many of the mitochondrial and nuclear proteins identified in the postmortem sample including Atp5a1, Atp5b, Mdh2, Slc25a3, and histones (Table 3). We also identified 2-oxoglutarate dehydrogenase in primary neurons which is of interest since many histone demethylases require 2-oxoglutarate as a cofactor (Gut and Verdin 2013; Salminen et al. 2014). These data provide further evidence that hemoglobin may be involved in mediating signals between mitochondria and the nucleus in neurons.

Fig. 4.

Fig. 4

Open in a new tab

Hemoglobin is expressed in cultured rat primary neurons. Cultured neuronal cells were immunostained with antibodies to hemoglobin (Hb) and neurofilament (NF). The merged image shows Hb (red fluorescence) and NF (green fluorescence) colocalization

Table 3.

Proteins interacting with hemoglobin in cultured primary neurons

Protein
1 P02091 Mass, 15969 Score, 4251 Matches, 126(126) Sequences, 14(14) emPAI, 121.67
Hemoglobin subunit beta-1 Rattus norvegicus GN=Hbb
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
5761 739.4104 738.4031 738.4024 28.51 0.0025 HLDNLK
8065 912.4783 911.471 911.4712 43.63 0.0001 VHLTDAEK
8111 458.2562 914.4978 914.4974 45.01 0.00012 AAVNGLWGK
9911 1090.589 1089.5817 1089.5818 53.78 2.30E–05 VINAFNDGLK
10208 561.8355 1121.6564 1121.6557 71.86 6.80E–08 VVAGVASALAHK
10248 563.786 1125.5574 1125.5567 28.79 0.005 LHVDPENFR
10938 609.8459 1217.6772 1217.6768 72.89 2.20E–07 KVINAFNDGLK
11335 637.8666 1273.7186 1273.7183 51.57 1.90E–05 LLVVYPWTQR
11482 649.8201 1297.6256 1297.6263 75.84 8.30E–08 VNPDDVGGEALGR
12152 699.33 1396.6454 1396.6445 58.4 4.10E–06 EFTPCAQAAFQK
12274 711.897 1421.7794 1421.7779 63.1 1.60E–06 VVAGVASALAHKYH
12695 505.5738 1513.6996 1513.6984 27.73 0.0054 GTFAHLSELHCDK
13339 572.0121 1713.0145 1713.0124 39.19 0.00012 LLGNMIVIVLGHHLGK
14257 1011.959 2021.9034 2021.9041 109.26 2.30E–11 YFDSFGDLSSASAIMGNPK
2 P11517 Mass, 15972 Score, 2095 Matches 85(85) Sequences, 13(13) emPAI, 67.88
Hemoglobin subunit beta-2 Rattus norvegicus GN = Hbb2
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
5761 739.4104 738.4031 738.4024 28.51 0.0025 HLDNLK
8065 912.4783 911.471 911.4712 43.63 0.0001 VHLTDAEK
8155 459.7562 917.4978 917.4971 41.46 0.00029 ATVSGLWGK
9911 1090.589 1089.5817 1089.5818 53.78 2.30E–05 VINAFNDGLK
10208 561.8355 1121.6564 1121.6557 71.86 6.80E–08 VVAGVASALAHK
10248 563.786 1125.5574 1125.5567 28.79 0.005 LHVDPENFR
10938 609.8459 1217.6772 1217.6768 72.89 2.20E–07 KVINAFNDGLK
11335 637.8666 1273.7186 1273.7183 51.57 1.90E–05 LLVVYPWTQR
12152 699.33 1396.6454 1396.6445 58.4 4.10E–06 EFTPCAQAAFQK
12274 711.897 1421.7794 1421.7779 63.1 1.60E–06 VVAGVASALAHKYH
12695 505.5738 1513.6996 1513.6984 27.73 0.0054 GTFAHLSELHCDK
13339 572.0121 1713.0145 1713.0124 39.19 0.00012 LLGNMIVIVLGHHLGK
13377 861.4307 1720.8468 1720.8454 93.58 1.80E–09 FGDLSSASAIMGNPQVK
3 P01946 Mass, 15319 Score, 1878 Matches, 90(90) Sequences, 12(12) emPAI, 43.93
Hemoglobin subunit alpha-1/2 Rattus norvegicus GN=Hba1
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
4787 664.287 663.2797 663.2799 32.22 0.0006 NCWGK
5884 747.3885 746.3812 746.381 33.47 0.0018 VLSADDK
6652 408.2531 814.4916 814.4912 42.8 0.00015 KVADALAK
6708 818.4412 817.4339 817.4334 24.04 0.028 VDPVNFK
9269 515.2577 1028.5008 1028.5001 45.21 6.30E–05 MFAAFPTTK
9852 544.3166 1086.6186 1086.6186 37.59 0.00065 LRVDPVNFK
10821 602.3326 1202.6506 1202.6507 65.56 1.20E–06 VLSADDKTNIK
11189 626.8617 1251.7088 1251.7075 89.05 2.80E–09 FLASVSTVLTSK
12934 786.8738 1571.733 1571.7328 62.23 1.50E–06 IGGHGGEYGEEALQR
13410 868.4362 1734.8578 1734.8577 68.85 7.30E–07 TYFSHIDVSPGSAQVK
15156 575.0444 2296.1485 2296.1448 46.15 0.00013 AADHVEDLPGALSTLSDLHAHK
4 Q00715 Mass, 13982 Score, 1255 Matches, 51(51) Sequences, 7(7) emPAI, 16.05
Histone H2B type 1 Rattus norvegicus
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
4797 664.3625 663.3552 663.3551 18.43 0.045 STITSR
6686 408.733 815.4514 815.4501 34.7 0.0016 EIQTAVR
6842 414.7141 827.4136 827.4137 42.55 9.70E–05 HAVSEGTK
8548 477.3055 952.5964 952.5957 38.11 0.00015 LLLPGELAK
10592 390.2036 1167.589 1167.5884 43.65 0.00016 QVHPDTGISSK
11281 633.3248 1264.635 1264.6339 29.56 0.0053 KESYSVYVYK
13451 872.414 1742.8134 1742.812 97.35 5.60E–10 AMGIMNSFVNDIFER
5 P62804 Mass, 11360 Score, 1181 Matches, 45(45) Sequences, 7(7) emPAI, 9.93
Histone H4 Rattus norvegicus GN = Hist1h4b
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
5547 714.3456 713.3383 713.3385 41.44 8.30E–05 TLYGFGG
8883 495.2927 988.5708 988.5706 45.7 7.70E–05 VFLENVIR
10315 567.7753 1133.536 1133.5353 37.2 0.00065 DAVTYTEHAK
10681 590.8146 1179.6146 1179.6135 78.4 5.60E–08 ISGLIYEETR
11608 655.8549 1309.6952 1309.6952 62.61 1.80E–06 TVTAMDVVYALK
11721 663.3807 1324.7468 1324.7463 43.17 9.60E–05 DNIQGITKPAIR
11734 663.8532 1325.6918 1325.6901 62.95 1.60E–06 TVTAMDVVYALK
12498 489.6064 1465.7974 1465.7963 19.35 0.037 TVTAMDVVYALKR
6 P15865 Mass, 21974 Score, 926 Matches, 52(52) Sequences, 7(7) emPAI, 2.59
Histone H1.4 Rattus norvegicus GN=Hist1h1e
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
6256 392.7374 783.4602 783.4603 37.95 0.00016 KPAAAAGAK
7669 437.7536 873.4926 873.492 38.94 0.00059 KATGTATPK
8763 487.3064 972.5982 972.5968 19.54 0.019 SGVSLAALKK
10082 554.2875 1106.5604 1106.5608 56.04 9.00E–06 ALAAAGYDVEK
10792 599.838 1197.6614 1197.6605 58.95 4.80E–06 ASGPPVSELITK
11737 442.9258 1325.7556 1325.7554 32.4 0.0016 KASGPPVSELITK
7 P0C169 Mass, 14097 Score, 718 Matches, 23(23) Sequences, 5(5) emPAI, 3.55
Histone H2A type 1-C Rattus norvegicus
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
1567 425.7671 849.5196 849.5184 23.42 0.0045 HLQLAIR
1733 431.2012 860.3878 860.3875 20.32 0.014 NDEELNK
3261 472.7701 943.5256 943.524 67.07 1.20E–06 AGLQFPVGR
18687 966.0891 1930.1636 1930.1615 78.59 1.40E–08 VTIAQGGVLPNIQAVLLPK
25442 972.5353 2914.5841 2914.5804 74.31 8.20E–08 VGAGAPVYLAAVLEYLTAEILELAGNAAR
8 P0CC09 Mass, 14087 Score, 671 Matches, 22(22) Sequences, 5(5) emPAI, 3.55
Histone H2A type 2-A Rattus norvegicus GN=Hist2h2aa3
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
1567 425.7671 849.5196 849.5184 23.42 0.0045 HLQLAIR
1733 431.2012 860.3878 860.3875 20.32 0.014 NDEELNK
3261 472.7701 943.5256 943.524 67.07 1.20E–06 AGLQFPVGR
18687 966.0891 1930.1636 1930.1615 78.59 1.40E–08 VTIAQGGVLPNIQAVLLPK
25613 983.8522 2948.5348 2948.5317 86.85 6.90E–09 VGAGAPVYMAAVLEYLTAEILELAGNAAR
9 P04797 Mass, 35805 Score, 501 Matches, 10(10) Sequences, 3(3) emPAI, 0.3
Glyceraldehyde-3-phosphate dehydrogenase Rattus norvegicus GN=Gapdh
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
10287 685.3768 1368.739 1368.7361 72.08 2.00E–07 GAAQNIIPASTGAAK
11027 778.9102 1555.8058 1555.8029 100.14 3.50E–10 VPTPNVSVVDLTCR
12207 910.4582 1818.9018 1818.8968 59.72 5.70E–06 IVSNASCTTNCLAPLAK
10 Q00729 Mass, 14216 Score, 482 Matches, 39(39) Sequences, 5(5) emPAI, 5.92
Histone H2B type 1-A Rattus norvegicus GN=Hist1h2ba
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
4797 664.3625 663.3552 663.3551 18.43 0.045 STITSR
6686 408.733 815.4514 815.4501 34.7 0.0016 EIQTAVR
6842 414.7141 827.4136 827.4137 42.55 9.70E–05 HAVSEGTK
8548 477.3055 952.5964 952.5957 38.11 0.00015 LLLPGELAK
10592 390.2036 1167.589 1167.5884 43.65 0.00016 QVHPDTGISSK
11 Q06647 Mass, 23383 Score, 446 Matches, 21(21) Sequences, 8(8) emPAI, 2.8
ATP synthase subunit O, mitochondrial Rattus norvegicus GN=Atp5o
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
9061 504.7904 1007.5662 1007.5651 22.49 0.0096 TVLNSFLSK
10374 573.2957 1144.5768 1144.5764 24.79 0.014 YATALYSAASK
10909 608.8688 1215.723 1215.7227 62.75 9.30E–07 VSLAVLNPYIK
11586 654.8181 1307.6216 1307.6214 26.26 0.0084 TDPSIMGGMIVR
12974 528.3076 1581.901 1581.8991 37.98 0.00029 LVRPPVQVYGIEGR
13903 938.9837 1875.9528 1875.9512 50.08 4.90E–05 FSPLTANLMNLLAENGR
14291 678.6865 2033.0377 2033.0364 35.54 0.0015 LGNTQGVISAFSTIMSVHR
15335 1188.604 2375.1934 2375.193 64.91 1.60E–06 GEVPCTVTTAFPLDEAVLSELK
12 P15999 Mass, 59717 Score, 358 Matches, 12(12) Sequences, 5(5) emPAI, 0.38
ATP synthase subunit alpha, mitochondrial Rattus norvegicus GN=Atp5a1
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
5733 423.2588 844.503 844.5018 38.23 0.00071 STVAQLVK
6124 439.217 876.4194 876.4189 31.77 0.0027 ISEQSDAK
8969 586.3209 1170.6272 1170.6245 51.74 2.50E–05 VVDALGNAIDGK
10146 668.8441 1335.6736 1335.6711 44.06 0.00019 EIVTNFLAGFEP
11081 788.3985 1574.7824 1574.7788 75.59 1.10E–07 ILGADTSVDLEETGR
13 Q6LED0 Mass, 15394 Score, 338 Matches, 23(23) Sequences, 4(4) emPAI, 2.3
Histone H3.1 Rattus norvegicus
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
5576 715.4102 714.4029 714.4024 34.16 0.0016 DIQLAR
6889 416.2504 830.4862 830.4861 50.19 4.10E–05 STELLIR
7256 850.431 849.4237 849.4232 49.8 3.90E–05 EIAQDFK
9295 516.8012 1031.5878 1031.5876 21.29 0.023 YRPGTVALR
14 P63039 Mass, 60917 Score, 288 Matches, 7(7) Sequences, 4(4) emPAI, 0.3
60 kDa heat shock protein, mitochondrial Rattus norvegicus GN=Hspd1
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
8933 617.3018 1232.589 1232.5885 51.45 2.80E–05 VGGTSDVEVNEK
20403 715.7147 2144.1223 2144.1221 56.51 8.50E–06 ALMLQGVDLLADAVAVTMGPK
22880 818.796 2453.3662 2453.3629 60.62 1.40E–06 TALLDAAGVASLLTTAEAVVTEIPK
25108 947.5204 2839.5394 2839.543 62.63 9.30E–07 TALLDAAGVASLLTTAEAVVTEIPKEEK
15 P0C0S7 Mass, 13545 Score, 272 Matches, 13(13) Sequences, 3(3) emPAI, 0.96
Histone H2A.Z Rattus norvegicus GN=H2afz
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
7274 425.767 849.5194 849.5184 29.45 0.0011 HLQLAIR
8476 472.7698 943.525 943.524 59.27 7.80E–06 AGLQFPVGR
10178 559.7829 1117.5512 1117.5503 41.73 0.00033 GDEELDSLIK
16 Q09073 Mass, 32880 Score, 164 Matches, 6(6) Sequences, 3(3) emPAI, 0.33
ADP/ATP translocase 2 Rattus norvegicus GN=Slc25a5
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
7335 428.7483 855.482 855.4814 35.07 0.0005 TAVAPIER
10954 610.3386 1218.6626 1218.6608 43.09 0.00017 DFLAGGVAAAISK
12409 723.8749 1445.7352 1445.7343 63.47 2.20E–06 YFPTQALNFAFK
17 P04636 Mass, 35661 Score, 161 Matches, 3(3) Sequences, 2(2) emPAI, 0.19
Malate dehydrogenase, mitochondrial Rattus norvegicus GN=Mdh2
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
5833 537.2957 1072.5768 1072.5764 28.28 0.007 IQEAGTEVVK
16994 897.0486 1792.0826 1792.0822 93.25 4.70E–10 VAVLGASGGIGQPLSLLLK
18 P10719 Mass, 56318 Score, 119 Matches, 3(3) Sequences, 3(3) emPAI, 0.12
ATP synthase subunit beta, mitochondrial Rattus norvegicus GN = Atp5b
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
12349 718.3795 1434.7444 1434.7467 55.6 1.50E–05 FTQAGSEVSALLGR
14162 994.5206 1987.0266 1987.0262 59.15 5.00E–06 AIAELGIYPAVDPLDSTSR
8952 499.2514 996.4882 996.4876 35.02 0.00077 LSYNTASNK
19 Q3KR86 Mass, 67135 Score, 82 Matches, 3(3) Sequences, 3(3) emPAI, 0.15
Mitochondrial inner membrane protein (Fragment) Rattus norvegicus GN=Immt
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
702 404.714 807.4134 807.4127 27.88 0.0064 AFDSAVAK
5879 538.2546 1074.4946 1074.4941 33.7 0.00083 SEIQAEQDR
8883 616.2936 1230.5726 1230.5728 52.8 1.20E–05 YSTSSSSGVTAGK
20 P19527 Mass, 61298 Score, 74 Matches, 6(6) Sequences, 4(4) emPAI, 0.23
Neurofilament light polypeptide Rattus norvegicus GN=Nefl
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
1996 437.2246 872.4346 872.4352 28.26 0.0043 GADEAALAR
4401 501.759 1001.5034 1001.5029 34.67 0.0012 QLQELEDK
5557 531.2589 1060.5032 1060.5036 30.6 0.0033 LAAEDATNEK
6814 561.2956 1120.5766 1120.5764 22.84 0.025 EYQDLLNVK
21 P16036 Mass: 39419 Score:70 Matches: 2(2) Sequences: 1(1) emPAI, 0.08
Phosphate carrier protein, mitochondrial Rattus norvegicus GN = Slc25a3
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
5301 523.7833 1045.552 1045.5516 42.38 0.00031 GSTASQVLQR
5302 523.7834 1045.5522 1045.5516 47.53 9.20E–05 GSTASQVLQR
22 P48721 Mass, 73812 Score, 59 Matches, 2(2) Sequences, 2(2) emPAI, 0.09
Stress-70 protein, mitochondrial Rattus norvegicus GN = Hspa9
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
4786 510.7329 1019.4512 1019.452 31.29 0.0014 DSETGENIR
8885 616.3359 1230.6572 1230.6568 45.12 0.00015 QAASSLQQASLK
23 D3ZAF6 Mass, 10446 Score, 58 Matches, 2(2) Sequences, 1(1) emPAI, 0.33
ATP synthase subunit f, mitochondrial Rattus norvegicus GN=Atp5j2
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
11091 619.8123 1237.61 1237.6091 35.17 0.0011 DFTPSGIAGAFR
24 P12839 Mass, 95734 Score, 50 Matches, 5(5) Sequences, 3(3) emPAI, 0.11
Neurofilament medium polypeptide Rattus norvegicus GN=Nefm
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
1541 424.7401 847.4656 847.4651 34.19 0.0021 TDISTALK
6814 561.2956 1120.5766 1120.5764 22.84 0.025 EYQDLLNVK
11986 469.209 1404.6052 1404.6045 20.82 0.014 VEEHEETFEEK
25 Q5XI78 Mass, 116221 Score, 50 Matches, 2(2) Sequences, 1(1) emPAI, 0.03
2-oxoglutarate dehydrogenase, mitochondrial Rattus norvegicus GN=Ogdh
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
15230 830.4722 1658.9298 1658.9283 39.81 0.00024 IEQLSPFPFDLLLK
26 Q9ER34 Mass, 85380 Score, 50 Matches, 3(3) Sequences, 2(2) emPAI, 0.08
Aconitate hydratase, mitochondrial Rattus norvegicus GN=Aco2
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
4084 494.7566 987.4986 987.4985 33.57 0.0018 VDVSPTSQR
5713 534.2777 1066.5408 1066.5407 22.74 0.014 NTIVTSYNR
27 D3ZBN0 Mass, 22635 Score, 43 Matches, 3(3) Sequences, 2(2) emPAI, 0.32
Histone H1.5 Rattus norvegicus GN=Hist1h1b
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
8274 547.2804 1092.5462 1092.5451 28.01 0.0055 ALAAGGYDVEK
9390 606.8467 1211.6788 1211.6761 24.64 0.0077 ATGPPVSELITK
28 P17764 Mass, 44666 Score, 42 Matches, 2(2) Sequences, 1(1) emPAI, 0.07
Acetyl-CoA acetyltransferase, mitochondrial Rattus norvegicus GN=Acat1
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
13965 815.1015 2442.2827 2442.2835 30.5 0.0028 IAAFADAAVDPIDFPLAPAYAVPK
29 Q63617 Mass, 111220 Score, 42 Matches, 3(3) Sequences, 2(2) emPAI, 0.06
Hypoxia up-regulated protein 1 Rattus norvegicus GN=Hyou1
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
5477 529.2618 1056.509 1056.5087 25 0.0062 EVEEEPGLR
13694 768.4272 1534.8398 1534.8395 27.72 0.0053 DAVIYPILVEFTR
30 Q05962 Mass, 32968 Score, 33 Matches, 2(2) Sequences, 1(1) emPAI, 0.1
ADP/ATP translocase 1 Rattus norvegicus GN=Slc25a4
Query Observed Mr(expt) Mr(calc) Score Expect Peptide
1634 428.7482 855.4818 855.4814 26.28 0.0038 TAVAPIER
Open in a new tab

To test whether Hbb could be regulating histone methylation, we transfected human SH-SY5Y neuroblastoma cells, which do not express endogenous Hbb, with either the empty expression vector (pVitro2) or expression vector driving Hbb expression (pVitro2-Hbb) and measured histone H3 methylation. After 48 h, cytoplasmic and nuclear extracts were isolated. Western blotting was performed with cytoplasmic protein and an antibody to Hbb to show that Hbb was being expressed from the pVitro2-Hbb expression construct in the neuroblastoma cells after transfection (Fig. 5a). We then performed Western blotting with nuclear extracts and an antibody to H3K4me3 and found that levels of this methylated histone were increased by almost twofold in pVitro2-Hbb transfected cells after normalization to histone H3 levels (Fig. 5b, c).

Fig. 5.

Fig. 5

Open in a new tab

Hbb expression regulates histone H3 trimethylation. a Western blotting shows that the Hbb subunit is expressed in SH-SY5Y cells transfected with pVitro2-Hbb. b Representative Western blot demonstrates that levels of H3K4me3 are increased in nuclear extracts isolated from SH-SY5Y cells transfected with pVitro2-Hbb compared to control cells transfected with vector alone. c Quantitation for H3K4me3 levels in SH-SY5Y cells transfected with either empty vector pVitro2 or pVitro2-Hbb was performed by densitometry from two separate experiments. Error bars represent SEM, *p < 0.05

Discussion

The presence of hemoglobin mRNA and protein within neuronal cells of the rodent and human CNS has been confirmed in several studies (Richter et al. 2009; Biagoli et al. 2009; Schelshorn et al. 2009; Broadwater et al. 2011), but the function of hemoglobin in cortical neurons is still not clear. Hemoglobin may serve a direct role in delivering oxygen to mitochondria in neurons. The association of hemoglobin with mitochondria is consistent with such a role (Shephard et al. 2014). However, hemoglobin may also have other functions in neurons. In order to better understand the role of hemoglobin in the CNS and its relevance to MS pathology, we first examined the cortical distribution of Hbb and its expression relative to the neuronal marker SMI32 in postmortem MS cortical tissue. The cerebral cortex can be subdivided anatomically into six layers based on the types of neurons within each layer and organization of their projections. Layer I contains almost no neurons. Cortical layers II and III contain neurons which form intracortical connections, projecting to other cortical neurons either in the same hemisphere or to the opposite hemisphere through the corpus callosum. Layer IV receives input from the thalamus, and neurons in layers V and VI project for the most part to subcortical regions including the spinal cord (DeFelipe and Farinas 1992). We found that the majority of neurons that contained Hbb and SMI32 appeared to be pyramidal neurons. Pyramidal neurons are glutamatergic and can be identified by their large size, apical dendrites, long axons, and pyramidal shape. They are generally found in cortical layers III and V but are also occasionally located in others layers. Hbb immunoreactivity in these cells was strongest in the cell body but weak staining also appeared in the nucleus and was absent in the nucleolus. These data are consistent with the study by Richter et al. 2009 which found hemoglobin immunoreactivity in cortical pyramidal neurons in rodent and human brains and the Biagoli et al. (2009) study which also reported hemoglobin expression in the cytoplasm and nucleus, but not in the nucleolus, in dopaminergic neurons.

Nonpyramidal cells are generally short axon cells which reside in middle layers of the cortex and are often inhibitory, signaling through GABAergic neurotransmission. Many of these interneurons synthesize TH. In contrast to a study by Biagoli et al. (2009), who found hemoglobin expression in TH containing neurons in the substantia nigra, we did not find any colocalization of TH and Hbb, but we did find that TH labeled neurons appeared to synapse to the soma of Hbb containing cells. This observation was consistent with the fact that TH labeled interneurons have been shown to preferentially synapse with pyramidal cells (Benevides-Piccione and DeFelipe 2007). The discrepancy between our study and the Biagoli et al. (2009) study is most likely due to the brain regions analyzed. We analyzed TH and Hbb colocalization in interneurons in the cortex while the Biagoli study analyzed deeper structures including mesencephalic dopaminergic neurons.

The significance of the increased distribution of Hbb expressing pyramidal neurons in internal cortical layers is not clear, but it may be a result of the large size and axonal projections of these cells. Neurons with longer projections require increased ATP to maintain ion homeostasis and conduction of nerve impulses over long distances. Our data show that Hbb overexpression in SH-SY5Y neuroblastoma cells increased H3K4me3, a histone mark that is present in actively transcribed regions of chromatin and regulates expression of oxidative phosphorylation genes (Singhal et al. 2015). A role for hemoglobin in mitochondrial respiration is supported by a study by Biagoli et al. (2009) which suggested that alterations in hemoglobin expression affect cellular energetics, since dopaminergic cell lines over expressing α- and β-globin subunits exhibited changes in oxygen homeostasis and alterations in the expression of mitochondrial genes. One explanation for the enrichment of Hbb expression in projection neurons in deeper cortical layers could be to maintain an adequate supply of ATP by upregulating H3K4me3 and expression of genes necessary for oxidative phosphorylation.

Our data suggest that changes in Hbb subcellular localization may contribute to MS pathology by exacerbating the effects of demyelination on neuronal energetics. Pyramidal cells in deeper cortical layers (layers V and VI) project to subcortical regions including the thalamus and spinal cord. As a result of the longer distances these axons traverse, they are more likely to be exposed to inflammatory insults and demyelination. Axons that are demyelinated redistribute sodium channels in order to maintain conductivity (England et al. 1991; Waxman 2006). As a result, these neurons require additional ATP in order to maintain ion homeostasis and neurotransmission. In addition to metabolic stress induced by demyelination, neurons are further compromised in MS by a dysregulation of mitochondrial genes and impaired energetics. Mitochondrial abnormalities including decreased expression of nuclear encoded electron transport chain subunit genes, the neuronal mitochondrial metabolite N-acetylaspartate, and the mitochondrial biogenesis factor PPARGC1a have been reported in cortical neurons in MS in studies analyzing postmortem tissue even in areas with no overt pathology (Witte et al. 2013; Li et al. 2013). Indications of metabolic changes and a dysfunction of mitochondrial respiration in MS cortical gray matter have also been observed in vivo in magnetic resonance spectroscopy studies (Ge et al. 2004; Cader et al. 2007). Our data suggest that there is a change in Hbb subcellular localization in MS, with increased Hbb in mitochondria and decreased Hbb in the nucleus. A dysregulation of Hbb transport into the nucleus in pyramidal neurons in MS may lead to a reduction in H3K4me3 and decreased expression of genes involved in mitochondrial respiration. This mechanism may contribute to the previously reported reductions in H3K4me3 and decreased expression of mitochondrial respiratory complexes in MS cortical neurons (Singhal et al. 2015; Dutta et al. 2006). Depletion of nuclear Hbb in MS may lead to an inability for neurons to meet the increased demands for energy as a result of demyelination.

It is not clear how Hbb is regulating methylation of H3K4me3 but it is known that histone H3 demethylases are dioxygenases that can be regulated by mitochondrial metabolites (Salminen et al. 2014; Gut and Verdin 2013). These dioxygenases catalyze the oxidation of carbon-hydrogen bonds and require O2 (Vissers et al. 2014). Since one of the main functions of hemoglobin is to bind O2, it may regulate histone H3 methylation by sequestering oxygen from histone demethylases, preventing the dioxygenase reaction and histone demethylation. We found that overexpressing Hbb alone increased H3K4me3 suggesting that although in erythrocytes the α- and β subunits function as a heterotetramer, these genes may have evolved separate functions and may act independent from one another in some cells. This idea is consistent with data showing that only Hba is expressed in vascular endothelial cells where it participates in a dioxygenase reaction which regulates NO release independent of Hbb (Straub et al. 2012). Hbb can also form a tetramer (HbH) which has a higher binding affinity for O2 than the α2β2 heterotetramer (Bellelli et al. 2006). Similarly, Hbb may act independently from Hba in cortical pyramidal cells and may provide a mechanism to regulate histone demethylation, chromatin conformation, and gene expression in response to changes in cellular metabolism and O2 consumption.

We have found that Hbb is expressed in cortical pyramidal neurons and is enriched in internal cortical layers in MS. We have also found that Hbb interacts with subunits of ATP synthase, an ADP/ATP translocase, histones, and a histone lysine demethylase. Overexpression of Hbb in SH-SY5Y cells increased levels of trimethylated histone H3. Taken together these data suggest that Hbb may be a part of a mechanism linking mitochondrial energetics with epigenetic changes to histones and gene expression changes in the nucleus.

Acknowledgments

We would like to thank the Rocky Mountain MS Center which is funded by the National Multiple Sclerosis Society and the Brain and Spinal Cord Resource Center at UCLA for tissue. This research was partially funded by NIH Grant R21NS075645 (JM and EF) and from funds from the College of Arts and Sciences at Kent State University (JM).

References

  1. Bellelli A, Brunori M, Miele AE, Panetta G, Vallone B. The allosteric properties of hemoglobin: insights from natural and site directed mutants. Curr Protein Pept Sci. 2006;7:17–45. doi: 10.2174/138920306775474121. [DOI] [PubMed] [Google Scholar]
  2. Benavides-Piccione R, DeFelipe J. Distribution of neurons expressing tyrosine hydroxylase in the human cerebral cortex. J Anat. 2007;211(2):212–22. doi: 10.1111/j.1469-7580.2007.00760.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Biagioli M, Pinto M, Cesselli D, Zaninello M, Lazarevic D, Roncaglia P, Simone R, Vlachouli C, Plessy C, Bertin N, Beltrami A, Kobayashi K, Gallo V, Santoro C, Ferrer I, Rivella S, Beltrami CA, Carninci P, Raviola E, Gustincich S. Unexpected expression of α- and β-globin in mesencephalic dopaminergic neurons and glial cells. Proc Natl Acad Sci U S A. 2009;106:15454–15459. doi: 10.1073/pnas.0813216106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bjartmar C, Kidd G, Mörk S, Rudick R, Trapp BD. Neurological disability correlates with spinal cord axonal loss and reduced N-acetyl-aspartate in chronic multiple sclerosis patients. Ann Neurol. 2000;48:893–901. [PubMed] [Google Scholar]
  5. Bö L, Geurts JJ, Mörk SJ, van der Valk P. Grey matter pathology in multiple sclerosis. Acta Neurol Scand Suppl. 2006;183:48–50. doi: 10.1111/j.1600-0404.2006.00615.x. [DOI] [PubMed] [Google Scholar]
  6. Broadwater L, Pandit A, Azzam S, Clements R, Vadnal J, Yong VW, Freeman EJ, Gregory RB, McDonough J. Analysis of the mitochondrial proteome in multiple sclerosis cortex. Biochim Biophys Acta. 2011;1812:630–641. doi: 10.1016/j.bbadis.2011.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cader S, Johansen-Berg H, Wylezinska M, Palace J, Behrens TE, Smith S, Matthews PM. Discordant white matter N-acetylasparate and diffusion MRI measures suggest that chronic metabolic dys-function contributes to axonal pathology in multiple sclerosis. Neuroimage. 2007;36(1):19–27. doi: 10.1016/j.neuroimage.2007.02.036. [DOI] [PubMed] [Google Scholar]
  8. DeFelipe J, Farinas I. The pyramidal neuron of the cerebral cortex: morphological and chemical characteristics of the synaptic inputs. Prog Neurobiol. 1992;39(6):563–607. doi: 10.1016/0301-0082(92)90015-7. [DOI] [PubMed] [Google Scholar]
  9. De Stefano N, Narayanan S, Francis GS, Arnaoutelis R, Tartaglia MC, Antel JP, Matthews PM, Arnold DL. Evidence of axonal damage in the early stages of multiple sclerosis and its relevance to disability. Arch Neurol. 2001;58(1):65–70. doi: 10.1001/archneur.58.1.65. [DOI] [PubMed] [Google Scholar]
  10. Dutta R, McDonough J, Yin X, Peterson J, Chang A, Torres T, Gudz T, Macklin WB, Lewis DA, Fox RJ, Rudick R, Mirnics K, Trapp BD. Mitochondrial dysfunction as a cause of axonal degeneration in multiple sclerosis patients. Ann Neurol. 2006;59:478–489. doi: 10.1002/ana.20736. [DOI] [PubMed] [Google Scholar]
  11. England JD, Gamboni F, Levinson SR. Increased numbers of sodium channels form along demyelinated axons. Brain Res. 1991;548(1-2):334–7. doi: 10.1016/0006-8993(91)91144-p. [DOI] [PubMed] [Google Scholar]
  12. Fisher E, Lee JC, Nakamura K, Rudick RA. Gray matter atrophy in multiple sclerosis: a longitudinal study. Ann Neurol. 2008;64(3):255–65. doi: 10.1002/ana.21436. [DOI] [PubMed] [Google Scholar]
  13. Ge Y, Gonen O, Inglese M, Babb JS, Markowitz CE, Grossman RI. Neuronal cell injury precedes brain atrophy in multiple sclerosis. Neurology. 2004;62(4):624–7. doi: 10.1212/wnl.62.4.624. [DOI] [PubMed] [Google Scholar]
  14. Gut P, Verdin E. The nexus of chromatin regulation and intermediary metabolism. Nature. 2013;502(7472):489–98. doi: 10.1038/nature12752. doi:10.1038/nature12752, Review. [DOI] [PubMed] [Google Scholar]
  15. Inglese M, Ge Y, Filippi M, Falini A, Grossman RI, Gonen O. Indirect evidence for early widespread gray matter involvement in relapsing-remitting multiple sclerosis. Neuroimage. 2004;21:1825–1829. doi: 10.1016/j.neuroimage.2003.12.008. [DOI] [PubMed] [Google Scholar]
  16. Li S, Clements R, Sulak M, Gregory R, Freeman E, McDonough J. Decreased NAA in gray matter is correlated with decreased availability of acetate in white matter in postmortem multiple sclerosis cortex. Neurochem Res. 2013;38(11):2385–96. doi: 10.1007/s11064-013-1151-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Liu L, Zeng M, Stamler JS. Hemoglobin induction in mouse macrophages. Proc Natl Acad Sci U S A. 1999;96(12):6643–7. doi: 10.1073/pnas.96.12.6643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Nishi H, Inagi R, Kato H, Tanemoto M, Kojima I, Son D, Fujita T, Nangaku M. Hemoglobin is expressed by mesangial cells and reduces oxidant stress. J Am Soc Nephrol. 2008;19(8):1500–8. doi: 10.1681/ASN.2007101085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Noseworthy JH, Lucchinetti C, Rodriguez M, Weinshenker BG. Multiple sclerosis. N Engl J Med. 2000;343(13):938–52. doi: 10.1056/NEJM200009283431307. [DOI] [PubMed] [Google Scholar]
  20. Pallotti F, Lenaz G. Isolation and subfractionation of mitochondria from animal cells and tissue culture lines. Methods Cell Biol. 2007;80:3–44. doi: 10.1016/S0091-679X(06)80001-4. [DOI] [PubMed] [Google Scholar]
  21. Pandit A, Vadnal J, Houston S, Freeman E, McDonough J. Impaired regulation of electron transport chain subunit genes by nuclear respiratory factor 2 in multiple sclerosis. J Neurol Sci. 2009;279:14–20. doi: 10.1016/j.jns.2009.01.009. [DOI] [PubMed] [Google Scholar]
  22. Rahaman MM, Straub AC. The emerging roles of somatic globins in cardiovascular redox biology and beyond. Redox Biol. 2013;1:405–10. doi: 10.1016/j.redox.2013.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Rasband WS. ImageJ, U. S. National institutes of health. Bethesda, Maryland, USA: 1997-2014. http://imagej.nih.gov/ij/ [Google Scholar]
  24. Reeder BJ. The redox activity of hemoglobins: from physiologic functions to pathologic mechanisms. Antioxid Redox Signal. 2010;13(7):1087–123. doi: 10.1089/ars.2009.2974. doi:10.1089/ars.2009.2974. [DOI] [PubMed] [Google Scholar]
  25. Richter F, Meurers BH, Zhu C, Medvedeva VP, Chesselet M-F. Neurons express hemoglobin α- and β-chains in rat and human brains. J Comp Neurol. 2009;515:538–547. doi: 10.1002/cne.22062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Salminen A, Kauppinen A, Hiltunen M, Kaarniranta K. Krebs cycle intermediates regulate DNA and histone methylation: epigenetic impact on the aging process. Ageing Res Rev. 2014;16:45–65. doi: 10.1016/j.arr.2014.05.004. [DOI] [PubMed] [Google Scholar]
  27. Schelshorn DW, Schneider K, Weber AW, Kruger D, Dittgen C, Burgers HF, Sabouri F, Gassler N, Bach A, Martin H, Maurer MH. Expression of hemoglobin in rodent neurons. J Cerebr Blood Flow Metab. 2009;29:585–595. doi: 10.1038/jcbfm.2008.152. [DOI] [PubMed] [Google Scholar]
  28. Shephard F, Greville-Heygate O, Marsh O, Anderson S, Chakrabarti L. A mitochondrial location for haemoglobins—dynamic distribution in ageing and Parkinson's disease. Mitochondrion. 2014;14(1):64–72. doi: 10.1016/j.mito.2013.12.001. doi:10.1016/j.mito.2013.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Singhal NK, Li S, Arning E, Alkhayer K, Clements R, Sarcyk Z, Dassanayake RS, Brasch NE, Freeman EJ, Bottiglieri T, McDonough J. Changes in methionine metabolism and his-tone H3 Trimethylation are linked to mitochondrial defects in multiple sclerosis. J Neurosci. 2015;35(45):15170–15186. doi: 10.1523/JNEUROSCI.4349-14.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Straub AC, Lohman AW, Billaud M, Johnstone SR, Dwyer ST, Lee MY, Bortz PS, Best AK, Columbus L, Gaston B, Isakson BE. Endothelial cell expression of haemoglobin α regulates nitric oxide signalling. Nature. 2012;491(7424):473–7. doi: 10.1038/nature11626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Vissers MC, Kuiper C, Dachs GU. Regulation of the 2-oxoglutarate-dependent dioxygenases and implications for cancer. Biochem Soc Trans. 2014;42(4):945–51. doi: 10.1042/BST20140118. [DOI] [PubMed] [Google Scholar]
  32. Waxman SG. Ions, energy and axonal injury: towards a molecular neurology of multiple sclerosis. Trends Mol Med. 2006;12(5):192–5. doi: 10.1016/j.molmed.2006.03.001. [DOI] [PubMed] [Google Scholar]
  33. Witte ME, Nijland PG, Drexhage JA, Gerritsen W, Geerts D, van Het Hof B, Reijerkerk A, de Vries HE, van der Valk P, van Horssen J. Reduced expression of PGC-1α partly underlies mitochondrial changes and correlates with neuronal loss in multiple sclerosis cortex. Acta Neuropathol. 2013;125(2):231–43. doi: 10.1007/s00401-012-1052-y. [DOI] [PubMed] [Google Scholar]

RESOURCES