Skip to main content
PLOS One logoLink to PLOS One
. 2016 May 3;11(5):e0154794. doi: 10.1371/journal.pone.0154794

Phylogenetic Analyses of Armillaria Reveal at Least 15 Phylogenetic Lineages in China, Seven of Which Are Associated with Cultivated Gastrodia elata

Ting Guo 1,3, Han Chen Wang 2,*, Wan Qiu Xue 2, Jun Zhao 4, Zhu L Yang 1,*
Editor: Ned B Klopfenstein5
PMCID: PMC4854404  PMID: 27138686

Abstract

Fungal species of Armillaria, which can act as plant pathogens and/or symbionts of the Chinese traditional medicinal herb Gastrodia elata (“Tianma”), are ecologically and economically important and have consequently attracted the attention of mycologists. However, their taxonomy has been highly dependent on morphological characterization and mating tests. In this study, we phylogenetically analyzed Chinese Armillaria samples using the sequences of the internal transcribed spacer region, translation elongation factor-1 alpha gene and beta-tubulin gene. Our data revealed at least 15 phylogenetic lineages of Armillaria from China, of which seven were newly discovered and two were recorded from China for the first time. Fourteen Chinese biological species of Armillaria, which were previously defined based on mating tests, could be assigned to the 15 phylogenetic lineages identified herein. Seven of the 15 phylogenetic lineages were found to be disjunctively distributed in different continents of the Northern Hemisphere, while eight were revealed to be endemic to certain continents. In addition, we found that seven phylogenetic lineages of Armillaria were used for the cultivation of Tianma, only two of which had been recorded to be associated with Tianma previously. We also illustrated that G. elata f. glauca (“Brown Tianma”) and G. elata f. elata (“Red Tianma”), two cultivars of Tianma grown in different regions of China, form symbiotic relationships with different phylogenetic lineages of Armillaria. These findings should aid the development of Tianma cultivation in China.

Introduction

Fungal species of the genus Armillaria (Fr.: Fr.) Staude (Physalacriaceae, Agaricales, Basidiomycota) are well known as important plant pathogens that can cause serious root diseases on diverse trees and woody plants growing in plantations, forests and orchards worldwide, resulting in huge economic losses [1, 2]. However, significant differences in pathogenicity have been observed among species of Armillaria. For example, A. ostoyae (Romagn.) Herink (= A. solidipes [3, 4]) and A. mellea (Vahl) P. Kumm. are generally considered to be strongly pathogenic, whereas species such as A. sinapina Bérubé & Dessur., A. gallica Marxm. & Romagn. and A. cepistipes Velen. are considered less pathogenic [2]. Therefore, accurate species delimitation of Armillaria is critical for the assessment of disease risk.

Several species of Armillaria have been identified as symbionts of Gastrodia elata Bl. (“Tianma” in Chinese) and Polyporus umbellatus (Pers.) Fr., both being well known as important elements of traditional medicine in East Asia [5–8]. Based on data from the Ministry of Commerce, the output of fresh tubers of Tianma reached a record 14,873 tonnes in 2015, generating an annual production value up to $100 million USD (http://www.gov.cn/xinwen/2015-07/22/content_2900532.htm). The growth and maturation of Tianma, a heterotrophic perennial orchid with no leaves and roots, heavily rely on the presence of Armillaria partners [9]. It is well known that different strains of Armillaria can affect both the production and the quality of the tubers of Tianma [9, 10]. Thus, screening the best Armillaria strains and assigning them to the correct taxa are particularly important for the cultivation of Tianma.

In the past 40 years, mating tests have been widely used in the taxonomy of Armillaria. Using these tests, 16 Chinese Biological species (CBS A to CBS P) of Armillaria have been identified [11, 12]. However, mating tests rely on the availability of single-spore (haploid) isolates. This limits their use in the identification of samples collected as rhizomorphs, which are commonly associated with Tianma tubers. Furthermore, the results obtained from mating tests are sometimes ambiguous and inconclusive. The mating results are judged by the change in colony morphology. The reaction tends to be indistinct if the mating tests are performed on diploid–haploid or diploid–diploid pairings [12–14]. For example, in some pairings between Japanese homothallic isolates, unclear zone lines were observed, and the scenario also occurred that there was no pigmented line at the junction of the two isolates but the mycelia did not intermingle on either side [15].

In recent years, molecular data, specifically DNA sequence data, have been increasingly used to identify fungal species [16]. Taylor et al. [17] introduced the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) as an objective way to define the limits of sexual species. Since their publication, numerous complexes of sibling species have been uncovered in fungi using the multilocus approach [18, 19]. Tsykun et al. [20] used a multilocus approach for the identification of Armillaria species occurring in Europe. Three loci, the rDNA ITS, IGS-1 (intergenic spacer region one) and the translation elongation factor-1 alpha (tef1-α), were used in their study. Among these, it was shown that tef1-α could successfully distinguish closely related Armillaria biological species, which has also been revealed by other researchers [21–25]. Based on the sequences from tef1-α and IGS-1, a recent study by Coetzee et al. [26] elucidated the phylogenetic relationships among biological species of Armillaria from China, and generally resolved four main phylogenetic groups, namely, the “A. ostoyae”, “A. gallica”, “A. tabescens” and “A. mellea” clusters. However, the relationship between the CBS and the phylogenetic clades is still unresolved, with most CBS (i.e., CBS C, F, G, H, J, L, N and O) remaining unnamed.

In this study, we extensively collect samples of Armillaria from China and analyze them using sequences of three DNA regions. Together with the rDNA ITS and tef1-α, which have been used in studies of Armillaria before, sequences from the beta-tubulin (β-tubulin) gene are also used, as it has been demonstrated that the third codons and introns of β-tubulin are highly variable and thus can be used at the interspecific level and even at the intraspecific level in fungal taxonomy [27–29]. In this study, we aim to i) reveal the phylogenetic diversity of Armillaria in China and establish the link between the CBS and the phylogenetic lineages; ii) determine the phylogenetic relationships among Armillaria samples from different regions of the Northern Hemisphere; and iii) assess the diversity of the phylogenetic lineages of Armillaria associated with Tianma in China.

Materials and Methods

Ethics statement

Armillaria is neither protected nor endangered in the sampled areas, and all samples were collected by researchers following current Chinese regulations. None of the sampled locations are privately owned or protected by law.

Taxon sampling, strain collection and isolation

Armillaria samples used in this study comprised three types: i) single-spore isolates representing 14 out of 16 known CBS (except CBS E and CBS P; the two isolates of CBS E were assigned to CBS C and CBS D by Zhao et al. [30] and the isolates of CBS P were not available), each with at least three single-spore isolates. They were all cultures previously assigned to biological species by one of the present authors (HCW) or other mycologists [11, 12, 31–37]; ii) basidiomata collected during the past 10 years, mainly from Southwest China; and iii) rhizomorphs/samples associated with Tianma, including rhizomorphs attached to the tuber surfaces, commercial strains of Armillaria used for the cultivation of Tianma, and rhizomorphs or basidiomata collected from inoculum (wood infected with Armillaria strains by farmers) on Tianma plantations in northeastern Yunnan during 2010–2014. Table 1 shows the details of all of the samples. Vouchers were kept in the Herbarium of Cryptogams of the Kunming Institute of Botany, Chinese Academy of Sciences (HKAS). For the rhizomorphs and some basidiomata, we prepared pure cultures to facilitate DNA isolation. All of the pure cultures were made from a variety of tissues following standard aseptic techniques. Pieces approximately 3–5 mm in length taken at the junction of the stipe and pileus of the basidiomata were inoculated on potato dextrose agar (PDA) media. Rhizomorphs were rinsed overnight with distilled water and sterilized with 75% ethanol for 1 min. The rhizomorphs were then carefully dried using sterilized filter paper, plated onto PDA media in Petri dishes, and cultured at 22–24°C in the dark. For the strains associated with Tianma, images of rhizomorphs were taken after about 2 weeks to compare the branching development. All of these isolates were preserved in the Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany (KIB) of the Chinese Academy of Sciences.

Table 1. Collections of Armillaria used in this study.

Taxon Biological Herbarium ID Isolated ID Origin Location GenBank accession numbers
species 1 ITS tef1-α β-tubulin
A. borealis A. borealis HKAS 86616 97061/182 tester strain Helsinki, Finland KT822291 KT822427 KT822214
A. borealis / HKAS 76263 Gt571 basidioma Muli, SC KT822294 KT822426 KT822193
A. borealis / HKAS 56108 Li1254 basidioma Xiangshan, YN KT822293 KT822425 -
A. cepistipes / HKAS 86542 SN2d commercial strain Yiliang, YN KT822303 KT822421 KT822179
A. cepistipes CBS F HKAS 86583 01108/11 single spore Xinlin, HLJ KT822290 KT822417 KT822181
A. cepistipes CBS F HKAS 86584 96059/861 single spore Laotuding, LN KT822278 KT822419 KT822178
A. cepistipes CBS F HKAS 86585 96060/211 single spore Laotuding, LN KT822283 KT822420 KT822180
A. cepistipes CBS F HKAS 86587 99101/71 single spore Yichun, HLJ KT822287 KT822418 KT822182
A. cf. borealis (CBS M) A. borealis HKAS 86617 01015/71 single spore Shennongjia, HB KT822309 KT822432 KT822218
A. cf. gallica / HKAS 85517 Guo408 basidioma XJ KT822312 KT822409 KU378051
A. ectypa HKAS 86565 70011/132 strain Auvergne, France KT822340 KT822438 KT822241
A. gallica A. gallica HKAS 86569 93421/12 tester strain EU KT822277 KT822414 KT822203
A. mellea / HKAS 85471 Guo104 basidioma Yiliang, YN KT822242 KT822341 KT822148
A. mellea / HKAS 49004 Ge508 basidioma Jiulong, SC KT822245 KT822347 KT822150
A. mellea / HKAS 85599 Gt874 basidioma Qujing, YN KT822249 KT822342 KU378052
A. mellea homothallic A. mellea HKAS 86588 83003/22 single spore Japan KT822246 KT822352 KT822151
A. mellea (CBS G) homothallic A. mellea HKAS 86590 00020/61 strain Yulong, YN KT822251 KT822354 KT822158
A. mellea (CBS G) homothallic A. mellea HKAS 86591 01010/11 strain Shennongjia, HB KT822252 KT822343 KT822156
A. mellea (CBS G) homothallic A. mellea HKAS 86592 02001/51 strain Kuankuoshui, GZ KT822253 KT822344 KT822154
A. mellea (CBS G) homothallic A. mellea HKAS 86593 04054/141 strain Tianmushan, ZJ KT822254 KT822345 KT822155
A. mellea (CBS G) homothallic A. mellea HKAS 86594 04055/91 strain Tianmushan, ZJ KT822244 KT822349 KT822157
A. mellea (CBS G) homothallic A. mellea HKAS 86597 99044/21 strain Kunming, YN KT822255 KT822351 KT822149
A. mellea homothallic A. mellea HKAS 86598 PFD84-1032 single spore Africa KT822248 KT822348 KT822159
A. mellea homothallic A. mellea HKAS 86599 PFD87-392 single spore Muguga, Kenya KT822250 KT822350 KT822152
A. mellea homothallic A. mellea HKAS 86600 PFD87-412 single spore Kenya KT822247 KT822355 KT822153
A. mellea heterothallic A. mellea HKAS 86611 B2752 tester strain New Hampshire, US KT822256 KT822353 KT822161
A. mellea (CBS K) heterothallic A. mellea HKAS 86612 00109/41 single spore Yulong, YN KT822243 KT822346 KT822160
A. nabsnona / HKAS 85499 Guo316 basidioma Yiliang, YN KT822265 KT822410 KT822189
A. nabsnona / HKAS 85500 Guo317 basidioma Yiliang, YN KT822266 KT822413 KT822190
A. nabsnona / HKAS 86544 ZT-1d commercial strain Yiliang, YN KT822270 KT822412 KT822191
A. nabsnona / HKAS 85523 Gt798 basidioma Yiliang, YN KT822333 KT822411 KT822192
A. ostoyae (CBS D) A. ostoyae HKAS 86579 96043/111 single spore Dunhua, JL KT822310 KT822428 KT822215
A. ostoyae (CBS D) A. ostoyae HKAS 86580 96044/241 single spore Dunhua, JL KT822311 KT822430 KT822216
A. ostoyae (CBS D) A. ostoyae HKAS 86581 97058B/161 single spore Dunhua, JL KT822292 KT822429 KT822217
A. ostoyae (CBS D) A. ostoyae HKAS 86582 98+3/41 single spore Dunhua, JL KT822307 KT822431 KT822177
A. sinapina (CBS A) A. sinapina HKAS 86566 96015/391 single spore Changbaishan, JL KT822323 KT822422 KT822208
A. sinapina (CBS A) A. sinapina HKAS 86567 96037/121 single spore Changbaishan, JL KT822272 KT822423 KT822211
A. sinapina (CBS A) A. sinapina HKAS 86568 99116/71 single spore Yichun, HLJ KT822262 KT822424 KT822219
A. sp. CBS N HKAS 86620 02066/31 single spore Emeishan, SC KT822317 KT822389 KT822236
A. sp. CBS J HKAS 86607 00112/51 single spore Yulong, YN KT822330 KT822358 KT822210
A. tabescens (CBS I) A. tabescens HKAS 86603 99122/131 single spore Beijing KT822240 KT822441 KT822339
A. tabescens A. tabescens HKAS 86604 CT1097.32 tester strain Messina, Italy KT822338 KT822440 KT822239
A. tabescens A. tabescens HKAS 86605 901582 tester strain Slovenia KT822337 KT822439 KT822238
Lineage 1 / HKAS 85457 Guo90 basidioma Yiliang, YN KT822271 KT822385 KT822224
Lineage 1 / HKAS 85519 Gt794 basidioma Yiliang, YN KT822335 KT822373 KT822225
Lineage 1 / HKAS 85527 Gt802c basidioma Yiliang, YN KT822322 KT822374 KT822227
Lineage 1 / HKAS 85551 Gt826c basidioma Weixin, YN KT822313 KT822382 KT822231
Lineage 1 / HKAS 85575 Gt850c basidioma Weixin, YN KT822314 KT822383 KT822230
Lineage 1 / HKAS 85581 Gt856c basidioma Weixin, YN KT822336 KT822392 KT822226
Lineage 1 CBS L HKAS 86615 00126/21 single spore Kuankuoshui, GZ KT822315 KT822384 KT822222
Lineage 1 CBS N HKAS 86621 02069/51 single spore Emeishan, SC KT822306 KT822386 KT822228
Lineage 1 CBS N HKAS 86622 02071/21 single spore Emeishan, SC KT822316 KT822390 KT822229
Lineage 2 / HKAS 86551 Guo282b rhizomorphs Yiliang, YN KT822279 KT822367 KT822183
Lineage 2 / HKAS 86554 Guo322b rhizomorphs Yiliang, YN KT822260 KT822366 KT822186
Lineage 2 / HKAS 86556 Guo364d commercial strain Yiliang, YN KT822259 KT822370 KT822187
Lineage 2 / HKAS 86557 Guo365d commercial strain Yiliang, YN KT822301 KT822368 KT822184
Lineage 2 / HKAS 86543 SN4d commercial strain Yiliang, YN KT822334 KT822369 KT822185
Lineage 2 CBS O HKAS 86623 02072/231 single spore Emeishan, SC KT822318 KT822363 KT822188
Lineage 3 / HKAS 85449 Guo82 basidioma Yiliang, YN KT822299 KT822387 KT822176
Lineage 3 / HKAS 86548 Guo278b rhizomorphs Yiliang, YN KT822296 KT822395 KT822173
Lineage 3 / HKAS 86552 Guo286a rhizomorphs Yiliang, YN KT822297 KT822393 KT822220
Lineage 3 / HKAS 86553 Guo287 basidioma Yiliang, YN KT822298 KT822394 KT822174
Lineage 3 CBS L HKAS 86613 00125/11 single spore Kuankuoshui, GZ KT822319 KT822388 KT822232
Lineage 3 CBS L HKAS 86614 00125/21 single spore Kuankuoshui, GZ KT822305 KT822391 KT822221
Lineage 3 / HKAS 86555 Guo324b rhizomorphs Yiliang, YN KT822302 KT822381 KT822175
Lineage 4 / HKAS 51692 Yang4881 basidioma Baiyu, SC KT822269 KT822415 KT822163
Lineage 4 / HKAS 51046 Ge1461 basidioma Daocheng, SC KT822257 KT822356 KT822162
Lineage 4 / HKAS 85594 Gt869 basidioma Yiliang, YN KT822274 KT822377 KT822172
Lineage 4 / HKAS 45820 Yang4434 basidioma Changdu, Tibet KT822258 KT822380 -
Lineage 4 CBS H HKAS 86601 99012/11 single spore Yichun, HLJ KT822280 KT822357 KT822166
Lineage 4 CBS H HKAS 86602 00019/41 single spore Yulong, YN KT822308 KT822378 KT822167
Lineage 4 CBS J HKAS 86606 00107/21 single spore Yulong, YN KT822281 KT822359 KT822171
Lineage 4 CBS J HKAS 86608 00115/31 single spore Xianggelila, YN KT822282 KT822375 KT822165
Lineage 4 CBS J HKAS 86609 00117/71 single spore Xianggelila, YN KT822331 KT822372 KT822169
Lineage 4 CBS J HKAS 86610 02049/21 single spore Xinyuan, XJ KT822332 KT822371 KT822164
Lineage 4 (CBS M) A. borealis HKAS 86618 01018/101 single spore Shennongjia, HB KT822321 KT822376 KT822170
Lineage 4 (CBS M) A. borealis HKAS 86619 01019/11 single spore Shennongjia, HB KT822295 KT822362 KT822168
Lineage 5 CBS C HKAS 86574 93022/131 single spore Changbaishan, JL KT822324 KT822361 KT822200
Lineage 5 CBS C HKAS 86575 96018/71 single spore Changbaishan, JL KT822327 KT822364 KT822201
Lineage 5 CBS C HKAS 86576 99109/61 single spore Yichun, HLJ KT822326 KT822360 KT822234
Lineage 5 CBS C HKAS 86577 99110/61 single spore Yichun, HLJ KT822267 KT822379 KT822235
Lineage 5 CBS C HKAS 86578 99115/101 single spore Yichun, HLJ KT822325 KT822365 KT822209
Lineage 6 / HKAS 86558 A9d commercial strain Korea KT822285 KT822407 KT822198
Lineage 6 / HKAS 86559 Guo343d commercial strain Hanzhong, SX KT822289 KT822406 KT822197
Lineage 6 / HKAS 86560 Jing-234d commercial strain SX KT822264 KT822408 KT822212
Lineage 6 / HKAS 86564 Guo341d commercial strain HB KT822284 KT822405 KT822196
Lineage 6 / HKAS 85567 Gt842c basidioma Weixin, YN KT822268 KT822399 KT822213
Lineage 6 / HKAS 85572 Gt847c basidioma Weixin, YN KT822273 KT822400 KT822207
Lineage 6 (CBS B) A. gallica HKAS 86571 02147/11 single spore Mudanjiang, HLJ KT822288 KT822404 KT822205
Lineage 6 (CBS B) A. gallica HKAS 86573 96011/251 single spore Changbaishan, JL KT822300 KT822398 KT822202
Lineage 6 / HKAS 86561 K19d commercial strain China KT822329 KT822401 -
Lineage 6 / HKAS 86563 Guo342d commercial strain HB KT822286 KT822397 KT822199
Lineage 6 / HKAS 45821 Yang4445 basidioma Kunming, YN KT822261 KT822396 KT822194
Lineage 6 (CBS B) A. gallica HKAS 86570 01106/71 single spore Beian, HLJ KT822320 KT822402 KT822204
Lineage 6 (CBS B) A. gallica HKAS 86572 96011/161 single spore Changbaishan, JL KT822328 KT822403 KT822206
Lineage 7 / HKAS 83303 Qin886 basidioma Longling, YN KU378047 KT822437 KU378049
Lineage 7 / HKAS 83361 Qin944 basidioma Longling, YN KU378048 KT822436 KU378050
Lineage 7 / HKAS 86541 Xhwang3394 basidioma Lincang, YN KT822304 KT822435 KT822237
Nag. E / HKAS 86549 Guo279b rhizomorphs Yiliang, YN KT822275 KT822433 KT822195
Nag. E / HKAS 86550 Guo281b rhizomorphs Yiliang, YN KT822276 KT822434 KT822233
North American A. cepistipes CBS F HKAS 86586 97033/11 single spore Changbaishan, JL KT822263 KT822416 KT822223

1 the isolates were previously assigned to biological species by Qin et al. [11].

2 tester strains.

The samples associated with Tianma

a rhizomorphs attached to the tuber surfaces

b rhizomorphs collected from inoculum (wood infected with Armillaria strains by farmers) at the Tianma plantations

c basidiomata collected from inoculum (wood infected with Armillaria strains by farmers) at the Tianma plantations

d commercial strains of Armillaria used for the cultivation of Tianma

Abbreviations: CBS = Chinese biological species; HKAS = the Herbarium of Cryptogams of the Kunming Institute of Botany (KIB); Chinese Academy of Sciences; SC = Sichuan Province; YN = Yunnan Province; HB = Hubei Province; JL = Jilin Province; HLJ = Heilongjiang Province; LN = Liaoning Province; GZ = Guizhou Province; ZJ = Zhejiang Province; XJ = Xinjiang Province; SX = Shaanxi Province

DNA isolation, PCR, DNA sequencing and alignments

DNA was directly extracted from dry specimens or cultures using the cetyltrimethylammonium bromide (CTAB) method [38]. Primers ITS1F and ITS4B [39] were used to amplify the 5.8S rRNA gene and the flanking ITS regions, and primer pairs EF595F/EF1160R [40] or 983F/1567R [41] were used to amplify tef1-α. For β-tubulin, primer pairs TubF (5′- GGTGCGGGTAACTGGGC -3′) and TubR (5′- GAGGCAGCCATCATGTTCTT -3′) [42] were used in the amplifications. PCR was performed in a total volume of 25 μl containing 2.5 μl of PCR reaction buffer, 0.5 μl of dNTP mixture (0.2 mM), 1 μl of each primer (5 μM), 1 U of Taq polymerase, and 1 μl of DNA template. PCR reactions were conducted on an ABI 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA) under the following reaction conditions: predenaturation at 94°C for 3 min, followed by 35 cycles of denaturation at 94°C for 40 s, annealing at 50°C (for ITS), 52°C (for tef1-α) and 53°C (for β-tubulin) for 40 s, and elongation at 72°C for 90 s. A final elongation at 72°C for 6 min was included after the cycles. We run 3–5 μl of the PCR products on a 2% agarose gel to verify correct amplification. PCR products were purified with a Gel Extraction & PCR Purification Combo Kit (Spin-column) (Bioteke, Beijing, China). The purified products were then sequenced in both directions on an ABI-3730-XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA) using the same primers as in the PCR amplifications. For most of the samples, PCR amplification of ITS and β-tubulin yielded a single strong band. Amplicons ranged in size between ~1,000 bp for ITS and ~900 bp for β-tubulin. Amplification of the tef1-α region yielded a strong band of about 600 bp for all of the samples. PCR products that could not be sequenced successfully were cloned into a PMD18-T vector (Takara, Japan) and then sequenced with primers M13F (5′ -GTAAAACGACGGCCAGTGAA-3′) and M13R (5′ -CAGGAAACAGCTATGACCAT-3′). The contiguous sequences were assembled with SeqMan implemented in Lasergene v7.1 (DNASTAR Inc., USA).

Six matrices were compiled for different purposes. The first four matrices, namely, ITS, tef1-α (EF1-I matrix), β-tubulin and the three-locus matrices, consisted of sequences generated in this study. They were used to delimit phylogenetic lineages of Armillaria in China. The four matrices contained sequences obtained from nine tester strains, which have been used by other authors to perform mating tests with Chinese isolates to identify biological species [11, 12, 43]. We used these sequences to achieve broader sampling for establishing the relationships between the biological species and phylogenetic lineages. A fifth matrix, named here as the comprehensive tef1-α matrix (EF1-II matrix), comprised tef1-α sequences generated in this study (from 101 collections) and 81 sequences retrieved from the GenBank (NCBI; http://blast.ncbi.nlm.nih.gov/; S1 Table). These sequences were selected based on two criteria: i) they were representative of species isolates from the Northern Hemisphere (Europe and North America) and East Africa, and ii) mating tests had been performed on these isolates. This 182-collection dataset was used to identify the relationships among all of our samples and known related samples in the GenBank.

We found that some diploid individuals contained many heterozygous sites (more than five sites) in the tef1-α region based on the alignment of EF1-II. In these cases, the program PHASE 2.0 (http://www.bioinf.manchester.ac.uk/resources/phase/) was used to resolve the haplotype of these heterozygous samples using the default parameter settings [44]. Therefore, a sixth matrix (EF1-III matrix), which was based on the EF1-II matrix and contained these haplotypes, was generated to illuminate the phylogenetic relationships among them. For all of the matrices, A. ectypa (Fr.) Lamoure was selected as the outgroup based on a previous study [22].

Each of the ITS, β-tubulin and EF1-I, II, and III matrices were aligned in MAFFT v6.853 with the auto strategy [45], and manually optimized in BioEdit v7.0.9 [46]. The three-locus matrix was compiled by concatenating the sequences of the ITS, EF1-I, and β-tubulin matrices in Phyutility 2.2 [47]. The regions containing insertions and deletions (indels) were included in the analysis, with gaps treated as missing data.

To test whether potentially ambiguous sites in the original alignments would add noise to the phylogenetic analyses, we first used the on-line Gblocks v0.91b server (http://molevol.cmima.csic.es/castresana/Gblocks_server.html) to select sites by specifying less stringent conditions, i.e., allowing smaller final blocks, gap positions within the final blocks and less strict flanking positions. The generated alignment of ITS, tef1-α and β-tubulin retained 93%, 99% and 96% original characters, respectively. The excluded sites in the tef1-α and β-tubulin alignments were all within introns. However, the introns could be unambiguously aligned and had many parsimony-informative characters. In addition, comparison of the trees generated from the processed and original alignments showed that the original alignments produced even better topologies with higher support values. Many authors consider that there is a substantial loss of information upon the removal of any fragments from sequences that have already been obtained [48, 49]. Therefore, in our final analyses, we included all of the characters. In the three-locus matrix, the unavailable β-tubulin sequences of three samples were treated as missing data in the phylogenetic analyses. The alignments of the six matrices are available from TreeBASE under accession no. 18700.

Phylogenetic analyses

The best-fitted substitution model for each matrix was determined through MrModeltest v2.3 [50] based on the Akaike information criterion (AIC). GTR+I+G, SYM+I+G and HKY+I+G were selected as the best models for the three-locus and ITS matrices, the three tef1-α matrices (EF1-I, II and III), and the β-tubulin matrix, respectively. Maximum likelihood (ML) analyses, Bayesian inference (BI) and maximum parsimony (MP) bootstrap analyses were conducted for the three-locus, EF1-II and EF1-III matrices. For the phylogenetic analyses based on the ITS, tef1-α (EF1-I) and β-tubulin matrices, only ML and BI were used. ML analyses were carried out using the program RaxML 7.0.4 [51] as implemented in the Cyberinfrastructure for Phylogenetic Research (CIPRES) Web Portal 1.0 (http://www.phylo.org/sub). The support values for each node were assessed using a nonparametric bootstrapping with 1,000 replicates. BI was conducted in MrBayes 3.1.2 [52] with two independent runs of one cold and three heated chains. Runs were performed for 50 million generations with trees sampled every 100 generations. Chain convergence was determined using Tracer v1.5 (http://tree.bio.ed.ac.uk/software/tracer/) to confirm sufficiently large ESS values (> 200). The sampled trees were subsequently summarized after omitting the first 25% of trees as burn-in using the “sump” and “sumt” commands implemented in MrBayes. The default parameters were used for both methods, with convergence and burn-in assessed according to the authors’ recommendations [51, 52]. The three-locus matrix was divided into three partitions, and we conducted partitioned mixed-model analysis that allowed us to estimate the model parameters separately in both BI and ML analyses. MP analyses were performed in PAUP [53] based on a heuristic search of 1,000 replicates with random stepwise addition using tree-bisection-reconnection branch swapping and starting with trees obtained by the stepwise addition of sequences. All of the characteristics were equally weighted and gaps were treated as missing data. Parsimony bootstrap analyses [54] with 1,000 replicates were subsequently performed using the fast bootstrap option to evaluate the robustness of the MP trees.

Phylogenetic lineage recognition

Phylogenetic lineages of Armillaria from China were delimited based on two criteria proposed by Dettman et al. [18, 19]. A clade was assigned to a phylogenetic lineage if it fulfilled either of the following two criteria: (i) genealogical concordance: the clade was present in the majority (2/3) of the single-locus genealogies; or (ii) genealogical non-discordance: the clade was well supported in at least one single-locus genealogy (for ML, bootstrap proportions (BP) ≥ 70%, Bayesian posterior probability (PP) ≥ 0.95), and it was not contradicted in any other single-locus genealogy at the same level of support. A conflict was assumed to be significant when two different relationships (one monophyletic and the other non-monophyletic) for the same set of taxa were supported either with ML-BP ≥ 70% or BI-PP ≥ 0.95. For any clade which failed to obtain multigene sequences from at least two samples, it was also accepted as a potential independent phylogenetic lineage if it showed long branches as sequence variation from its sister groups.

Results

Phylogenetic analyses

The ITS, EF1-I, and β-tubulin matrices included 101, 101 and 98 sequences, respectively. The number of nucleotides/characters (and the percentages of parsimony-informative characters) in these three matrices were 910 (12.6%), 515 (28.7%) and 850 (20.7%), respectively. For each of these three matrices, ML and BI analyses yielded similar topologies. The phylogenetic trees generated from ML analyses are shown in S1 Fig. Overall, branch resolution and support in the ITS phylogeny were lower, and only a few branches were supported by both the bootstrap and posterior probabilities, while better branch resolution and support were obtained for the trees generated from the EF1-I and β-tubulin sequences. Several well supported lineages appeared in common between the two single-locus genealogies, i.e., A. mellea, A. cepistipes, putative new Lineages 2 and 7, A. tabescens and Nag. E (S1 Fig). Concurrently, the β-tubulin data showed supported conflicts with tef1-α with regard to the placement of several phylogenetic lineages, i.e., A. ostoyae, A. sinapina and A. borealis (S1 Fig). Nevertheless, the phylogenetic signal in the individual ITS and tef1-α datasets was so strong that the incongruence from β-tubulin was eliminated in the three-locus analyses. The ML trees of the three-locus and EF1-II matrices are presented in Figs 1 and 2, respectively. In Fig 2, we label the clade including samples HKAS86579, HKAS86581, HKAS86580 and HKAS86582 as A. ostoyae, because our samples were nested in the same clade as the GenBank-retrieved sequences of European A. ostoyae, and this name is more popularly acknowledged than its putative synonym A. solidipes (Fig 2). Phylogenetic analyses based on the three-locus dataset revealed five major clades (Fig 1), while those based on the EF1-II matrix indicated six major clades (Fig 2). The major differences between the trees inferred from the two matrices were as follows: (i) A. cf. borealis, which clustered into Clade II in the tree generated from the three-locus dataset (Fig 1), formed a single clade (VI) in the phylogenetic tree from the EF1-II matrix; and (ii) A. cepistipes and A. sinapina, which clustered into Clade I (Fig 1) in the tree of the three-locus matrix, were placed in Clade II in the EF1-II phylogeny (Fig 2).

Fig 1. Phylogenetic tree generated from the three-locus (ITS, tef1-α and β-tubulin) dataset.

Fig 1

The labels on the right of the phylogram indicate groups identified by phylogenetic analyses. The values of the bootstrap frequencies of ML (BP ≥ 70%), posterior probability (PP ≥ 0.95) and maximum parsimony bootstraps (PB ≥ 70%) are shown above the nodes. Thick black branches indicate high support in the analyses (ML-BP ≥ 70%, BI-PP ≥ 0.95). Green branches were concordantly supported by the majority of the loci (genealogical concordance), or were well supported by at least one locus and not contradicted by any other locus (genealogical non-concordance). Triangles at nodes indicate that all taxa united by it belong to the same phylogenetic lineage (see text for details). Taxon labels indicate strain number and geographic source. If a strain was originally identified as a CBS (Chinese biological species), the CBS taxon is listed before the strain number.

Fig 2. Phylogenetic relationships between samples of Armillaria inferred from tef1-α sequences using ML analysis.

Fig 2

Branch support values are indicated by numbers above branches (ML-BP/BI-PP/MP-PB). Thick black branches received high support in the analyses (ML-BP ≥ 70%, BI-PP≥ 0.95). The accession numbers for the sequences retrieved from the GenBank database are listed in S1 Table.

The PHASE analyses inferred four haplotypes within the seven heterozygous strains (HKAS51692, HKAS45821, HKAS86559, HKAS86564, HKAS85572, HKAS85567 and HKAS86558) (S2 Fig). The phylogeny containing these haplotypes instead of heterozygous sequences is shown in Fig 3. The phylogeny (EF1-III) displayed an identical topology to the EF1-II phylogeny except for the shallow nodes surrounded by the five heterozygous samples: therefore, the deep nodes appearing in common between EF1-III and EF1-II tree are indicated by triangles.

Fig 3. Phylogeny of Armillaria samples inferred from tef1-α DNA sequences using ML analysis to show the intraspecific level within Lineage 6.

Fig 3

Branch support values are indicated by numbers above branches (ML-BP/BI-PP/MP-PB). The nodes appearing in common between Fig 3 and Fig 2 are indicated by triangles. The species names labeled on our collections correspond to Fig 1. Seven samples with heterozygous sites (HKAS45821, HKAS51692, HKAS86558, HKAS86559, HKAS86564, HKAS85567 and HKAS85572) were analyzed using PHASE 2.0 and every isolate was divided into two haploid genotypes. The four subgroups of Lineage 6 were highlighted in different colors.

Phylogenetic lineage recognition

At least 15 phylogenetic lineages of Armillaria were recognized from China. Among them, four (A. mellea, A. tabescens, Nag. E and Lineage 7) were strongly supported by all three genealogies (ITS, EF1-I and β-tubulin), two (A. cepistipes and Lineage 2) were strongly supported as monophyletic by ML-BP (≥ 70%) and Bayesian-PP (≥ 0.95) in two of the individual gene trees (S1 Fig; Table 2), and four lineages (A. nabsnona, Lineages 1, 3 and 4) were resolved as monophyletic in one of the three individual gene trees and were not rejected by the other two matrices (Table 2). The five phylogenetic lineages (Lineage 5, Lineage 6, A. sinapina, A. ostoyae and A. borealis) only formed monophyletic groups in the tef1-α gene tree. Except HKAS86573, 11 samples of Lineage 6 formed a monophyletic group (93/1.00) in the β-tubulin tree (S1 Fig). The sequences of this lineage lacked significant genetic differentiation, and the genealogical patterns were common among the three loci, so it is rational to collapse these into a single phylogenetic lineage. The branches of HKAS86569 (European A. gallica) were relatively long in all three single-locus genealogies and the combined tree revealed that Lineage 6 and European A. gallica were probably different phylogenetic lineages, accordingly (S1 Fig; Fig 1). The other five phylogenetic lineages were represented by single collections (Fig 1), thus their monophyly could not be tested. However, the five singletons (HKAS86620, HKAS86607, HKAS 85517, HKAS 86586 and HKAS 86617) showed relatively long branches compared with their sister groups: therefore, they were considered to be genetically divergent from their sisters (Fig 1, Clades I and II). Among the 15 phylogenetic lineages as determined by the corcordance and/or non-disconcordance of the three genealogies, the monophyly of seven lineages is highly supported in the tef1-α genealogy and monophyly of 10 lineages is highly supported in the β-tubulin genealogy (S1 Fig; Fig 1; Table 2).

Table 2. Support values for Armillaria lineages recognized by genealogical concordance in analyses of individual gene partitions and in the combined three-locus dataset.

Values are shown as ML-BP/Bayesian-PP. Missing values (-) apply to non-monophyly.

Independent evolutionary lineage1 ITS tef1-α β-tubulin Criteria satisfied Combined three-locus data 2
A. borealis -/- 98/1.00 -/- n 96/1.00/98
A. cepistipes -/- 99/1.00 96/1.00 ① 100/1.00/100
A. mellea 100/1.00 100/1.00 100/1.00 ①② 100/1.00/100
A. nabsnona -/- 100/1.00 -/- ② 99/1.00/100
A. ostoyae -/- 99/1.00 -/- n 95/1.00/91
A. sinapina -/- 100/1.00 -/- n 99/1.00/94
Lineage 1 -/- -/- 81/0.97 ② 99/1.00/82
Lineage 2 -/- 95/1.00 100/1.00 ① 100/1.00/99
Lineage 3 -/- -/- 100/1.00 ② 100/1.00/100
Lineage 4 -/- -/- 100/1.00 ② 52/0.99/-
Lineage 5 99/1.00 91/1.00 -/- n 85/1.00/-
Lineage 6 -/- -/- 93/1 n 41/0.98/-
Lineage 7 93/1.00 100/1.00 100/1.00 ①② 100/1.00/100
A. tabescens 98/1.00 100/1.00 100/1.00 ①② 100/1.00/100
Nag. E 100/1.00 99/1.00 96/1.00 ①② 100/1.00/100

1 Support values not applicable for the following five potential lineages represented by single collections, which are therefore not included in the table: A. sp. (HKAS86620), A. sp. (HKAS86607), A. cf. gallica (HKAS85517), North American A. cepistipes (HKAS86586), A. cf. borealis (HKAS86617).

2 The maximum parsimony (MP) bootstrap analysis was added in the three-locus phylogeny.

① genealogical concordance, ② genealogical non-discordance.

“n” represents neither ① nor ② was fulfilled, but accepted as phylogenetic lineage, see text for details.

Phylogenetic lineages of Armillaria associated with Tianma

A total of 23 isolates associated with Tianma were obtained from our study. The collections associated with Tianma belonged to seven independent phylogenetic lineages, including Lineages 1 to 3, A. nabsnona, Nag. E, A. cepistipes, and Lineage 6 (Fig 1). Nag. E was recorded to be associated with Tianma for the first time by this study. Among these seven phylogenetic lineages, the strains of Lineage 2 and Lineage 6 are the most commonly used in the cultivation of Tianma (authors’ personal observations), accounting for 22% (5 out of 23) and 30% (7 out of 23) of the strains, respectively (Fig 1).

Discussion

Phylogenetic lineage diversity of Armillaria in China and the assignment of 14 CBS

Our study revealed a high diversity of Armillaria species in China. At least 15 phylogenetic lineages were recognized (Fig 1), 10 of which were represented by two or more collections and could be supported by the GCPSR criteria of Dettman et al. [19]. The grouping of the samples of the remaining five lineages did not strictly satisfy either genealogical concordance or genealogical non-disconcordance. The major conflict was between the genealogies of tef1-α and β-tubulin. For example, the samples of Lineage 5 were well supported in the tef1-α tree but collapsed into two subgroups in the β-tubulin genealogy (S1 Fig). The monophyly of four isolates of A. ostoyae was supported in the tef1-α tree. However, these isolates collapsed into two subgroups in the β-tubulin tree, one group was nested with a subgroup of Lineage 5 and the other one was cluster with sample of A. borealis, respectively. The samples of A. sinapina formed a monophyletic clade in the tef1-α genealogy but split into three divergent subgroups in the β-tubulin tree. Nevertheless, considering the high support values in the combined tree, we took these clades as independent phylogenetic lineages. The remaining five potential phylogenetic lineages were each represented by a single strain (HKAS86620, HKAS86607, HKAS85517, HKAS86586 and HKAS86617) but showed relatively long branches, seeming to suggest obvious genetic divergence from their close relatives (Fig 1).

The 14 CBS proposed based on mating tests could be assigned to specific phylogenetic lineages with the help of our multigene data. Coetzee et al. [30] analyzed these CBS using the sequences of tef1-α and IGS-1. They revealed four main phylogenetic groups and named them the “A. ostoyae”, “A. gallica”, “A. tabescens” and “A. mellea” clusters. However, no clear assignment of these CBS was provided in their study. In our analyses, some unexpected relationships between CBS and phylogenetic lineages were indicated. Two types of correspondence among the CBS and the phylogenetic lineages were suggested by our data (Fig 4). The first type showed clear relationships among the phylogenetic lineages and the CBS, and could be divided into three subtypes: (i) one CBS to one phylogenetic lineage; this included CBS A, B, C, D, O and I, which could be assigned to A. sinapina, Lineage 6, Lineage 5, A. ostoyae, Lineage 2 and A. tabescens, respectively; (ii) one CBS to two phylogenetic lineages; this was represented by CBS F, which was divided into two subgroups, provisionally named A. cepistipes and North American A. cepistipes; and (iii) two CBS to one phylogenetic lineage; this included CBS G and K, which were merged into A. mellea. The second type was much more complicated. This type included two groups of CBS: (i) the group consisting of CBS M and J, both of which were separated into two phylogenetic lineages, but shared Lineage 4, represented by CBS H; and (ii) the group consisting of CBS L and N, both of which were divided into two lineages, but shared Lineage 1.

Fig 4. The link between 14 CBS (Chinese Biological Species) and phylogenetic lineages identified in this study.

Fig 4

CBS were recognized in previous studies and phylogenetic lineages were delimited in this study. The m/n on the arrows between “CBS” and “phylogenetic lineage” means that m of n isolates of a CBS were assigned to phylogenetic lineages.

Our multigene data provided several notable new insights into the treatment of the CBS. Some incompatible CBS presented the same phylogenetic lineage. For example, the homothallic strains of CBS G have been reported as almost incompatible with the heterothallic strains of CBS K. However, they nested within the A. mellea clade with strong support (100/1/99) (Fig 1, Clade IV) in our phylogenetic analyses. Similar observations have also been made for other fungal groups. For example, the homothallic and heterothallic biotypes of the pathogen Moniliophthora perniciosa were not inter-fertile, presumably because genetic barriers have evolved since the biotypes diverged [55]. Thus, it is quite reasonable to accept CBS G and K as a single phylogenetic lineage. In contrast, some compatible strains of a biological species could be further divided into two or more phylogenetic lineages. For instance, CBS M, which has been demonstrated to be compatible with European A. borealis, could be divided into two monophyletic clades. The scenario whereby one biological species actually encompasses more than one phylogenetic lineage has been discussed in the context of European Armillaria collections [24]. A similar phenomenon was observed for CBS F. This biological species has been suggested to be conspecific to A. singula, which was originally described from Japan, on the basis of its basidioma morphology [11], or to represent a novel taxon closely related to A. cepistipes, A. calvescens, A. gallica and A. sinapina, based on phylogenetic analyses of the IGS-1 region [26]. Although no compatibility reaction emerged between the isolates of CBS F and European or North American A. cepistipes [32], most of the CBS F isolates were grouped with those of A. cepistipes from Japan and Europe into a common sub-clade with high support in the tef1-α tree, and the isolate HKAS86586 was unexpectedly grouped with the North American A. cepistipes (Fig 2). Thus, it is reasonable to identify the isolates of CBS F as A. cepistipes and the closely related “North American A. cepistipes”.

Relationships between Armillaria from China and other regions of the world

By comparing tef1-α sequences from our study with sequences from the GenBank database, we explored the phylogenetic relationships between Chinese Armillaria isolates and those from other parts of the world. Of the recognized taxa, A. mellea and A. tabescens have been reported to be widely distributed in the Northern Hemisphere. However, we found significant genetic divergence among isolates of each of these two species from different continents (Figs 1 and 2), indicating genetic isolation among populations from different continents. Nevertheless, it is surprising that the homothallic A. mellea from Southwest China (HKAS86590) and East Africa (HKAS86600) were phylogenetically very close to those gathered from Europe (Fig 2). Furthermore, the African samples of homothallic A. mellea (HKAS86598 and HKAS86599) were grouped within a sub-clade of predominantly East Asian samples (Figs 1 and 2). This is similar to observations reported previously [15, 56]. The disjunction of closely related species of Armillaria between China and Africa is probably due to recent human-mediated introductions, which was also suggested by biogeographic studies of other fungi, such as Favolaschia, Serpula and Pleurotus [57–59]. Armillaria gallica has also been recorded from different continents of the Northern Hemisphere. Our study indicated that the samples recognized as A. gallica from East Asia and North America were genetically strongly divergent from European A. gallica. In total, two phylogenetic lineages could be plausibly inferred for “A. gallica” (Fig 2). Most of the samples from China previously considered as A. gallica, now represented a new phylogenetic lineage (Lineage 6) according to our analyses, and one specimen (HKAS85517) from Xinjiang (XJ) together with two A. gallica samples from Japan formed another clade, while the A. gallica from North America formed a separate clade (Fig 2). This is similar to previous reports [60]. In addition, significant heterozygous sites were detected in the tef1-α sequences of six strains within Lineage 6 (HKAS45821, HKAS86559, HKAS86564, HKAS85572, HKAS85567 and HKAS86558). After including these haplotypes in the phylogenetic analyses, we found that the two alleles of some strains (HKAS51692 and HKAS45821) were clustered into different phylogenetic lineages (Fig 3), indicating that hybridization could occur among different phylogenetic subgroups. Hybridization events commonly occurr in pathogenic fungi [61–64]. Interspecific hybridization has only been reported for three Basidiomycota: Coniophora puteana [65], Flammulina velutipes [66] and Tricholoma scalpturatum [67]. Even if direct evidence is still lacking, some Armillaria species may have interspecific hybridization potential because they already have a broad range of hosts.

The phylogenetic lineages shared between East Asia and Europe included A. borealis, A. cf. borealis, A. ostoyae and A. cepistipes. We found that the Chinese isolates of “A. borealis” encompassed two lineages (Figs 1 and 2). Similarly, European “A. borealis” has also been reported as two divergent lineages [60]. The isolates HKAS56108 and HKAS76263 were grouped into the A. borealis lineage, and the isolate HKAS86617 was grouped into A. cf. borealis (Fig 1). Samples of A. ostoyae from northeastern China, Japan and Europe were grouped into a highly supported lineage. Based on morphological observations, Burdsall & Volk [3] have proposed that A. solidipes Peck, originally described from North America, is an older name for A. ostoyae, originally described from Europe. Our phylogenetic analysis indicated that the North American A. solidipes was sister to its sympatric A. gemina rather than the Eurasian A. ostoyae. We thus provisionally assign the North American isolates to A. solidipes and the Eurasian isolates to A. ostoyae.

Armillaria nabsnona, North American A. cepistipes and A. sinapina are common in East Asia and North America. Isolates from coastal western North America, Japan and southwestern China exhibited great genetic differentiation within A. nabsnona and formed three subclades. The isolates from North America, Japan and northeastern China showed limited genetic variation in A. sinapina. The North American A. cepistipes is distributed in North America and Northeast China, and is genetically divergent from the East Asian–European A. cepistipes lineage (Fig 2). The relationships between “A. cepistipes” in North America and East Asia can only be elucidated when more collections are available.

The phylogenetic lineages restricted to East Asia were Nag. E and Lineage 6. Nag. E is a biological species previously identified in Japan by Ota et al. [68]. Phylogenetically, it is closely related to A. nabsnona (Clade I in Fig 2). Four isolates within Lineage 6 belong to CBS B, and CBS B was assigned to A. gallica previously. Prior to this study, A. gallica had also been recorded from China and Japan [11, 68, 69]. Interestingly, we found that the “A. gallica” from East Asia was genetically different from European A. gallica. In our phylogenetic analyses, the tester strain of A. gallica from Europe (HKAS86569) was genetically differentiated from samples of “A. gallica” from other regions (Figs 1 and 2). HKAS86569 formed a congruent genetic pattern (displayed as substitutions) in the alignments of three loci within the lineage, suggesting that it may represent a different phylogenetic species from Lineage 6 (Figs 1 and 2; S1 Fig). Our samples (HKAS45821 and HKAS85517) were closely aligned with the Japanese “A. gallica” (Fig 2). We propose that A. gallica is restricted to Europe and the “A. gallica” in East Asia and North America are not conspecific with the European A. gallica. Moreover, our phylogenetic analyses indicated that the currently recognized A. gallica is polyphyletic and probably comprises cryptic species (Fig 2), in accordance with the findings of Klopfenstein et al. [60]. To determine the phylogenetic relationships of these putative A. gallica collections, seven haplotypes from tef1-α sequences were detected within 17 samples (S2 Fig), and the phylogenetic tree inferred from the EF1-III dataset, which included these haplotypes, indicated that Lineage 6 could be split into four subgroups, providing preliminary evidence for ongoing speciation (Fig 3).

Most of the newly identified phylogenetic lineages in Clade I and Clade III (Fig 1) are restricted to China. Lineage 1 is distributed from Southwest to Northeast China in broad-leaved forests. The two sympatric phylogenetic lineages, Lineage 2 and Lineage 3, are restricted to Yunnan and Guizhou, Southwest China, and Lineage 5 is found only in Northeast China. In contrast, Lineage 4 is widely distributed in China from the northeastern to the central, southwestern and northwestern parts. Among the nine new phylogenetic lineages identified in this study, Lineage 7 was significantly different from the other species in phylogenetic position. It was formed of a single clade (Clade III) while Lineages 1 to 6 were nested within Clade I (Fig 1).

Armillaria associated with Tianma in China

Prior to this study, six species (including subspecies) of Armillaria, namely A. cepistipes, A. gallica, A. mellea subsp. nipponica, A. jezoensis J.Y. Cha & Igarashi, A. tabescens and A. nabsnona, had been reported to be associated or form symbiotic relationships with Gastrodia elata in Japan [7, 70]. Our study indicated that A. cepistipes and A. nabsnona could be associated with Tianma in China (Fig 1). However, we found no evidence for the symbiosis between Tianma and the other four Armillaria species based on our data. In contrast, four additional phylogenetic lineages, namely Lineages 2, 3, 6 and Nag. E, were found to be associated with the cultivation of Tianma in China (Fig 1). The collections of Lineage 4 (HKAS85594) and A. mellea (HKAS85471) were taken from Tianma plantations. However, no direct evidence showed that strains within them could be used for Tianma cultivation. Interestingly, two common features could be found among the Armillaria strains suitable for Tianma cultivation: (i) they possibly belonged to saprotrophic/low-pathogenic phylogenetic lineages (Fig 1, Clade I); and (ii) their mycelia had a fast growth speed and could form vigorous and stout rhizomorphs, the branching patterns of which were was monopodial (S3 Fig). Morrison revealed that species producing monopodially branched rhizomorphs, i.e., A. gallica, A. nabsnona and A. cepistipes, were less aggressive than dichotomously branched species (A. mellea, A. borealis and A. ostoyae) [71]. We hypothesize that the low-pathogenic (less virulent and aggressive) character of these species helps Armillaria to establish a symbiotic relationship with Tianma, rather than causing disease to tubers, while the rapid growth of mycelia and the healthy development of rhizomorphs greatly improves the ability of Armillaria to derive water and nutrition from the soil or rotten wood and share them with the tubers of Tianma.

Two different cultivars of Tianma, “Brown Tianma” (G. elata f. glauca) and “Red Tianma” (G. elata f. elata), are widely cultivated in China [72]. The former is mainly produced in southwest China (Sichuan, northeastern Yunnan and western Guizhou provinces), and the latter is widely cultivated in southwest, central, north and northeast China. Our study revealed that different phylogenetic lineages of Armillaria had different cultivation patterns with Tianma. Brown Tianma was associated with strains of A. nabsnona, A. cepistipes, Lineage 2, Nag. E, Lineage 3 and Lineage 6, while Red Tianma was only associated with Lineage 6. Our investigation revealed that two strains of Lineage 6 (HKAS86560 and HKAS86558) were widely considered as good promoters for the cultivation of Tianma in central China, and that a few strains belonging to Lineage 2 and Lineage 3 were widely used for the cultivation of Tianma in southwest China (Yunnan, Sichuan and Guizhou provinces). Although the strains of Lineage 6 were introduced into Zhaotong, Yunnan Province to achieve high yields of Brown Tianma, they proved uncompetitive compared with the local strains of A. cepistipes (HKAS86542), Lineage 2 (HKAS86543) and A. nabsnona (HKAS86544). These findings strongly suggest that native and/or naturalized Armillaria strains should be selected for the cultivation of Tianma, which has also been suggested for the selection of species for agroforestry [73].

Supporting Information

S1 Fig. Phylogenetic trees inferred from the maximum likelihood (ML) analysis with branch support obtained by ML and BI analyses based on ITS, tef1-α and β-tubulin sequences, respectively.

Branch support values are indicated by numbers above branches (ML-BP/BI-PP). Thick black branches received high support in the analyses (ML-BP ≥ 70%, BI-PP ≥ 0.95). Taxon labels indicate strain number and geographic source. Branches showing supported conflict with single gene phylogenies are highlighted in different colors.

(PDF)

S2 Fig. Best haplotype reconstruction of seven samples with heterozygous sites.

(PDF)

S3 Fig. The rhizomorphs development of strains associated with Tianma.

The strains of a-f were associated with Tianma cultivation and strains of g-h could not be used for Tianma cultivation. a and b: Lineage 6 (HKAS86560, HKAS86558); c: A. nabsnona (HKAS86544); d: Lineage 2 (HKAS86543); e: A. cepistipes (HKAS86542); f: Nag. E (HKAS86549); g: Lineage 1 (HKAS85457); h: A. mellea (HKAS85471).

(PDF)

S1 Table. Tef1-α sequences from GenBank used in this study and their accession numbers.

(DOC)

Acknowledgments

The authors thank Drs. Zai-Wei Ge, Yan-Chun Li and Xiang-Hua Wang and Jiao Qin (Kunming Institute of Botany, CAS) for providing specimens. We are also very grateful to Drs. Bang Feng and Xiang-Hua Wang (Kunming Institute of Botany, CAS) for the improvement of the manuscript. The four reviewers and the associate editor are highly appreciated for constructive suggestions and detailed comments on this paper.

Data Availability

All relevant data are within the paper and its Supporting Information files. DNA accession numbers have been detailed in Table 1 of the manuscript.

Funding Statement

This study was financed by the National Natural Science Foundation of China (Nos. 30800006 and 31170024), the Chongqing Natural Science Foundation (No. CSTC, 2009BA5030), and the Key Laboratory for Plant Diversity and Biogeography of East Asia, KIB, Chinese Academy of Sciences (KLBB 201207). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Wargo PM, Shaw CG III. Armillaria root rot: the puzzle is being solved. Plant Dis. 1985;69(2):826–832. [Google Scholar]
  • 2.Shaw CG III, Kile GA. Armillaria root disease. Armillaria root disease. 1991. [Google Scholar]
  • 3.Burdsall HH Jr, Volk TJ. Armillaria solidipes, an older name for the fungus called Armillaria ostoyae. North American Fungi. 2008;3:261–267. [Google Scholar]
  • 4.Redhead SA, Bérubé J, Cleary MR, Holdenrieder O, Hunt RS, Korhonen K, et al. (2033) Proposal to conserve Armillariella ostoyae (Armillaria ostoyae) against Agaricus obscurus, Agaricus occultans, and Armillaria solidipes (Basidiomycota). Taxon. 2011;60(6):1770–1771. [Google Scholar]
  • 5.Kusano S. Gastrodia elata and its symbiotic association with Armillaria mellea. J Coll Agric Tokyo. 1911;4:1–66. [Google Scholar]
  • 6.Xu JT, Mu C. The relation between growth of Gastrodia elata protocorms and fungi. Acta Bot Sin. 1990;32(1):26–31. [Google Scholar]
  • 7.Cha JY, Igarashi T. Armillaria species associated with Gastrodia elata in Japan. Eur J Forest Pathol. 1995;25(6–7):319–326. [Google Scholar]
  • 8.Kikuchi G, Yamaji H. Identification of Armillaria species associated with Polyporus umbellatus using ITS sequences of nuclear ribosomal DNA. Mycoscience. 2010;51(5):366–372. 10.1007/s10267-010-0053-8 [DOI] [Google Scholar]
  • 9.Sun SQ, Chen GH. The influences of different Armillaria on the yield of Gastrodia and the content of gastrodin. Shandong Science. 2003;16(2):7–10. [Google Scholar]
  • 10.Wang QY, Guo SX, Guan FB. Studies on influences of Armillaria mellea strains from different sources on yield of Gastrodia elata. Chinese Traditional and Herbal Drugs. 2001;32(9):839–841. [Google Scholar]
  • 11.Qin GF, Zhao J, Korhonen K. A study on intersterility groups of Armillaria in China. Mycologia. 2007;99(3):430–441. [DOI] [PubMed] [Google Scholar]
  • 12.Zhao J, Dai YC, Qin GF, Wei YL, Wang HC, Yuan HS. New biological species of Armillaria from China. Mycosystema. 2008;27(2):156–170. [Google Scholar]
  • 13.Korhonen K. Infertility and clonal size in the Armillariella mellea complex. Karstenia. 1978;18(2):31–42. [Google Scholar]
  • 14.Guillaumin J, Anderson J, Korhonen K, Shaw C, Kile G. Life cycle, interfertility and biological species. Armillaria Root Disease. 1991:10–20. [Google Scholar]
  • 15.Ota Y, Intini M, Hattori T. Genetic characterization of heterothallic and non-heterothallic Armillaria mellea sensu stricto. Mycol Res. 2000;104(9):1046–1054. 10.1017/s0953756200002550 [DOI] [Google Scholar]
  • 16.Cai L, Giraud T, Zhang N, Begerow D, Cai G, Shivas RG. The evolution of species concepts and species recognition criteria in plant pathogenic fungi. Fungal Divers. 2011;50(1):121–133. [Google Scholar]
  • 17.Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, et al. Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol. 2000;31(1):21–32. 10.1006/fgbi.2000.1228 . [DOI] [PubMed] [Google Scholar]
  • 18.Dettman JR, Jacobson DJ, Turner E, Pringle A, Taylor JW. Reproductive isolation and phylogenetic divergence in Neurospora: comparing methods of species recognition in a model eukaryote. Evolution. 2003;57(12):2721–2741. [DOI] [PubMed] [Google Scholar]
  • 19.Dettman JR, Jacobson DJ, Taylor JW. Multilocus sequence data reveal extensive phylogenetic species diversity within the Neurospora discreta complex. Mycologia. 2006;98(3):436–446. [DOI] [PubMed] [Google Scholar]
  • 20.Tsykun T, Rigling D, Prospero S. A new multilocus approach for a reliable DNA-based identification of Armillaria species. Mycologia. 2013;105(4):1059–1076. 10.3852/12-209 . [DOI] [PubMed] [Google Scholar]
  • 21.Maphosa L, Wingfield BD, Coetzee MPA, Mwenje E, Wingfield MJ. Phylogenetic relationships among Armillaria species inferred from partial elongation factor 1-alpha DNA sequence data. Australas Plant Path. 2006;35(5):513–520. 10.1071/ap06056 [DOI] [Google Scholar]
  • 22.Antonín V, Tomšovský M, Sedlák P, Májek T, Jankovský L. Morphological and molecular characterization of the Armillaria cepistipes-A. gallica complex in the Czech Republic and Slovakia. Mycol Prog. 2009;8(3):259–271. 10.1007/s11557-009-0597-1 [DOI] [Google Scholar]
  • 23.Hasegawa E, Ota Y, Hattori T, Kikuchi T. Sequence-based identification of Japanese Armillaria species using the elongation factor-1 alpha gene. Mycologia. 2010;102(4):898–910. 10.3852/09-238 [DOI] [PubMed] [Google Scholar]
  • 24.Mulholland V, MacAskill GA, Laue BE, Steele H, Kenyon D, Green S. Development and verification of a diagnostic assay based on EF-1 α for the identification of Armillaria species in Northern Europe. Forest Pathol. 2012;42(3):229–238. 10.1111/j.1439-0329.2011.00747.x [DOI] [Google Scholar]
  • 25.Ross-Davis AL, Hanna JW, Klopfenstein NB, Kim MS. Advances toward DNA-based identification and phylogeny of North American Armillaria species using elongation factor-1 alpha gene. Mycoscience. 2012;53(2):161–165. 10.1007/s10267-011-0148-x [DOI] [Google Scholar]
  • 26.Coetzee MPA, Wingfield BD, Zhao J, van Coller SJ, Wingfield MJ. Phylogenetic relationships among biological species of Armillaria from China. Mycoscience. 2015;56(5):530–541. [Google Scholar]
  • 27.Geiser DM, Pitt JI, Taylor JW. Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proceedings of the National Academy of Sciences. 1998;95(1):388–393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Myllys L, Lohtander K, Tehler A. β-tubulin, ITS and group I intron sequences challenge the species pair concept in Physcia aipolia and P. caesia. Mycologia. 2001;93(2):335–343. [Google Scholar]
  • 29.Sung GH, Sung JM, Hywel-Jones NL, Spatafora JW. A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): identification of localized incongruence using a combinational bootstrap approach. Molecular phylogenetics and evolution. 2007;44(3):1204–1223. 10.1016/j.ympev.2007.03.011 . [DOI] [PubMed] [Google Scholar]
  • 30.Zhao J, Tian SM, Zhang L, Xu ZC, Qin GF. Mating relationship between CBS E isolates and other Chinese biological species of Armillaria. Journal of Jilin Forestry University. 2000;16(1):5–8. [Google Scholar]
  • 31.Qin GF, He W, Zhao J, Tian SM, Shen RX. Mating relationships between Chinese biological species and north American species of Armillaria. Mycosystema. 1999;18(3):243–248. [Google Scholar]
  • 32.Qin GF, Zhao J, Tian SM, Korhonen K, Dai YC, Liu CR. New biological species of Armillaria in China. Mycosystema. 2000;19(4):509–516. [Google Scholar]
  • 33.Sun LF, Yang GT, Zhao J, Song YS, Qin GF. Investigation and identifcation on Armillaria biological species in Mudanjiang forested area of Heilongjiang Province. Forest Pest & Disease. 2003;22(4):35–38. [Google Scholar]
  • 34.Sun LF, Tian SM, Yang GT, Zhao J, Qin GF, Song YS, et al. Culture characters of five familiar Armillaria biological species in Northeast China. Journal of Northeast Forestry University. 2007;27(2):48–51. [Google Scholar]
  • 35.Sun LF, Zhang YH, Yang GT, Qin GF, Song YS, Song RQ. A review of biological species of Armillaria and their geographic distribution. Mycosystema. 2007;26(2):306–315. [Google Scholar]
  • 36.Sun LF, Zhang YH, Yang GT, Qin GF, Song YS, Song RQ, et al. Geographic distribution survey of Armillaria biological species in Heilongjiang province. Mycosystema. 2007;26(1):59–67. [Google Scholar]
  • 37.Zhao J, Qin GF, Dai YC. Newly recorded biological species of Chinese Armillaria. Mycosystema. 2005;24(2):164–173. [Google Scholar]
  • 38.Doyle JJ. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem bull. 1987;19:11–15. [Google Scholar]
  • 39.Gardes M, Bruns TD. ITS primers with enhanced specificity for basidiomycetes‐application to the identification of mycorrhizae and rusts. Mol Ecol. 1993;2(2):113–118. [DOI] [PubMed] [Google Scholar]
  • 40.Wendland J, Kothe E. Isolation of tef1 encoding translation elongation factor EF1 [alpha] from the homobasidiomycete Schizophyllum commune. Mycol Res. 1997;101(07):798–802. [Google Scholar]
  • 41.Rehner S. Primers for Elongation Factor 1-a (EF1-a). Assembling the Fungal Tree of Life, Cornvallis, OR Available at: http://www.aftol.org/pdfs/EF1primer.pdf. 2001.
  • 42.Wang HC. Systematic studies on Armillaria from China: University of Chinese Academy of Sciences; 2007. [Google Scholar]
  • 43.Qin GF, Hantula J. Phylogenetic relationships between homothallic and heterothallic Armillaria mellea. Mycosystema. 2001;21(3):346–355. [Google Scholar]
  • 44.Stephens M, Donnelly P. A comparison of bayesian methods for haplotype reconstruction from population genotype data. The American Journal of Human Genetics. 2003;73(5):1162–1169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Katoh K, Misawa K, Kuma Ki, Miyata T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002;30(14):3059–3066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic acids symposium series. 1999;41:95–98. [Google Scholar]
  • 47.Smith SA, Dunn CW. Phyutility: a phyloinformatics tool for trees, alignments and molecular data. Bioinformatics. 2008;24(5):715–716. 10.1093/bioinformatics/btm619 [DOI] [PubMed] [Google Scholar]
  • 48.Lee MS. Unalignable sequences and molecular evolution. Trends Ecol Evol. 2001;16(12):681–685. [Google Scholar]
  • 49.Aagesen L. The information content of an ambiguously alignable region, a case study of the trnL intron from the Rhamnaceae. Org Divers Evol. 2004;4(1):35–49. [Google Scholar]
  • 50.Nylander JAA. MrModeltest v2. Program distributed by the author Evolutionary Biology Centre, Uppsala University; 2004;2. [Google Scholar]
  • 51.Stamatakis A, Hoover P, Rougemont J. A rapid bootstrap algorithm for the RAxML web servers. Syst Biol. 2008;57(5):758–771. 10.1080/10635150802429642 [DOI] [PubMed] [Google Scholar]
  • 52.Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19(12):1572–1574. [DOI] [PubMed] [Google Scholar]
  • 53.Swofford DL. PAUP*. Phylogenetic analysis using parsimony (* and other methods). Version 4. 2003.
  • 54.Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985;39(4):783–791. [DOI] [PubMed] [Google Scholar]
  • 55.Griffith GW, Hedger JN. The breeding biology of biotypes of the witches’ broom pathogen of cocoa, Crinipellis perniciosa. Heredity. 1994;72:278–289. [Google Scholar]
  • 56.Baumgartner K, Baker BR, Korhonen K, Zhao J, Hughes KW, Bruhn J, et al. Evidence of natural hybridization among homothallic members of the basidiomycete Armillaria mellea sensu stricto. Fungal biology. 2012;116(6):677–691. 10.1016/j.funbio.2012.03.006 . [DOI] [PubMed] [Google Scholar]
  • 57.Johnston PR, Whitton SR, Buchanan PK, Park D, Pennycook SR, Johnson JE, et al. The basidiomycete genus Favolaschia in New Zealand. New Zeal J Bot. 2006;44(1):65–87. [Google Scholar]
  • 58.Kauserud H, Högberg N, Knudsen H, Elborne SA, Schumacher T. Molecular phylogenetics suggest a North American link between the anthropogenic dry rot fungus Serpula lacrymans and its wild relative S. himantioides. Mol Ecol. 2004;13(10):3137–3146. [DOI] [PubMed] [Google Scholar]
  • 59.Zervakis GI, Moncalvo JM, Vilgalys R. Molecular phylogeny, biogeography and speciation of the mushroom species Pleurotus cystidiosus and allied taxa. Microbiology. 2004;150(3):715–726. [DOI] [PubMed] [Google Scholar]
  • 60.Klopfenstein NB, Hanna JW, Ross-Davis AL, Stewart JE, Ota Y, Medel-Ortiz R, et al., editors. Armillaria phylogeny based on tef-1α sequences suggests ongoing divergent speciation within the Boreal Floristic Kingdom. Browning, J; Palacios, P, compilers Proceedings of the 60th Annual Western International Forest Disease Work Conference; 2012.
  • 61.Brasier C, Cooke D, Duncan J. Origin of a new Phytophthora pathogen through interspecific hybridization. Proceedings of the National Academy of Sciences. 1999;96(10):5878–5883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Newcombe G, Stirling B, McDonald S, Bradshaw H. Melampsora× columbiana, a natural hybrid of M. medusae and M. occidentalis. Mycol Res. 2000;104(03):261–274. [Google Scholar]
  • 63.Moon C, Craven K, Leuchtmann A, Clement S, Schardl C. Prevalence of interspecific hybrids amongst asexual fungal endophytes of grasses. Mol Ecol. 2004;13(6):1455–1467. [DOI] [PubMed] [Google Scholar]
  • 64.Inderbitzin P, Davis RM, Bostock RM, Subbarao KV. The ascomycete Verticillium longisporum is a hybrid and a plant pathogen with an expanded host range. PloS one. 2011;6(3):1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Kauserud H, Svegården IB, Decock C, Hallenberg N. Hybridization among cryptic species of the cellar fungus Coniophora puteana (Basidiomycota). Mol Ecol. 2007;16(2):389–399. [DOI] [PubMed] [Google Scholar]
  • 66.Hughes KW, Petersen RH. Apparent recombination or gene conversion in the ribosomal ITS region of a Flammulina (Fungi, Agaricales) hybrid. Mol Biol Evol. 2001;18(1):94–96. [DOI] [PubMed] [Google Scholar]
  • 67.Jargeat P, Martos F, Carriconde F, Gryta H, MOREAU PA, Gardes M. Phylogenetic species delimitation in ectomycorrhizal fungi and implications for barcoding: the case of the Tricholoma scalpturatum complex (Basidiomycota). Mol Ecol. 2010;19(23):5216–5230. 10.1111/j.1365-294X.2010.04863.x [DOI] [PubMed] [Google Scholar]
  • 68.Ota Y, Matsushita N, Nagasawa E, Terashita T, Fukuda K, Suzuki K. Biological species of Armillaria in Japan. Plant Dis. 1998;82(5):537–543. [DOI] [PubMed] [Google Scholar]
  • 69.Mohammed C, Guillaumin JJ, Berthelay S. Armillaria species identified in China and Japan. Mycol Res. 1994;98(6):607–613. [Google Scholar]
  • 70.Sekizaki H, Kuninaga S, Yamamoto M, Asazu SN, Sawa S, Kojoma M, et al. Identification of Armillaria nabsnona in Gastrodia tubers. Biological and Pharmaceutical Bulletin. 2008;31(7):1410–1414. [DOI] [PubMed] [Google Scholar]
  • 71.Morrison D. Rhizomorph growth habit, saprophytic ability and virulence of 15 Armillaria species. Forest Pathol. 2004;34(1):15–26. [Google Scholar]
  • 72.Zhou X, Yang XH, Liang HX, Liu CY. Morphology of Gastrodia elata Bl (Tian-Ma): Science Press; 1987. [Google Scholar]
  • 73.Ranjitkar S, Sujakhu NM, Lu Y, Wang Q, Wang M, He J, et al. Climate modelling for agroforestry species selection in Yunnan Province, China. Environ Modell Softw. 2016;75:263–272. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Phylogenetic trees inferred from the maximum likelihood (ML) analysis with branch support obtained by ML and BI analyses based on ITS, tef1-α and β-tubulin sequences, respectively.

Branch support values are indicated by numbers above branches (ML-BP/BI-PP). Thick black branches received high support in the analyses (ML-BP ≥ 70%, BI-PP ≥ 0.95). Taxon labels indicate strain number and geographic source. Branches showing supported conflict with single gene phylogenies are highlighted in different colors.

(PDF)

S2 Fig. Best haplotype reconstruction of seven samples with heterozygous sites.

(PDF)

S3 Fig. The rhizomorphs development of strains associated with Tianma.

The strains of a-f were associated with Tianma cultivation and strains of g-h could not be used for Tianma cultivation. a and b: Lineage 6 (HKAS86560, HKAS86558); c: A. nabsnona (HKAS86544); d: Lineage 2 (HKAS86543); e: A. cepistipes (HKAS86542); f: Nag. E (HKAS86549); g: Lineage 1 (HKAS85457); h: A. mellea (HKAS85471).

(PDF)

S1 Table. Tef1-α sequences from GenBank used in this study and their accession numbers.

(DOC)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files. DNA accession numbers have been detailed in Table 1 of the manuscript.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES