Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2016 May 4;6:25312. doi: 10.1038/srep25312

Co-spread of metal and antibiotic resistance within ST3-IncHI2 plasmids from E. coli isolates of food-producing animals

Liangxing Fang 1,2, Xingping Li 1,2, Liang Li 1,2, Shumin Li 1,2, Xiaoping Liao 1,2, Jian Sun 1,2,a, Yahong Liu 1,2,3,b
PMCID: PMC4855149  PMID: 27143648

Abstract

Concerns have been raised in recent years regarding co-selection for antibiotic resistance among bacteria exposed to heavy metals, particularly copper and zinc, used as growth promoters for some livestock species. In this study, 25 IncHI2 plasmids harboring oqxAB (20/25)/blaCTX-M (18/25) were found with sizes ranging from ∼260 to ∼350 kb and 22 belonged to the ST3-IncHI2 group. In addition to blaCTX-M and oqxAB, pcoA-E (5/25) and silE-P (5/25), as well as aac(6′)-Ib-cr (18/25), floR (16/25), rmtB (6/25), qnrS1(3/25) and fosA3 (2/25), were also identified on these IncHI2 plasmids. The plasmids carried pco and sil contributed to increasing in the MICs of CuSO4 and AgNO3. The genetic context surrounding the two operons was well conserved except some variations within the pco operon. The ~32 kb region containing the two operons identified in the IncHI2 plasmids was also found in chromosomes of different Enterobacteriaceae species. Further, phylogenetic analysis of this structure showed that Tn7-like transposon might play an important role in cross-genus transfer of the sil and pco operons among Enterobacteriaceae. In conclusion, co-existence of the pco and sil operons, and oqxAB/blaCTX-M as well as other antibiotic resistance genes on IncHI2 plasmids may promote the development of multidrug-resistant bacteria.


The horizontal transfer of plasmids plays a significant role in the dissemination of antibiotic resistance genes. Plasmids in the HI incompatibility group (IncHI) occur widely in the Enterobacteriaceae. Members of this group can carry a wide variety of resistance genes including those encoding the metallo-β-lactamase NDM-11,2. One subgroup of IncHI, IncHI2, is one of the most common incompatibility groups of plasmids in Enterobacteriaceae3. This group is frequently detected in Salmonella enterica, Enterobacter cloacae, Klebsiella pneumonia and Escherichia coli isolates from humans and chickens4,5,6, but also with a sporadic occurrence in swine7,8.

IncHI2 plasmids have been found to carry numerous classes of resistance genes including resistance to β-lactams (blaCTX-M, blaCMY, blaSHV, blaIMP, blaVIM), quinolones (oqxAB, qnrA1, qnrS1 and qnrB2), aminoglycosides (armA, aac-Ib/aac-Ib-cr), amphenicols (floR) and fosfomycin (fosA3)3,9,10,11,12. Reports on co-spread of extended-spectrum β-lactamase (ESBLs) and plasmid-mediated quinolone resistance determinants (PMQRs) in the same plasmids have increased in the past years6,13. Our previous studies determined that IncHI2 plasmids are linked to the distribution of oqxAB-blaCTX-M genes in E. coli and Salmonella spp.10,11. However, only a few of these cases have been documented. Fluoroquinolones such as ciprofloxacin and enrofloxacin, and cephalosporins such as ceftiofur have been widely used in veterinary medicine in China. Olaquindox, the main substrate for OqxAB, is also commonly used as a therapeutic and preventive antibiotic in pigs14.

In addition to genes encoding antibiotic resistance, the IncHI2 plasmids also harbor a large number of metal tolerance genes. For example, R478 is the prototype of the ST1-IncHI2 plasmids and has been totally sequenced15. It encodes efflux systems to detoxify copper (pcoABCDRSE), silver (silESRCBAP), arsenic (arsCBRH), as well as the Tn1696-related mercury operon (merEDACPTR) and tellurite resistance systems (terZABCDEF and terY3Y2XY1W). Moreover, trace elements including copper have been used as feed additives for the treatment of swine and poultry disease control and weight improvement16,17.

There is increasing concern that metal contamination functions as a selective agent in the proliferation of antibiotic resistance18. There is indeed experimental evidence that exposure to heavy metals (particularly copper and zinc) can induce or select for bacterial adaptations that result in decreased susceptibility to β-lactams19. This may occur by selection of heavy metal resistance determinants for resistance to non-antibiotic agents that are linked to genes for antibiotic resistance20. Considering that the IncHI2 plasmids may play an important role in dissemination of antibiotic and metal resistance genes, we characterized IncHI2 plasmids harboring oqxAB and/or blaCTX-M in E. coli isolates from the diseased food-producing animals in China. Furthermore, the genetic context surrounding the pco and sil operons located on these IncHI2 plasmids were also investigated.

Results

The prevalence of the IncHI2 plasmids

Our initial study group contained 739 E. coli isolates from diseased animals. 405 of these isolates possessing either blaCTX-M (204) or oqxAB (328) were selected for conjugation experiments. We were successful in obtaining 163 transconjugants harboring blaCTX-M and/or oqxAB, including 25 that carried IncHI2 plasmids (25/163 total, 15.3%). The donor strains of these 25 transconjugants were isolated from 14 ducks, 4 chickens and 7 pigs among 2004–2012 and these food-producing animals were from 15 farms (Table 1).

Table 1. Characteristics of the 25 E. coli isolates and transconjugants harboring IncHI2 plasmids.

Strain Source Farm no. Year Co-transferred resistance genes
MICs (ug/ml)/(mM)
Plasmid
ESBLs PMQRs Metal resistance genes Other genes CTX CIP CuSO4 AgNO3 Replicon types Size (kb) Addiction system X-baIRFLP
Z39 Chicken Farm 1 2004 blaCTX-M-27 oqxAB, aac(6′)-Ib-cr – rmtB, floR 8 0.25 8 0.008 HI2, FII ∼350 hok-sok, pemKI, srnBC G3
Z13 Chicken Farm 1 2004 – oqxAB pcoA-D-E, silE-P rmtB 0.06 0.06 12 0.03 HI2, FII ∼350 hok-sok NT
Z31 Chicken Farm 1 2004 – oqxAB – – 0.06 0.06 8 0.008 HI2, FII ∼350 hok-sok, srnBC, ccdAB F4
S7 Pig Farm 2 2004 blaCTX-M-9G oqxAB, aac(6′)-Ib-cr – floR 4 0.5 8 0.008 HI2 ∼280 no I
X2 Duck Farm 3 2005 blaCTX-M-65 oqxAB, aac(6′)-Ib-cr – floR 32 1 8 0.008 HI2, N ∼280 no C
A84 Duck Farm 4 2005 – oqxAB pcoA-D-E, silE-P rmtB 0.25 0.125 12 0.06 HI2, FII ∼280 hok-sok G2
A64 Duck Farm 5 2007 blaCTX-M-27 oqxAB, aac(6′)-Ib-cr – rmtB, floR 32 0.25 8 0.008 HI2, FII ∼350 hok-sok NT
A69 Duck Farm 5 2007 blaCTX-M-27 oqxAB, aac(6′)-Ib-cr – rmtB, floR 32 0.125 8 0.008 HI2, FII ∼350 hok-sok E
A74 Duck Farm 5 2007 blaCTX-M-27 oqxAB, aac(6′)-Ib-cr – rmtB, floR 32 0.5 8 0.008 HI2, FII ∼320 hok-sok NT
A78 Duck Farm 5 2007 blaCTX-M-27 oqxAB, aac(6′)-Ib-cr – – 32 0.25 8 0.008 HI2, N ∼280 no G1
S100 Duck Farm 6 2007 blaCTX-M-14 – – floR 32 0.03 8 0.008 HI2, FII, N ∼280 hok-sok H
S151 Duck Farm 6 2007 – oqxAB, aac(6′)-Ib-cr pcoA-E, silE-P – 0.06 0.06 12 >1 HI2, FII ∼260/100 hok-sok D2
P2-3 Pig Farm 7 2008 blaCTX-M-65 oqxAB, aac(6′)-Ib-cr – floR, fosA3 32 0.5 8 0.008 HI2, FIB ∼380 hok-sok, pemKI F2
P3-3 Pig Farm 7 2008 – oqxAB – – 8 0.25 8 0.008 HI2, FII, FIB ∼260 no F1
HAI Pig Farm 8 2009 – oqxAB, aac(6′)-Ib-cr – – 0.06 0.25 8 0.008 HI2 ∼280 no K2
FS341G Duck Farm 9 2010 blaCTX-M-65 qnrS1, aac(6′)-Ib-cr – floR 32 0.5 8 0.008 HI2, N ∼280 VagCD A
45-6 Pig Farm 10 2010 blaCTX-M-14 oqxAB, aac(6′)-Ib-cr – floR 32 0.125 8 0.008 HI2 ∼280 no J2
FS271X Duck Farm 9 2010 blaCTX-M-65 aac(6′)-Ib-cr – floR 32 0.125 8 0.008 HI2, N ∼280 no J3
2Y4G Duck Farm 11 2011 blaCTX-M-14 oqxAB, aac(6′)-Ib-cr – floR 2 0.25 8 0.008 HI2 ∼280 no B
3YG7 Duck Farm 11 2011 – oqxAB, aac(6′)-Ib-cr pcoA-D-E, silE-P floR 0.06 0.5 12 >1 HI2 ∼280 no D3
CBJ3C Chicken Farm 12 2012 blaCTX-M-14 oqxAB – floR, foSA3 16 0.06 8 0.008 HI2, N ∼350 PemKI, srnBC NT
FS8Z4C Pig Farm 13 2012 blaCTX-M-65 qnrS1 – floR 32 2 8 0.008 HI2, FII ∼280 hok-sok F3
FS1Z4S Pig Farm 14 2012 blaCTX-M-14 oqxAB, aac(6′)-Ib-cr – floR 8 0.125 8 0.008 HI2 ∼280 no K1
FS7Z5G Pig Farm 13 2012 blaCTX-M-14 aac(6′)-Ib-cr pcoA-D-E, silE-P – 32 0.5 12 >1 HI2, ∼280 no D1
FS11Y5C Duck Farm 15 2012 blaCTX-M-55 oqxAB, aac(6′)-Ib-cr, qnrS1 aac(6′)-Ib-cr qnrS1 – – 64 4 8 0.008 HI2 ∼260 no J1

CTX, cefotaxime; CIP, ciprofloxacin; “–” “not detected”; “NT” “not determined”.

Detection of antimicrobial and heavy metal resistance determinants

Among the 25 transconjugants harboring IncHI2 plasmids, 20 carried oqxAB, and 17 harbored blaCTX-M-9G, while only one was positive for blaCTX-M-1G. The most predominant CTX-M-encoding gene was blaCTX-M-14 (6), followed by blaCTX-M-27 and blaCTX-M-65 (5 each). OqxAB and blaCTX-M were found together in 13 transconjugants (Table 1). Other antibiotic-resistance determinants, aac (6′)-Ib-cr, floR, qnrS1, and fosA3 were co-transferred in 18, 16, 3, and 2 transconjugants, respectively. The number of transconjugants carrying oqxAB-aac(6′)-Ib-cr, oqxAB-floR, and oqxAB-aac(6′)-Ib-cr-floR, were 15, 12, and 11, respectively. Moreover, four transconjugants carried oqxAB, blaCTX-M-9G and rmtB simultaneously (Table 1). Interestingly, all of the 25 transconjugants carried a tellurite-resistance system while mercury and arsenic resistance genes were not detected. PcoA-D-E, as well as silE-P genes was found in four transconjugants. Additionally, in one transconjugants S151T, pcoA-E was observed, while pcoD was not detected. (Table 1).

Antimicrobial susceptibility tests

Among the 25 transconjugants harboring IncHI2 plasmids, 18 carried blaCTX-M and showed a reduced susceptibility to CTX (MIC ≥2 μg/mL). In addition, 25 and 15 transconjugants were also resistant to AMP and CIF, respectively. At least one PMQR gene was found in 25 transconjugants (except S100T). Ciprofloxacin MICs were mainly grouped into two levels including 15 non-susceptible transconjugants (0.06–0.25 μg/mL) and 9 with low resistance levels (0.5–4 μg/mL). The MICs of OQX in 20 transconjugants carrying oqxAB, had 4-fold higher than that for the recipient E. coli C600. All transconjugants showed increase in MICs of FLF, and 11 showed extremely high-level resistance with MICs ≥256 μg/mL. Notably, co-transfer of extremely high-level resistance to AMK and FOS (MICs ≥256 μg/mL) were also observed in six transconjugants harboring rmtB and two carrying fosA3, respectively. None of the transconjugants were resistant to meropenem. The metal susceptibility testing showed that 5 transconjugants carrying the pco and sil genes had the MICs of CuSO4 and AgNO3 higher than that for the recipient E. coli C600 (MICCuSO4 = 12 mM vs. 8 mM; MICAgNO3 = 0.03~>1 mM vs. 0.008 mM), while in the other 20 of 25 transconjugants, the MICs of CuSO4 and AgNO3 had no change, when compared with E. coli C600 (Table 1).

Plasmids analysis

The result of S1-PFGE revealed that all of the 25 transconjugants carried only one plasmid with size ranging from ~260 kb to ~380 kb, except for S151T which carried two plasmids (~260 kb and ~100 kb) (Table 1). Southern blot analysis confirmed that these large plasmids were members of the IncHI2 type. Furthermore, a probe hybridizing to oqxB/blaCTX-M-9G/blaCTX-M-1G/rmtB/pcoA/silE also confirmed that these genes were located on the IncHI2 plasmids. Interestingly, 16 of 25 (except pS151T) were fused plasmids. The most prevalent combination was IncHI2 in combination with IncFII (10) and followed by IncN (6) (Table 1). Using pDLST analysis, 22 IncHI2 plasmids were assigned to ST3 and only one to ST1 (pZ13T). Two IncHI2 plasmids were not typeable due to a failure to detect the smr0199 loci (pA84T and pS100T). RFLP analysis of plasmid DNA from the transconjugants harboring IncHI2 plasmids using XbaI demonstrated that 21 of 25 could be divided into eleven groups (designated A to K) (≥75% similarity) (Table 1).

The hipA, mucB and relE genes involved in plasmid stabilization were found in all of the 25 IncHI2 plasmids. However, the seven addiction systems tested in this study were completely lacking in eight plasmids containing only the IncHI2 replicon, as well as another four fused plasmids. Furthermore, no more than three addiction systems were detected among all of the 25 IncHI2 plasmids.

Analysis of the genetic environment of the oqxAB and bla CTX-M genes

The genetic environment of the blaCTX-M-9G genes was ISEcp1-blaCTX-M-9G-IS903 (16), while it was ISEcp1-blaCTX-M-1G-orf477 for the blaCTX-M-1G genes (1). In one transconjugants S7T, both the blaCTX-M-9G allele and the genetic environment of the blaCTX-M-9G gene were not determined. The oqxAB genes were flanked by two copies of IS26 that were located in the same orientation in 20 transconjugants harboring oqxAB. To determine the stability of this structure (IS26-oqxA-oqxB-IS26), inverse PCR was performed and amplicons of approximately 1.6 kb were obtained in all of 20 transconjugants. Sequence analysis of the amplicons further confirmed the genetic environment surrounding the oqxAB genes as obtained by PCR mapping.

Analysis of the genetic environment of pco and sil genes

The regions surrounding the pco and sil genes are shown in Fig. 1, Supplementary Fig. S2 and Table S3. A Tn7-like transposon (~5.99 kb) encompassing the tnsABCD genes, and a ~4.64-kb region including four ORFs (encoding hypothetical proteins), were present upstream from the sil operon, which consisted of silESRCBAP genes (~12.45 kb). That was followed by a ~1.29-kb region including two ORFs (encoding hypothetical proteins). Downstream from it, three different genetic organizations were found within the pco operon: type I, in the plasmids p3YG7T and pFS7Z5GT, a ~7.53-kb segment containing the pcoEABCDRSE genes was present; type II, in the plasmid pS151T, the pco operon was identical to that in pEC5207 (KT347600) and the pcoD and pcoR genes were deleted; type III, in the plasmids pZ13T and pA84T, the pco operon was divided into two parts, and they were not genetically linked together: in one part, downstream from pcoE, pcoA had 1348 bp deleted at the 3′-end and then was followed by an insertion sequence insL (Fig. 1); in the other part, pcoA was truncated at the 5′-end by the insertion of tnpA in the reverse orientation, and pcoBCDRSE was present downstream (Supplementary Fig. S1). The pco operon was then followed by a 5.69-kb region including five ORFs in these five plasmids (Fig. 1 and Supplementary Fig. S1).

Figure 1. Characteristic of the genetic contexts of the pco and sil operons and linear comparison of the structures containing the two operons.

Figure 1

The plasmid pHXY0809 (KM877269) represented an IncHI2 plasmid not carrying the sil and pco operons. Plasmids pAPEC-O1-R (BX663045), R478 (DQ517526), pSH111_227 (JN983042), and pEC5207 (KT347600) were the only four IncHI2 plasmids harbored the sil and pco operons assigned in GenBank. E. coli (CP003289), E. cloacae (CP010384), S. enterica (CP007530), C. freundii (CP012554), E. asburiae (CP0122162) represented the sequences containing the sil and pco operons and they were located on chromosomes of five different Enterobacteriaceae species. p3YG7T, pFS7Z5GT, pS151T, pZ13T, and pA84T represented the IncHI2 plasmids harbored the sil and pco operons in this study. The arrows represent the positions and transcriptional directions of the ORFs. Regions of homology are shaded in gray.

To clarify the role of tnsABCD-~4.64-kb region-silESRCBAP-~1.29-kb region-pcoEABCDRSE (~32kb) in spread of the sil and pco operons, the similar regions from plasmids pZ13T (tnsABCD-~4.64-kb region-silESRCBAP-~1.29-kb region-pcoE-∆pcoA) and p3YG7T (tnsABCD-~4.64-kb region-silESRCBAP-~1.29-kb region-pcoEABCDRSE) were aligned with another 22 reference sequences downloaded from GenBank’s nucleotide database. The 22 reference sequences were closely related to that in p3YG7T, with a 92–100% query coverage and 99% overall nucleotide identity. A phylogenetic tree suggested that these regions were fairly conserved among the 24 selected sequences from chromosomes DNA or plasmids from isolates of six Enterobacteriaceae species. These isolates were recovered from six countries, and diverse origins including humans, animals and environment (Fig. 2).

Figure 2. A phylogenetic analysis of tnsABCD-~4.64-kb region-silESRCBAP-~1.29-kb region-pcoEABCDRSE structure among 22 reference sequences from GenBank and two sequences pZ13T (KU248944) and p3YG7T(KU248945) (marked by the black triangles) in this study.

Figure 2

The 22 reference sequences belonged to six different genera and were closely related to that in p3YG7T, with a 92–100% query coverage and an overall nucleotide identity of 99%. The GenBank accession number, the location of the sil and pco operons of each sequence and the host species, the sources, the locations of recovery and the collection dates of strains of each sequence are shown. The phylogenetic tree is constructed using MEGA 5.05 software.

Discussion

In this study, 25 IncHI2 plasmids carrying blaCTX-M/oqxAB were found from 739 E. coli isolates from disease food-producing animals among 2004–2012. Additionally, we also found that aac (6′)-Ib-cr and floR were frequently co-transferred with blaCTX-M/oqxAB among these IncHI2 plasmids. OqxAB along with aac (6′)-Ib-cr, floR, and blaCTX-M were identified on the same transferable IncHI2 plasmids10. This may be an important mechanism for dissemination of multidrug-resistance genes. Notably, blaCTX-M, oqxAB, and rmtB were the first time identified simultaneously on the IncHI2 plasmids from four transconjugants, which also showed different levels of MICs increased with CTX, CIP, and AMK as compared with recipient strain E. coli C600. The third-generation cephalosporin, fluoroquinolones, and aminoglycosides are the important front-line antibiotics. Therefore, these multidrug-resistant IncHI2 plasmids should be of great concern.

Insertion sequences ISEcp1 and IS26 are most frequently associated with blaCTX-M and oqxAB, respectively11,21. This is consistent with our results that ISEcp1 was upstream of the blaCTX-M gene (except pS7T) and the oqxAB genes were flanked by IS26 in this study. Interestingly, inverse PCR performed on all of the oqxAB-positive transconjugants produced an amplicon and subsequent sequencing showed that the pair of intact IS26 flanking oqxAB could loop out the intervening sequence through homologous recombination. This might further accelerate oqxAB dissemination among Enterobacteriaceae. Further studies are required to explore how the diverse resistance genes, especially blaCTX-M and oqxAB, as well as rmtB, were integrated into the same IncHI2 plasmids.

IncHI2 plasmids are high molecular weight and possess multiple replicons (RepHI1A and RepHI2)15. Additionally, the IncHI2 and IncFIB plasmids co-resident within the same cell were found to undergo plasmid fusion in the transconjugants22. In this study, the majority of the plasmids contained IncHI2 were in combination with either IncFII or IncN. Plasmid may have recombined with co-resident plasmids23, thereby expanding the number of replicons and extending host ranges of the fused plasmids. Although the IncHI2 plasmids herein were of diverse sizes, 22 of 25 were assigned to the ST3 group by pDLST. In Europe and the USA, blaCTX-M-2 producers from both human and poultry sources have been associated with ST2-IncHI2 plasmids, while the blaCTX-M-9 producers were associated with ST1-IncHI2 plasmids4. In China, ST3-IncHI2 plasmids have been found to spread fosA3 among E. coli isolates from chickens12. This indicates that ST3-IncHI2 plasmids most often associated with resistance genes in E. coli from food-producing animals in China. Further, a variety of plasmid patterns were observed by comparing the similarity of the 25 IncHI2 plasmids using RFLP analysis, although some ones showed similar XbaI digestion profiles. Considering that IncHI2 plasmids possessed a well-conserved and stable backbones3, their diversity observed herein were probably due to the deletions or acquisition of a number of resistance genes by transposons and insertion sequences24 or IS26-mediated fusion with other plasmids23.

The presence of addiction systems encoded in resistance plasmids may allow for the maintenance and dissemination of resistance genes within a given bacterial population25. However, in this study, IncHI2 plasmids were found mostly to be devoid of addiction systems which had been previously shown12. These results are not surprising because the seven addiction systems detected in this and that studies were mainly characterized in IncF, IncI1 plasmids or Salmonella virulence plasmids25. However, hipA/B, mucA/B, relE/B, and ter determinants involved in plasmid stabilization system were observed among all of the 25 IncHI2 plasmids. This once again suggested that these genes might play a significant role in the persistence and spread of IncHI2 plasmids.

It has been known for several decades that metal- and antibiotic-resistance genes are linked, particularly on plasmids26,27. The ter determinants were found on the IncHI2 plasmids in the previous study28 and were also observed on all of the IncHI2 plasmids in this study. However, the mer and ars determinants were not found on any of the 25 IncHI2 plasmids. The prototype of the ST1-HI2 group, R478, harbors the mer and ars determinants, while they are deleted in pAPEC-O1-R, the prototype of ST2-HI2 plasmids3,15,29. The IncHI2 plasmids presented in this study may be genetically distinct from R478. Five of the 25 IncHI2 plasmids (20%) also harbored the pco and sil genes, simultaneously. The metal susceptibility testing showed that they also contributed to increasing in the MICs of CuSO4 and AgNO3 when compared with the recipient E. coli C600 and other transconjugants not carried the pco and sil genes. Surprisingly, there were some differences between the MICs of AgNO3, but the MICs of CuSO4 were identical in the five transconjugants carrying pco and sil genes.

We further analyzed the genetic background surrounding the pco and sil genes. The results indicated that the ~24-kb structures (tnsABCD-~4.64-kbregion-silESRCBAP-~1.29-kb region) and the 5.69-kb regions including five ORFs downstream from the pco operons were well conserved in the five plasmids in this study and another four IncHI2 plasmids (R478 (DQ517526), pSH111-27 (JN983042), pAPEC-O1-R (BX663045) and pEC5027 (KT347600)) from GenBank (Fig. 1). The silESRCBAP genes constituted the complete sil operon and shared 95~96.3% identity to that of plasmid pMG101 (AF067954) (Fig. S3A) which played a function role in conferring to silver resistance30. However, there was variability within the pco operon. In the plasmids p3YG7T and pFS7Z5GT, the complete pco operon composed of pcoEABCDRSE genes, was 99.4% identical to that of the plasmid PRJ1004 (X83541) (Fig. S3B) which facilitates copper efflux31. However, in another three IncHI2 plasmids pS151T, pZ13T and pA84T, the pco operons were disrupted even though they also shared high similarities with that of plasmid PRJ1004 (Fig. S3B). The deletion of the pcoD and pcoR genes was also observed in the IncHI2 plasmid pEC5027 carrying blaCMY-2 in our previous report32. It has been demonstrated that mutations in each of the pcoABCD genes on the plasmid pRJ1004 and the silECBA genes on plasmid pMG101 lead to complete loss of copper and silver resistance, respectively31,33. Thus, the reason for the inconsistency between the genetic contexts of the pco and sil operons and the MICs of CuSO4 and AgNO3 observed in the five transconjugants harboring pco and sil is unknown. This remains to be elucidated through further studies.

A Tn7-like transposon carried the pco and sil genes in IncHI plasmids from previous reports33,34. In the current study, aTn7-like transposon was also present upstream of the pco and sil operons in the five IncHI2 plasmids. In our previous study, we obtained the complete sequence of the IncHI2 plasmid pHXY0809 (KM877269) which carried oqxAB but did not harbor the sil and pco operons. Interestingly, a linear comparison of plasmid pHXY0809 with plasmids pAPEC-O1-R, R478, pSH111-27, pEC0527, and p3YG7T (this study) revealed that the regions containing sil and pco operons appeared to be mobilized into these IncHI2 plasmids via the Tn7-based transpositions (Fig. 1). We also identified a complete transposition unit flanked by 5 bp direct repeats (DR) (GTCCT) that bounded the tnsABCD-~4.64-kb region-silESRCBAP-~1.29-kb region-pcoEABCDRSE structure in the plasmid p3YG7T. Furthermore, a transposition unit containing the sil and pco operons, flanked by 5-bp DR (GGTCC or GTCCT), was also found in plasmids R478, pSH111-27, pAPEC-O1-R and pEC0527. These transposition units were all bordered by a 28 bp sequence (TGTCCGAGGACAATAAAGTTGTACACAA) at one end, and another 28 bp sequence (AAGGATACAACTTTAATGTCTCTACACA) at the other end. The two 28 bp sequences show 18-bp nucleotide identity. As Tn7 carries terminal inverted repeats of 28 bp35, we speculated that the two 28 bp sequences might serve as the invert repeats of Tn7-like transposons. These results revealed that Tn7-based transpositions may play a significant role in the spread of the sil and pco operons among IncHI2 plasmids.

A chromosomal integration of Tn7-like transposons carrying the pco and sil genes was also identified in Salmonella Senftenberg34. Tn7-based transposition appeared to be able to mobilize the sil and pco operons from plasmid into chromosome33. Interestingly, in the IncHI2 plasmids (R478, pSH111-27, and p3YG7T), the structures (tnsABCD-~4.64-kb region-silESRCBAP-~1.29-kb region-pcoEABCDRSE) were highly similar to that in chromosomes of five different genera (Fig. 1). This may implicate mobilization of the sil and pco operons from plasmids into chromosomes or conversely, from the chromosomes into plasmids via Tn7-based transposition. Further, phylogenetic analysis of this structure suggested that a Tn7-like transposon was involved in cross-genus transfer of the sil and pco operons among Enterobacteriaceae of diverse origins in many countries.

Copper has been commonly used as a feed additive in animal growth promotion as described above. Silver, on the other hand, is widely used in disinfectants during production or as animal antiseptics36,37. There is a strong association of heavy metal micronutrients in swine feed and the occurrence and persistence of multidrug-resistant bacteria38. Therefore, metal contamination may contribute to the persistence of the genetic platforms that carry metal and antibiotic resistance genes. These platforms include the IncHI2 plasmids and Tn7-like transposons which may serve to maintain and spread heavy metal-tolerant and multidrug-resistant Enterobacteriaceae.

In conclusion, we characterized 25 IncHI2 plasmids harboring blaCTX-M/oqxAB from E. coli isolates from diseased farm animals in China among 2002–2012. Co-spread of blaCTX-M/oqxAB with aac (6′)-Ib-cr, floR, fosA3 and rmtB, as well as the heavy metal resistance genes (pco and sil), were identified on the large and diverse ST3-IncHI2 plasmids. These IncHI2 plasmids carried the pco and sil operons also contributed to increasing in the MICs of CuSO4 and AgNO3. Further, ISEcp1 and IS26 were found to involve in spread of blaCTX-M and oqxAB, respectively. Tn7-like transposons were linked to dissemination of the sil and pco operons. This is the first report of co-existence of oqxAB, blaCTX-M, and the pco and sil operons on the same plasmids. This may promote the dissemination of multidrug-resistant isolates under the metal and antibiotic selective pressure. Increased surveillance of the multidrug-resistant IncHI2 plasmids in E. coli food-producing animals is urgently needed.

Materials and Methods

Bacterial strains

A total of non-duplicate 739 E. coli strains were isolated from viscera or feces samples from diseased food-producing animals, including ducks (203), chickens (110), geese (31) and pigs (395) between 2002 and 2012 as described previously10,39. The samples were recovered from more than 80 livestock farms throughout Guangdong province. E. coli isolates carrying the blaCTX-M and/or oqxAB genes (405/739) were selected in conjugation experiments by the broth-mating method using E. coli C600 (streptomycin-resistant; MIC >2000 μg/mL) as the recipient. The transconjugants were selected on MacConkey agar plates supplemented with streptomycin (500~1000 μg/mL) and cefotaxime (2 mg/L) or olaquindox (32~64 mg/L). The plasmids isolated from the transconjugants harboring blaCTX-M and/or oqxAB were further characterized by PCR-based replicon typing (PBRT) using PCR amplification/sequencing with IncHI2 primers as previously described40.

Antimicrobial susceptibility tests

For all of the transconjugants harboring IncHI2 plasmids, MICs of ampicillin (AMP), cefoxitin (FOX), ceftiofur (CIF), cefotaxime (CTX), amikacin (AMK), gentamicin (GEN), chloramphenicol (CHL), florfenicol (FLF), doxycycline (DOX), nalidixic acids (NAL), ciprofloxacin (CIP), olaquindox (OQX), sulfamethoxazole/trimethoprim (SXT), meropenem (MEO) were determined by the agar dilution method following the guidelines of Clinical and Laboratory Standards institute (CLSI). MIC of fosfomycin (FOS) was determined by the agar dilution method on Mueller-Hinton agar containing 25 μg/mL glucose 6-phosphate, according to guideline M100-S20 of the CLSI. The breakpoints for each antimicrobial were used as recommended by the CLSI (M100-S25) or CLSI (Vet01-A4/Vet01-S2)41,42. E. coli ATCC 25922 was used as a quality control strain. MICs of AgNO3 and CuSO4 were determined by broth microdilution method in an aerobic atmosphere as previously described33, with some modification. Briefly, the transconjugants harboring IncHI2 plasmids were incubated in Mueller-Hinton broth with serial dilutions of CuSO4 (0.25, 0.5, 1, 2, 4, 8, 12, 16, 20, 24, 32 and 36 mM, adjusted to pH 7.2) and AgNO3 (0.0004, 0.0008, 0.0015, 0.03, 0.06, 0.08, 0.125, 0.16, 0.25, 0.32, 0.5, 1.0 mM, adjusted to pH 7.4). E. coli C600 was used as a reference strain.

Detection of antimicrobial and heavy metal resistance determinants

ESBL-encoding genes (blaTEM, blaSHV, blaCTX-M-1G, blaCTX-M-9G, blaCTX-M-2G, and blaCTX-M-25G), pAmpCs-encoding genes (blaCMY-2), PMQR genes (qnrA, qnrB, qnrS, aac-(6′)-Ib-cr, qepA, oqxA and oqxB), exogenously acquired 16S rRNA methyltransferase (16S-RMTase) genes (rmtB and armA), fosfomycin resistance genes (fosA3, fosA, and fosC2) and the florfenicol resistance gene (floR) were detected among all of the transconjugants harboring IncHI2 plasmids by PCR amplification using primers published previously9,10,12,43,44. Metal resistance determinants, including terD, terF, terX and terY3 (conferring resistance to tellurium), merA and merC (conferring resistance to mercury), arsB and arsH (conferring resistance to arsenic), pcoA, pcoD and pcoE (conferring resistance to copper), silE and silP (conferring resistance to silver) were also detected among these transconjugants by PCR amplification (Table S1).

Plasmids analysis

Plasmids analysis was carried out in the transconjugants harboring IncHI2 plasmids by DNA linearization with S1 nuclease followed by PFGE analysis45. Salmonella enterica serotype Braenderup H9812 standards and Lambda Ladder PFG marker (NEB, Biolabs) were used as size markers. Southern blotting was carried out on S1-PFGE gels with digoxigenin-labelled probes specific for the IncHI2 replicon, oqxB, blaCTX-M-9G, blaCTX-M-1G, rmtB, pcoA and silE. Incompatibility (Inc) groups were assigned by PBRT of the transconjugants40. Plasmid double-locus sequence typing (pDLST) for IncHI2 plasmids was performed as previously described3. The IncHI2 plasmids were further analyzed by restriction fragment length polymorphism (RFLP) using XbaI as the restriction enzymes (TaKaRa Biotechnology, Dalian, China). Comparison of RFLP patterns was performed with BioNumerics®v6.6 (Applied Maths, Ghent, Belgium). Dendrograms were generated with the Dice similarity coefficient (1.5% optimization and 1.5% tolerance) using the unweighted pair group method with arithmetic mean. RFLP types were defined with ≥75% similarity between clusters. Additionally, to further understand the successful dissemination of the IncHI2 plasmids, plasmid addiction systems were determined25 and another three genes hipA, mucB and relE involving in plasmid stabilization system were also detected (Table S1).

Analysis of the genetic environment of resistance genes

The genetic context surrounding oqxAB and blaCTX-M on the IncHI2 plasmids were investigated by PCR mapping, inverse PCR and sequencing. The primers used to determine the regions upstream and downstream of the oqxAB and blaCTX-M genes are listed in Table S1. The genetic contexts of pco and sil genes on the IncHI2 plasmids were also explored by PCR mapping and primer walking. The region containing the pco and sil genes in plasmids pEC5207 (KT347600) was using as the reference sequence (Supplementary Table S2).

Nucleotide Sequence Accession Numbers

The two partial nucleotide sequences of plasmid pZ13T containing the sil operon and the pcoBCDRSE genes have been deposited into GenBank under accession numbers KU248944 and KU248943, respectively. The partial nucleotide sequences of plasmid p3YG7T containing the sil and pco operons has also been deposited into GenBank under accession numbers KU248945.

Additional Information

How to cite this article: Fang, L. et al. Co-spread of metal and antibiotic resistance within ST3-IncHI2 plasmids from E. coli isolates of food-producing animals. Sci. Rep. 6, 25312; doi: 10.1038/srep25312 (2016).

Supplementary Material

Supplementary Information
srep25312-s1.pdf (482.7KB, pdf)

Acknowledgments

This work was supported by the Program for Changjiang Scholars and Innovative Research Team in University of Ministry of Education of China (Grant No. IRT13063), the National Natural Science Foundation and Natural Science Foundation of Guangdong Province, China (Grant No. U1201214), the Natural Science Foundation of Guangdong Province (Grant No. S2012030006590), and the National Natural Science Fund of China (Grant No. 31402247).

Footnotes

Author Contributions L.F. performed experiments, analyzed the data and wrote the manuscript; X.L. and S.L. performed experiments; L.L. edited the manuscript; J.S. designed the experiments, analyzed the data, and edited the manuscript. X.L. and Y.L. coordinated the whole project.

References

  1. Villa L., Poirel L., Nordmann P., Carta C. & Carattoli A. Complete sequencing of an IncH plasmid carrying the blaNDM-1, blaCTX-M-15 and qnrB1 genes. J Antimicrob Chemother. 67, 1645–1650 (2012). [DOI] [PubMed] [Google Scholar]
  2. Dolejska M., Villa L., Poirel L., Nordmann P. & Carattoli A. Complete sequencing of an IncHI1 plasmid encoding the carbapenemase NDM-1, the ArmA 16S RNA methylase and a resistance-nodulation-cell division/multidrug efflux pump. J Antimicrob Chemother. 68, 34–39 (2013). [DOI] [PubMed] [Google Scholar]
  3. Garcia-Fernandez A. & Carattoli A. Plasmid double locus sequence typing for IncHI2 plasmids, a subtyping scheme for the characterization of IncHI2 plasmids carrying extended-spectrum beta-lactamase and quinolone resistance genes. J Antimicrob Chemother. 65, 1155–1161 (2010). [DOI] [PubMed] [Google Scholar]
  4. Garcia Fernandez A. et al. Comparative analysis of IncHI2 plasmids carrying blaCTX-M-2 or blaCTX-M-9 from Escherichia coli and Salmonella enterica strains isolated from poultry and humans. Antimicrob Agents Chemother. 51, 4177–4180 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Villa J. et al. Multiclonal spread of VIM-1-producing Enterobacter cloacae isolates associated with In624 and In488 integrons located in an IncHI2 plasmid. Int J Antimicrob Agents. 43, 451–455 (2014). [DOI] [PubMed] [Google Scholar]
  6. Miro E. et al. Spread of plasmids containing the bla(VIM-1) and bla(CTX-M) genes and the qnr determinant in Enterobacter cloacae, Klebsiella pneumoniae and Klebsiella oxytoca isolates. J Antimicrob Chemother. 65, 661–665 (2010). [DOI] [PubMed] [Google Scholar]
  7. Fischer J Fau - Rodriguez I. et al. Escherichia coli producing VIM-1 carbapenemase isolated on a pig farm. J Antimicrob Chemother. 67, 1793–1795 (2012). [DOI] [PubMed] [Google Scholar]
  8. Fischer J Fau – Rodriguez I. et al. Salmonella enterica subsp. enterica producing VIM-1 carbapenemase isolated from livestock farms. J Antimicrob Chemother. 68, 478–480 (2013). [DOI] [PubMed] [Google Scholar]
  9. Fang L. X. et al. Dissemination of the chromosomally encoded CMY-2 cephalosporinase gene in Escherichia coli isolated from animals. Int J Antimicrob Agents. 46, 209–213 (2015). [DOI] [PubMed] [Google Scholar]
  10. Liu B. T. et al. Dissemination and characterization of plasmids carrying oqxAB-blaCTX-M genes in Escherichia coli isolates from food-producing animals. PloS one. 8, e73947 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Li L. et al. Spread of oqxAB in Salmonella enterica serotype Typhimurium predominantly by IncHI2 plasmids. J Antimicrob Chemother. 68, 2263–2268 (2013). [DOI] [PubMed] [Google Scholar]
  12. Yang X.Y. et al. F33: A-: B-, IncHI2/ST3, and IncI1/ST71 plasmids drive the dissemination of fosA3 and blaCTX-M-55/-14/-65 in Escherichia coli from chickens in China. Front Microbiol. 5, 688; doi: 10.3389/fmicb.2014.00688 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Miró E. et al. Spread of plasmids containing the blaVIM-1 and blaCTX-M genes and the qnr determinant in Enterobacter cloacae, Klebsiella pneumoniae and Klebsiella oxytoca isolates. J Antimicrob Chemother. 65, 661–665 (2010). [DOI] [PubMed] [Google Scholar]
  14. Hansen L. H., Johannesen E., Burmolle M., Sorensen A. H. & Sorensen S. J. Plasmid-encoded multidrug efflux pump conferring resistance to olaquindox in Escherichia coli. Antimicrob Agents Chemother. 48, 3332–3337 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gilmour M. W., Thomson N. R., Sanders M., Parkhill J. & Taylor D. E. The complete nucleotide sequence of the resistance plasmid R478: defining the backbone components of incompatibility group H conjugative plasmids through comparative genomics. Plasmid. 52, 182–202 (2004). [DOI] [PubMed] [Google Scholar]
  16. Bolan N. S., Khan M., Donaldson J., Adriano D. & Matthew C. Distribution and bioavailability of copper in farm effluent. Sci Total Environ. 309, 225–236 (2003). [DOI] [PubMed] [Google Scholar]
  17. Cang L., Wang Y., Zhou D. & Dong Y. Heavy metals pollution in poultry and livestock feeds and manures under intensive farming in Jiangsu Province, China. J Environ Sci (China). 16, 371–374 (2003). [PubMed] [Google Scholar]
  18. Wales A. D. & Davies R. H. Co-Selection of Resistance to Antibiotics, Biocides and Heavy Metals, and Its Relevance to Foodborne Pathogens. Antibiotics. 4, 567–604 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hölzel C. S. et al. Heavy metals in liquid pig manure in light of bacterial antimicrobial resistance. Environl Res. 113, 21–27 (2012). [DOI] [PubMed] [Google Scholar]
  20. Summers A. et al. Mercury released from dental “silver” fillings provokes an increase in mercury-and antibiotic-resistant bacteria in oral and intestinal floras of primates. Antimicrob Agents Chemother. 37, 825–834 (1993). [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Toleman M. A. & Walsh T. R. Combinatorial events of insertion sequences and ICE in Gram-negative bacteria. FEMS Microbiol Rev. 35, 912–935 (2011). [DOI] [PubMed] [Google Scholar]
  22. Garcia A. et al. Acquisition and diffusion of blaCTX-M-9 gene by R478-IncHI2 derivative plasmids. FEMS Microbiol Lett. 271, 71–77 (2007). [DOI] [PubMed] [Google Scholar]
  23. Dolejska M., Villa L., Minoia M., Guardabassi L. & Carattoli A. Complete sequences of IncHI1 plasmids carrying blaCTX-M-1 and qnrS1 in equine Escherichia coli provide new insights into plasmid evolution. J Antimicrob Chemother. 69, 2388–2393 (2014). [DOI] [PubMed] [Google Scholar]
  24. Cain A. K. & Hall R. M. Evolution of IncHI2 plasmids via acquisition of transposons carrying antibiotic resistance determinants. J Antimicrob Chemother. 67, 1121–1127 (2012). [DOI] [PubMed] [Google Scholar]
  25. Mnif B. et al. Molecular characterization of addiction systems of plasmids encoding extended-spectrum beta-lactamases in Escherichia coli. J Antimicrob Chemother. 65, 1599–1603 (2010). [DOI] [PubMed] [Google Scholar]
  26. Foster T. Plasmid-determined resistance to antimicrobial drugs and toxic metal ions in bacteria. Microbiol Rev. 47, 361–409 (1983). [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Baker-Austin C., Wright M. S., Stepanauskas R. & McArthur J. Co-selection of antibiotic and metal resistance. Trends Microbiol. 14, 176–182 (2006). [DOI] [PubMed] [Google Scholar]
  28. Hou Y. & Taylor D. E. Incidence of tellurite resistance determinants among plasmids of different incompatibility groups. Plasmid. 32, 306–311 (1994). [DOI] [PubMed] [Google Scholar]
  29. Johnson T. J., Wannemeuhler Y. M., Scaccianoce J. A., Johnson S. J. & Nolan L. K. Complete DNA sequence comparative genomics, and prevalence of an IncHI2 plasmid occurring among extraintestinal pathogenic Escherichia coli isolates. Antimicrob Agents Chemother. 50, 3929–3933 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Gupta A., Matsui K., Lo J.-F. & Silver S. Molecular basis for resistance to silver cations in Salmonella. Nat Med. 5, 183–188 (1999). [DOI] [PubMed] [Google Scholar]
  31. Brown N. L., Barrett S. R., Camakaris J., Lee B. T. & Rouch D. A. Molecular genetics and transport analysis of the copper-resistance determinant (pco) from Escherichia coli plasmid pRJ1004. Mol Microbiol. 17, 1153–1166 (1995). [DOI] [PubMed] [Google Scholar]
  32. Deng H. et al. Prevalence of extended-spectrum cephalosporin-resistant Escherichia coli in a farrowing farm: ST1121 clone harboring IncHI2 plasmid contributes to the dissemination of blaCMY-2. Front Microbiol. 6, 1210; doi: 10.3389/fmicb.2015.01210 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Randall C. P., Gupta A., Jackson N., Busse D. & O’Neill A. J. Silver resistance in Gram-negative bacteria: a dissection of endogenous and exogenous mechanisms. J Antimicrob Chemother. 70, 1037–1046 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Switt A. M. et al. Identification and characterization of novel Salmonella mobile elements involved in the dissemination of genes linked to virulence and transmission. PloS one. 7, e41247–e41247 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Rogers M., Ekaterinaki N., Nimmo E. & Sherratt D. Analysis of Tn7 transposition. Mol Gen Genet. 205, 550–556 (1986). [DOI] [PubMed] [Google Scholar]
  36. Mijnendonckx K., Leys N., Mahillon J., Silver S. & Van Houdt R. Antimicrobial silver: uses, toxicity and potential for resistance. Biometals. 26, 609–621 (2013). [DOI] [PubMed] [Google Scholar]
  37. Maillard J.-Y. & Hartemann P. Silver as an antimicrobial: facts and gaps in knowledge. Crit Rev Microbiol. 39, 373–383 (2013). [DOI] [PubMed] [Google Scholar]
  38. Medardus J. J. et al. In-feed use of heavy metal micronutrients in US swine production systems and its role in persistence of multidrug-resistant salmonellae. salmonellae Appl Environ Microbiol. 80, 2317–2325 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yang Q. E. et al. IncF plasmid diversity in multi-drug resistant Escherichia coli strains from animals in China. Front Microbiol. 6, 964; 10.3389/fmicb.2015.00964 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Carattoli A. et al. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 63, 219–228 (2005). [DOI] [PubMed] [Google Scholar]
  41. CLSI. Performance Standards for Antimicrobial Susceptibility Testing. CLSI document M100-S25. (Clinical and Laboratory Standards Institute, 2015).
  42. CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacterial Isolated from Animals. Approved Standard-Fourth Edition and Supplement. CLSI documents VET 01-A4 and VET01-S2. (Clinical and Laboratory Standards Institute, 2013).
  43. Deng Y. et al. Dissemination of IncFII plasmids carrying rmtB and qepA in Escherichia coli from pigs, farm workers and the environment. Clin Microbiol Infect 17, 1740–1745 (2011). [DOI] [PubMed] [Google Scholar]
  44. Chen S. et al. Characterization of multiple-antimicrobial-resistant salmonella serovars isolated from retail meats. Appl Environ Microbiol. 70, 1–7 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Barton B. M., Harding G. P. & Zuccarelli A. J. A general method for detecting and sizing large plasmids. Anal Biochem. 226, 235–240 (1995). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information
srep25312-s1.pdf (482.7KB, pdf)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES