Skip to main content
Acta Veterinaria Scandinavica logoLink to Acta Veterinaria Scandinavica
. 2016 May 4;58:28. doi: 10.1186/s13028-016-0210-y

Identification of additional mitochondrial DNA mutations in canine mast cell tumours

Anna Śmiech 1,✉, Brygida Ślaska 2, Magdalena Surdyka 2, Ludmiła Grzybowska-Szatkowska 3, Wojciech Łopuszyński 1, Dorota Różańska 4
PMCID: PMC4855722  PMID: 27146669

Abstract

Background

Research has revealed the presence of somatic mutations in mitochondrial DNA (mtDNA) of certain types of tumours. As this has not been studied for canine mast cell tumours, the aim of this study was to identify mutations in the hypervariable region of mtDNA in mast cell tumours in dogs and determine their association with the process of neoplastic transformation.

Results

Samples from 17 dogs with histopathologically confirmed mast cell tumours were analysed. The samples consisted of tumour tissues (n = 17), normal tissues (n = 17), and blood (n = 17). Amplicons of the displacement loop (D-loop) were sequenced and the obtained nucleotide sequences were subjected to bioinformatics analyses. Somatic mutations were detected in seven positions of the D-loop nucleotide sequences in 47 % of the dogs, while polymorphisms were identified in 94 % of the dogs. Most of these changes were homoplasmic, while heteroplasmy was detected in two individuals. Six new haplotypes were established as being characteristic for canine mast cell tumours. There was no association between the presence of the mutations and sex, haplotype, or malignancy grade assessed in 3 and 2-grade scales.

Conclusions

Differences in the frequency of somatic mutations imply their direct association with the neoplastic transformation. However, their functional consequences and clinical significance are not clear. The mutations may be used for diagnosis and prognosis of canine mast cell tumours in the future.

Keywords: Tumour, Dog, D-loop, mtDNA, Mutations

Findings

Mast cell tumours account for 7–21 % of all diagnosed skin neoplasms in dogs [1]. The aetiology of mast cell tumour development is not fully understood but recent research of human tumours has revealed the presence of somatic mutations in mitochondrial DNA (mtDNA), in particular in the D-loop region, which controls replication and transcription of mtDNA [2, 3].

Somatic cells contain hundreds to several thousand mitochondria, each containing 1–10 gene copies of mtDNA, which often undergoes spontaneous mutations due to their lack of protective activity of histones, the globular, coiled structure of mtDNA and a high level of mitochondrial reactive oxygen species (ROS). When a cell or tissue contains both mutated and normal wild-type mtDNA, the condition is known as heteroplasmy, while homoplasmy refers to the presence of only one type of mtDNA (mutated or normal mtDNA). Most changes within the mtDNA nucleotide sequences of neoplastic cells are homoplastic [3].

Investigations of the association between mtDNA somatic mutations and neoplastic transformation have primarily been conducted in humans [2–4] where somatic mtDNA mutations have been found in malignant tumours such as prostate and breast cancer. Such mutations are considered to trigger the neoplastic transformation through shifts of cell energy resources, an increase in the mitochondrial oxidative stress, and modulation of apoptosis [3]. Only a few studies have been carried out on canine tumours [5–9]. Bertagnolli et al. [5] investigated mixed canine mammary tumours and performed an analysis of a fragment of the D-loop of mtDNA from epithelial and mesenchymal tumour components. They identified nucleotide changes that could serve as molecular markers for establishing the origin of neoplastic cells. An association between a nuclear and/or mtDNA mutation and malignant transformation has been observed for canine tumours in other studies [6–9]. Slaska et al. [7, 8] observed somatic mutations in the D-loop region of mtDNA in 62 % of examined epithelial tumours and in 25 % of mesenchymal tumours. In another study, no mutations in mesenchymal tumours were been found, whereas 50 % of epithelial tumours exhibited somatic mutations. Blood and tumour heteroplasmy in the D-loop region has been diagnosed in dogs with squamous cell carcinoma, comedo carcinoma of the mammary gland, and sweat gland carcinoma [7, 8].

Besides the D-loop, three mtDNA genes, i.e. the NADH dehydrogenase subunit 1 (ND1), cytochrome c oxidase subunit I (COI), and cytochrome b (CYTB) have been analysed in different canine tumour types. The results showed that polymorphisms in these genes influenced the function of proteins and thus their potential role in carcinogenesis [9].

Presence of mtDNA defects in canine mast cell tumours has not been reported. The aim of this study was therefore to identify mutations in the hypervariable region of mtDNA in canine mast cell tumours and to assess their association with the process of neoplastic transformation.

Complete sets of tumour tissues, normal skin tissues and blood (n = 17) were obtained from 17 dogs with mast cell tumours that had undergone surgery. Normal and tumour tissues were sampled for histopathology and were fixed in buffered formalin, pH = 7.2, processed routinely, embedded in paraffin wax, sectioned at 4 µm and stained with haematoxylin-eosin and toluidine blue. Microscopic classification was performed in accordance with the WHO histological classification [10]. The degree of malignancy was assessed using both a 3-grade scale [11] and a 2-grade scale [12]. The dogs were divided into three groups according to age: I (up to 5 years), II (from 6 to 9 years), and III (over 10 year-old).

DNA was extracted from tissues and blood with the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany). DNA samples were assessed quantitatively and qualitatively by electrophoretic separation in agarose gel and spectrophotometrically by measurements of sample absorbance in a BioPhotometer spectrophotometer (Eppendorf, Hamburg, Germany). Amplification of the D-loop was performed, using a polymerase chain reaction (PCR) technique in a T100 Thermal Cycler (Bio-Rad, Wroclaw, Poland). Primer sequences used in the analysis, encompassing a mtDNA fragment between nucleotide 15746–16107 (LF 5′- CATACTAACGTGGGGGTTAC; HR 5′- CCATTGACTGAATAGCACCTTG), were based on already published data [13]. The annealing temperature (Ta-60.8 °C) and amplification conditions were established experimentally. Amplification products were visualized on 2 % agarose gel. Amplicons were sequenced using a BigDye Terminator Cycle Sequencing kit (Applied Biosystem, Foster City, CA, USA) in GeneAmp PCR system 9700 (Applied Biosystem). The samples were subsequently purified on CentriSep columns according to the manufacturer’s protocol or precipitated with ethanol and sodium acetate according to the protocol of the BigDye kit manufacturer. Extension products were separated on an ABI 377 automated sequencer (Applied Biosystem).

The obtained nucleotide sequences were subjected to bioinformatics analyses in order to determine mutation and polymorphic sites within the mtDNA fragment of each sample (DNA Baser Sequence Assembler v 3.2). The D-loop nucleotide sequences were compared to the reference sequence [GenBank: U96639] [14, 15] and described as the polymorphisms. The hypervariable region I (HVI) dog haplotypes were established according to Savolainen et al. [16], Pereira et al. [17], and Imes et al. [18].

The probability of the presence of a mutation in each locus in relation to the age, sex, haplotype, and malignancy grade was estimated using the method of least-squares means (lsm) ± standard error (se). The correlation between the data was analysed using the SAS 9.4 procedure PROC GLM (SAS Institute, Cary, NC, USA). Correlations with P ≤ 0.05 were considered significant.

The study was approved by the II Local Ethical Commission for Animal Experiments in Lublin, Poland (Resolution number 6/2013).

Data on sex, breed, age and malignancy grade of the dogs are presented in Table 1. Mutations and/or polymorphisms were observed in eight positions of the D-loop nucleotide sequences in all cases (n = 17) of mast cell tumours (Tables 2, 3). Somatic mutations in seven positions of the D-loop nucleotide sequences were detected in 47 % of the dogs (Table 2). All changes were substitution mutations, i.e. exchange of one nucleotide base with another. These mutations were detected in the tumour tissue and blood, but not in the normal tissues. The majority of the changes were homoplasmic. In one dog, heteroplasmy was detected in the blood and tumour in position m.C15815C/T (Table 2); in another dog, heteroplasmic changes were found only in the tumour in positions m.C15912T/C and m.C16025T/C (Fig. 1). Somatic mutations in tumour tissues in positions m.16003 (Fig. 2) and m.15912 mtDNA exhibited the highest frequency, in approximately 35 and 24 % of the cases, respectively. These mutations were also detected in the blood of one dog.

Table 1.

Data on dogs with mast cell tumours included in the study

Dog number HVI dog haplotype Sex Breed Age (years) Grading according to Patnaik et al. [11], Kiupel et al. [12]
1 B1 F Dachshund 9 Grade III/high-grade
2 A18 F Bavarian Mountain Hound 9 Grade III/high-grade
3 A26 F St. Bernard 6 Grade II/high-grade
4 B11 M French Bulldog 10 Grade II/low-grade
5  B1 F Crossbreed 6 Grade I/low-grade
6 A17 M Boxer 8 Grade I/low-grade
7 B1 F Schnauzer 8 Grade II/low-grade
8 A18 F Boxer 8 Grade II/low-grade
9 A18 F Golden Retriever 4 Grade I/low-grade
10 A18 F Central Asian 4 Grade II/high-grade
11 A18 F Crossbreed 8 Grade II/low-grade
12 A17 M Labrador 10 Grade II/low-grade
13 A19 F Crossbreed 11 Grade II/low-grade
14 A26 F Labrador 3,5 Grade II/low-grade
15 A18 F Bernese Mountain Dog 8 Grade II/high-grade
16 A18 F Crossbreed 15 Grade II/low-grade
17 A18 F Bernese Mountain Dog 9 Grade III/high-grade

Table 2.

Somatic mutations in the D-loop sequence in normal tissue, blood and tumour tissue in cases of canine mast cell tumours

Dog number Sequences in normal tissue Sequences in blood Sequences in tumour tissue HVI haplotype (normal tissue → tumour tissue)
1 m.15815C m.15815C/T m.15815C/T B1 → B1/B37
2 m.15800T m.15800T m.15800C A18 → B37
m.15912C m.15912C m.15912T
m.15955C m.15955C m.15955T
m.16003A m.16003A m.16003G
3 m.15912C m.15912C m.15912T/C A26 → A101*/102*
m.16003A m.16003A m.16003G
m.16025C m.16025C m.16025T/C
4 m.15800 T m.15800 T m.15800 C B11* → A172*
5 m.15800C m.15800T m.15800T B1 → A17
m.15815C m.15815T m.15815T
m.15912T m.15912C m.15912C
m.16003G m.16003A m.16003A
6 m.15795C m.15795C m.15795T A17 → A173*
7 m.16003G m.16003G m.16003A B1 → B12*
13 m.16003A m.16003A m.16003G A19 → A191*

Somatic mutations in the D-loop sequence were present in 8 out of 17 dogs

* Recently reported haplotypes [16–18]

Table 3.

Differences in the mitochondrial D-loop region between the reference sequence and normal tissue, blood and tumour tissue sequences in cases of canine mast cell tumours

Dog number Reference sequence Sequence in normal cells Sequence in blood Sequence in tumour cells
1 m.15800T m.15800C m.15800C m.15800C
1–12, 14–17 m.15814C m.15814T m.15814T m.15814T
7 m.15815T m.15815C m.15815C m.15815C
1, 7 m.15912C m.15912T m.15912T m.15912T
1, 4–7, 12 m.15955C m.15955T m.15955T m.15955T
1 m.16003A m.16003G m.16003G m.16003G
14 m.16025T m.16025C m.16025C m.16025C

Differences were not present in one of the studied dogs (no. 13)

Fig. 1.

Fig. 1

Cancer heteroplasmy in position m.16025 (a normal tissue, b blood, c tumour tissue)

Fig. 2.

Fig. 2

Mutation in tumour tissue in position m.16003 (a normal tissue, b blood, c tumour tissue)

Recently reported tumour haplotypes (except B11) were present in tumour tissue but not in normal tissue or blood (Table 2). The HVI dog haplotype A18, accounting for 41.7 % in normal tissue and blood, was the most prevalent haplotype in each type of the analysed tissues. In tumour tissue, it was present in 41.2 % of the tumours. The mtDNA haplotype was changed in all dogs with detected mutations; hence, six not previously reported haplotypes of mast cell tumours were detected. Compared to the reference canine sequence, polymorphisms (m.T15800C, m.C15814T, m.T15815C, m.C15912T, m.C15955T, m.A16003G, m.T16025C) were found in seven positions of the D-loop sequences in 16 of 17 dogs (94 %) with mast cell tumours (Table 3). In most dogs (94 %) polymorphism was detected in position m.C15814T, while polymorphism at D-loop position m.C15955T was found in 35 % of the examined dogs (Table 3).

Mutations in loci m.15912 and m.16003 were only detected in dogs aged six year or older (age groups II and III). The risk of mutation in locus m.16003 was significantly higher in the oldest dogs (age group III) compared to the youngest dogs (P = 0.047). However, since the group sizes were limited, these data should be interpreted with care. Statistical analyses did not reveal an association between presence of mutations and sex, haplotype, or the tumour malignancy grades (Tables 1 and 2).

Analysis of the D-loop sequences revealed a relatively high genetic variability. As the mutations occurred independently of the mast cell tumour malignancy grades, this indicates that the presence of mutations in the D-loop and the malignancy grade was not associated. Mutations in the mtDNA sequences and sex or haplotype were not associated as also observed for other types of canine tumours [7–9]. Some of the observed mutations (except m.16003 and m.16025) have been recognized in other types of canine tumours previously [5]. These were mostly homoplasmic substitution mutations although single heteroplasmy mutations were found as well.

Presence of mutations in the D-loop sequences in tumour tissue and/or blood of dogs with mast cell tumours indicates that they may be involved in the process of neoplastic transformation. Further studies on the significance of mtDNA D-loop mutations and their association with neoplastic transformation, biological behaviour, and histologic grade of canine mast cell tumour are however required to determine their significance.

Authors’ contributions

AS and BS participated in the design of the study, analyses and drafted the manuscript. MS participated in molecular genetic study. LGSz participated in the analyses of the results. WL performed the histopathological examination. DR collected samples and data on breed, age and sex of dogs. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Contributor Information

Anna Śmiech, Email: anna.smiech@up.lublin.pl.

Brygida Ślaska, Email: brygida.slaska@up.lublin.pl.

Magdalena Surdyka, Email: magda.surdyka@gmail.com.

Ludmiła Grzybowska-Szatkowska, Email: ludgr@poczta.onet.pl.

Wojciech Łopuszyński, Email: wojciech.lopuszynski@up.lublin.pl.

Dorota Różańska, Email: drrozanska@gmail.com.

References

  • 1.Welle MM, Bley CR, Howard J, Rüfenacht S. Canine mast cell tumours: a review of the pathogenesis, clinical features, pathology and treatment. Vet Dermatol. 2008;19:321–339. doi: 10.1111/j.1365-3164.2008.00694.x. [DOI] [PubMed] [Google Scholar]
  • 2.Czarnecka AM, Golik P, Bartnik E. Mitochondrial DNA mutations in human neoplasia. J Appl Genet. 2006;47:67–78. doi: 10.1007/BF03194602. [DOI] [PubMed] [Google Scholar]
  • 3.Grzybowska-Szatkowska L, Slaska B. Mitochondrial DNA and carcinogenesis. Mol Med Rep. 2012;6:923–930. doi: 10.3892/mmr.2012.1027. [DOI] [PubMed] [Google Scholar]
  • 4.Grzybowska-Szatkowska L, Slaska B. Mitochondrial NADH-dehydrogenase polymorphisms are associated with breast cancer in Poland. J Appl Genet. 2014;55:173–181. doi: 10.1007/s13353-013-0190-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bertagnolli AC, Sores P, Van Asch B, Amorim A, Cirnes L, Maximo V, et al. An assessement of the clonality of the components of canine mixed mammary tumours by mitochondrial DNA analysis. Vet J. 2009;182:269–274. doi: 10.1016/j.tvjl.2008.07.005. [DOI] [PubMed] [Google Scholar]
  • 6.Gurgul A, Żukowski K, Ślaska B, Semik E, Pawlina K, Ząbek T, et al. General assessment of copy number variation in normal and tumor tissues of the domestic dog (Canis lupus familiaris) J Appl Genet. 2014;55:353–363. doi: 10.1007/s13353-014-0201-5. [DOI] [PubMed] [Google Scholar]
  • 7.Slaska B, Grzybowska-Szatkowska L, Surdyka M, Nisztuk S, Rozanska D, Rozanski P, et al. Mitochondrial D-loop mutations and polymorphisms are connected with canine malignant cancers. Mitochondr DNA. 2014;25:238–243. doi: 10.3109/19401736.2013.792054. [DOI] [PubMed] [Google Scholar]
  • 8.Ślaska B, Surdyka M, Brodzki A, Nisztuk S, Gurgul A, Bugno-Poniewierska M, et al. Mitochondrial D-loop mutations can be detected in sporadic malignant tumours in dogs. Bull Vet Inst Pulawy. 2014;58:631–637. [Google Scholar]
  • 9.Slaska B, Grzybowska-Szatkowska L, Nisztuk S, Surdyka M, Rozanska D. Mitochondrial DNA polymorphism in genes encoding ND1, COI and CYTB in canine malignant cancers. Mitochondr DNA. 2015;26:452–458. doi: 10.3109/19401736.2013.840594. [DOI] [PubMed] [Google Scholar]
  • 10.Hendrick MJ, Mahaffey EA, Moore JH, Walder EJ. Histological Classification of Mesenchymal Tumors of Skin and Soft Tissues of Domestic Animals. In: WHO International Histological Classification of Tumors of Domestic Animals. Second Series. Washington: Armed Forces Institute of Pathology; 1998. Vol. 2 p. 28–9.
  • 11.Patnaik AK, Ehler WJ, Macewen EG. Canine cutaneous mast cell tumour: morphologic grading and survival time in 83 dogs. Vet Pathol. 1984;21:469–474. doi: 10.1177/030098588402100503. [DOI] [PubMed] [Google Scholar]
  • 12.Kiupel M, Webster JD, Bailey KL, Best S, Delay J, Detrisac CJ, et al. Proposal of a 2-tier histologic grading system for canine cutaneous mast cell tumors to more accurately predict biological behavior. Vet Pathol. 2011;48:147–155. doi: 10.1177/0300985810386469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Van Asch B, Albarran C, Alonso A, Angulo R, Alves C, Betancor E, et al. Forensic analysis of dog (Canis lupus familiaris) mitochondrial DNA sequences: an inter-laboratory study of the GEP-ISFG working group. Forensic Sci Int Genet. 2009;4:49–54. doi: 10.1016/j.fsigen.2009.04.008. [DOI] [PubMed] [Google Scholar]
  • 14.DNA baser sequence assembler 3.2. Heracle BioSoft SRL Romania. 2012. http://www.DnaBaser.com. Accessed 10 June 2015.
  • 15.Kim KS, Lee SE, Jeong HW, Ha JH. The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome. Mol Phylogenet Evol. 1998;10:210–220. doi: 10.1006/mpev.1998.0513. [DOI] [PubMed] [Google Scholar]
  • 16.Savolainen P, Zhang YP, Luo J, Lundeberg J, Leitner T. Genetic evidence for an East Asian origin of domestic dogs. Science. 2002;298:1610–1613. doi: 10.1126/science.1073906. [DOI] [PubMed] [Google Scholar]
  • 17.Pereira L, Van Asch B, Amorim A. Standardisation of nomenclature for dog mtDNA D-loop: a prerequisite for launching a Canis familiaris database. Forensic Sci Int. 2004;141:99–108. doi: 10.1016/j.forsciint.2003.12.014. [DOI] [PubMed] [Google Scholar]
  • 18.Imes DL, Wictum EJ, Allard MW, Sacks BN. Identification of single nucleotide polymorphisms within the mtDNA genome of the domestic dog to discriminate individuals with common HVI haplotypes. Forensic Science International: Genetics. 2012;6:630–639. doi: 10.1016/j.fsigen.2012.02.004. [DOI] [PubMed] [Google Scholar]

Articles from Acta Veterinaria Scandinavica are provided here courtesy of BMC

RESOURCES