Abstract
Shankhpushpi is a reputed drug from an Indian system of medicine for treating mental disorders and enhancing memory. Two herbs, namely Convolvulus prostratus Forssk. and Evolvulus alsinoides (L.) L., are commonly known as Shankhpushpi. Ambiguous vernacular identity can affect the scientific validity of the Shankpushpi-based herbal drug therapy. In the present investigation, a novel and sensitive multiplex PCR method based on polymorphism in the internal transcribed spacer (ITS) region was developed to establish the molecular identity of C. prostratus and E. alsinoides. DNA was isolated and the ITS region was amplified, sequenced and assembled. Sequences were aligned to identify variable nucleotides in order to develop plant-specific primers. Primers were validated in singleplex reactions and eventually a multiplex assay was developed. This assay was tested for sensitivity and validated by amplifying DNA isolated from the simulated blended powdered plant material. Primers developed for C. prostratus resulted into a 200 bp amplicon and 596 bp for E. alsinoides. The assay was found to be sensitive enough for amplification of low quantities of DNA. The method can detect 10% of the mixing of plants with each other in blended material. This PCR assay can be used for rapid botanical identification of Shankhpushpi plant materials and will improve evidence-based herbal drug therapy.
KEY WORDS: PCR, Internal transcribed spacers, Shankhpushpi, Botanical identification, Adulteration, Substitution, Herbal drugs, DNA barcoding
Graphical abstract
Shankhpushpi is a reputed drug from an Indian system of medicine for treating mental disorders and enhancing memory. Two herbs, namely Convolvulus prostratus Forssk. and Evolvulus alsinoides (L.) L., are commonly known as Shankhpushpi. Ambiguous vernacular identity can affect the scientific validity of the Shankpushpi-based herbal drug therapy. In the present investigation, a novel and sensitive multiplex PCR method based on polymorphism in the internal transcribed spacer (ITS) region was developed to establish the molecular identity of C. prostratus and E. alsinoides.

1. Introduction
Convolvulus prostratus Forssk. (CP) syn Convolvulus microphyllus Sieb. ex Spreng syn Convolvulus pluricaulis Choisy, vernacularly known as Shankhpushpi1, 2, is reputed to be “medhya rasayna” (“wisdom drug”) in the Ayurvedic system of medicine. The whole plant is used as a drug to boost memory, improve cognitive functions and to treat central nervous system (CNS) disorders like psychosis, epilepsy and Alzheimer׳s disease3, 4, 5. The major chemical constituents of the plant are carbohydrates, fatty acids, alkaloids and coumnarins which are believed to work in synergy to produce desired effects in these disorders. The term “Shankhpushpi” has plurality and is also equated with Evolvulus alsinoides (L.) L.3. The whole plant of E. alsinoides is also reported to have therapeutic properties to increase intellect, improve learning, and enhance memory6, along with other medical applications7, 8. Controversial and ambiguous vernacular identity of Shankhpushpi can present a challenge for correct plant identification, which is the first step for preparation of safe and efficacious herbal drugs. Market examination of crude drugs sold as Shankhpushpi, indicated the presence of E. alsinoides (EA) as the major substituent and mixing material9. Moreover, extensive and systematic information about the bioactive compounds of these two plants is needed to check comparable therapeutic effects when E. alsinoides is used as substituent5. However, comparative pharmacological evaluation of plant extracts for CNS activities from these two plants species have established the superiority of C. prostratus5, 9. In order to unequivocally identify the original botanicals and to maintain the scientific validity of Shankhpushpi-based drugs, various approaches have been reported3, 10, 11. These methods were based on conventional pharmacognosy and phytochemical analytical techniques. Utilization of these methods is restricted by their dependency on personal expertize and low sensitivity for the processed material (powder, capsules and tablets) in which taxonomic characteristics can degrade. In addition, identification with chemical techniques can fluctuate with mutable environmental and geographical conditions12. These limitations have raised the need for developing additional DNA-based approaches to identify the Shankhpushpi plant species. These methods can be used independently and also as auxiliary tools in conjunction with the conventional methods to enhance the validity of plant identification13, 14.
In the present study we have developed a PCR-based method for the rapid molecular identification of individual species and to differentiate two Shankhpushpi plant species CP and its closely related substituent EA15, 16. The assays were developed for both processed and unprocessed material using sequences of the internal transcribed spacer (ITS) locus of nuclear DNA. The ITS region represents a nonfunctional sequence present between highly conserved rRNA genes. It can be divided into two regions namely ITS1 and ITS2 which are interrupted by a 5.8s rRNA gene sequence. This array ITS1-5.8s rRNA gene-ITS2 is flanked by 18s rRNA and a 26s rRNA gene sequences. This tandem array is spread randomly in the nuclear genome and is recommended as one of the DNA barcoding tools for plants to differentiate between closely related species17.
2. Material and methods
2.1. Plant collection
Whole plant samples of CP and EA were collected from seven different locations in India during their flowering season (Table 1). At least three samples of each species were collected from each location. Plants were authenticated with the help of taxonomist and voucher specimens were submitted to the herbarium division of our institute. The samples were stored at −20 °C prior to analysis (unprocessed material). Some amounts (2–5 g) of the samples were heat dried at 45 °C for 48 h and then powdered (considered as processed material).
Table 1.
Description of plant samples and their geographical origin.
| Plant species | Location |
|---|---|
| C. prostratus | Anand, Gujarat (Vouchered-BVPPERD/PP/04/13/01) |
| Udaipur, Rajasthan | |
| Boriavi, Gujarat | |
| Dholka, Ahmedabad, Gujarat | |
| Kota, Rajasthan | |
| E. alsinoides | Pune, Maharashtra (Vouchered-BVPPERD/PP/08/12/10 ) |
| Anand, Gujarat. |
2.2. DNA isolation, amplification and sequencing of ITS locus
DNA was isolated from leaf tissue of both the plants using the CTAB method18 and was used for amplification of the ITS locus. ITS regions from CP and EA were amplified using universal primer pairs19. Amplification was carried out in 25 µL reaction volume with 1×Taq buffer, 2 mmol/L MgCl2, 200 µmol/L dNTP, 10 pmol of the forward (ITS5) and reverse primers (ITS4), 1U of Taq polymerase and 40–60 ng of DNA template, 5% DMSO (dimethyl sulphoxide) and 0.5 µg/µL BSA (bovine serum albumin). The reaction was performed as follows: initial denaturation 94 °C (10 min), 30 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 45 s, polymerization at 72 °C 1 min which was finally extended at 72 °C for 5 min. The amplicons thus obtained were subjected to bidirectional sequencing.
2.3. Sequence assembly, analysis and characterization
Sequences of ITS loci of both plants were analyzed for quality and assembled using Sequence analysis vs 5.2 (Applied Biosystem, USA) and Codon Code Aligner v.6.0.1 (Codon Code, Dedham, Massachusetts, USA) software respectively. Determination of sequence boundaries and verification of the contigs were done using BLAST search20. The sequences thus obtained were submitted to NCBI (Accession numbers CP-KC688313, EA- KC688314). The sequences were also characterized in terms of length, aligned length, guanine-cytosine (GC) content, conserved and variable sites using MEGA software v.5.121.
2.4. Selection of plant-specific primers
Plant-specific primers were designed manually using variable sites, determined within the aligned ITS sequences of both the plants using the ClustalW tool (MEGA vs 5.1)21. Groups of feasible primers were subjected to OligoCalc22 and Primer3 software23 for in silico selection of best suitable primers on the basis of optimal length, optimum GC content, melting temperature compatibility, hairpin formation, secondary structure and species specificity. In silico verified primers were experimentally validated in various singleplex PCR in order to identify optimum annealing temperatures, to check the amplifiability of the primers for their respective species samples and cross amplifiability of the primers with opposite species. The primer finally selected for CP (5′ TTGGCCTAAATGCGAGTCTT 3′) was 20 bp long with a melting temperature of approximately 56 °C. The calculated melting temperature of 21 bp long EA specific primer (5′ TGTTTAAACACCATACCGCGG 3′) was approximately 59 °C. Primer3 software was also used to determine approximate lengths of the amplicons which were 200 bp for CP and 596 bp for EA.
2.5. Multiplex PCR assay for CP and EA
Molecular identity of the individual plants (CP and EA) and their mixtures (both processed and unprocessed) was established by developing multiplex PCR assay. The optimized final reaction conditions were as follows: a total 25 µL multiplex reaction mixture was added with 1×Taq buffer, 2.50 mmol/L MgCl2, 200 µmol/L dNTP, 20 pmol primer of CP, 2 pmol primer of EA, reverse primer (ITS4) 10 pmol, Taq Polymerase 1 U and the reaction was supplemented with BSA (0.5 µg/µL). Concentration of primer specific for EA was increased up to 6 pmol for amplification from dried samples. PCR amplifications were carried out in ABI light thermal cycler and performed according to following PCR conditions as initial denaturation at 94 °C for 10 min, 35 cycles of denaturation at 94 °C for 1 min, annealing at 60 °C for 20 s and polymerization at 72 °C for 1 min subsequently final extension was carried out at 72 °C for 5 min.
2.6. Specificity and sensitivity of the assays
The specificity in multiplex assay was verified by including two cross controls i.e. in control-1 DNA of CP was mixed with both the primers and in control-2 DNA of EA was mixed with both the primers. All the PCR assays were tested for their sensitivity. Different dilutions of DNA of each plant were made (2, 5, 10, 25, 50, 75 and 100 ng) to test the limit of amplification and detection on agarose gel.
2.7. Validation of multiplex PCR assay and analysis of PCR products
The developed multiplex PCR method was further validated by amplifying DNA isolated from the mixture of processed material. The mixing was done in various ratios to imitate possibility of commercial adulteration and substitution. Plants material was mixed in various ratios viz. 10:90, 30:70, 50:50, 70:30 and 90:10 (CP:EA). DNA was isolated from each mixture and subjected to amplification with developed multiplex PCR assay. PCR products were analyzed using agarose gel electrophoresis.
3. Results and discussion
The use of authentic botanicals is the very first level of quality control for herbal drugs. Lacking of originals can pose negative impact on the efficacy of finished products and hence, on consumer's belief. Therefore, use of authentic species is essential to maintain the growth and development of medicinal plant sectors. DNA diagnostics have become the gold standard for scientific validation of herbal products14, 24. Previously, random amplification polymorphic DNA (RAPD) markers were developed to authenticate Shankhpushpi species25 as well as for genetic diversity analysis1, 26. However, reproducibility and differential expertize of various laboratories are the major limitations of this technique27. Molecular authentication processes based on the DNA sequencing are comparatively more effective and economical27. Among the sequence-based methods, DNA barcoding is the most recent28, 29. Application of standard DNA barcoding has been extended further in various investigations by developing various methodologies like conventional and quantitative PCR, Bar-HRM (DNA barcode high-resolution melting curve analysis), LAMP (loop mediated isothermal amplification) and high throughput next generation sequencing, to identify plant species30, 31. In the present investigation a multiplex PCR was developed for molecular identification (Fig. 1) of CP and EA32. The method employs the universality and precision of DNA barcoding with the added advantage of rapidity of PCR. This procedure is based on variability in the sequence of the ITS region. The assays developed here are suitable to identify both the plants in the original and the dried (processed) forms.
Figure 1.
(A) Schematic representation of the method development. (B) Representation of different amplicon sizes.
DNA isolated from both plants was subjected to qualitative and quantitative analysis with agarose gel electrophoresis and UV spectrophotometry. Prominent bands of DNA were observed on the gel (Supplementary Fig. 1). UV analysis showed 260/280 ratio as 1.4–1.8 indicating DNA purity. ITS region from both the species were amplified, sequenced and assembled into consensus. The lengths for CP and EA, ITS consensus were 676 bp and 686 bp, respectively. BLAST search of these contigs revealed their novelty and authenticity as first 100 BLAST outputs were matched with the same species or the genus. Sequences characteristics of the ITS loci of both the plants are given in Supplementary Table 1. Both consensus sequences were aligned with clustal W which were used to find variable nucleotides to design specific primers for each plant (Fig. 2).
Figure 2.
Aligned ITS sequences of CP and EA. Species specific primers attachment sites are marked with arrows.
Primers were selected based on bioinformatics and experimental analysis in various singleplex reactions (Supplementary Fig. 2). Subsequently, a multiplex PCR was developed. Amplicons generated in the final multiplex reactions were analyzed on 1.8% agarose gel. Two different bands of size 596 bp and 200 bp were seen on the gel specific to EA and CP, respectively, without any cross reactivity between the plants (Fig. 3). During development of the molecular authentication process cross amplification of the primers was noticed. It was observed that EA-specific primers generated same amplicon in CP and vice versa. This cross-reactivity was suppressed by various approaches. In case of EA, specific reaction optimization efforts included variations in annealing temperature, annealing time, and reaction mixture composition (MgCl2 and primers) in order to eliminate the cross amplifiability of EA primer with CP DNA. Cross-amplification of the CP primer with EA DNA was inhibited using the ARMS (Arbitrary Refectory Mutation System) technique33. A mismatch was inserted at the penultimate position from the 3′ end helped to prevent the amplification of EA DNA with the CP primer. As reported in earlier investigations of allele-specific PCR, deliberate insertions of a mismatch nucleotide within nucleotides close to the 3' end of the primers increase their allele specificity34. These approaches made the PCR reaction very specific, robust and stringent. BSA was used in all the reactions as a PCR facilitator. This reagent is known to stabilize enzymes and reduce the inhibition of amplification due to secondary metabolites35 during PCR-based assays. Sensitivity of the assays was evaluated using different DNA concentrations. Multiplex assays were found to be sensitive enough to detect 2 ng of DNA of both the plants when present in the equal ratios (Fig. 4). Further verification was done by amplification of DNA isolated from simulated mixtures of the dried powdered plant material of CP and EA. Results of method validation showed the assay is sensitive enough to detect the mixing of both the species with each other as low as at 10% level (Fig. 5).
Figure 3.
1.8% agarose gel is showing amplification with multiplex PCR assay, was developed for identification and discrimination of CP and EA in mixtures, for fresh samples (A) and for dried powdered samples (B). (A) Lane 1 control reaction in which both the primers were mixed with the CP DNA. Lane 2 control tube having EA DNA in place of CP. Presence of only one band depending of the species proves the specificity of the assay. Lane 3 amplification from both the species; (B) Lanes 4, 5, and 6 amplicon from control tube having CP DNA, control tube having EA DNA, reaction mixture having both the DNA with both the primers respectively; M: GeneRuler 50 bp DNA ladder (Thermo Scientific); N: no template control.
Figure 4.
1.8% agarose gel is showing results of sensitivity of the multiplex assay for the DNA from fresh material (Lanes 1–7) and dried powdered material (Lanes 8–14). DNA concentration of CP: EA is 2 ng:2 ng (Lanes 7 and 14), 5 ng:5 ng (Lanes 6 and 13), 10 ng:10 ng (Lanes 5 and 12) 25 ng: 25 ng (Lanes 4 and 11), 50 ng:50 ng (Lanes 3 and 8), Lanes 2 and 1 are showing amplification from mixture of DNA having concentration of each species 75 and 100 ng, respectively, extracted from fresh samples. At these concentrations no amplification was observed for the DNA from dried samples (Lanes 9 and 10); M: GeneRuler 50 bp DNA ladder (Thermo Scientific), N: no template control.
Figure 5.
1.8% agarose gel is showing results of validation of the single tube multiplex PCR assay. 200 bp amplicon specific to CP and 596 bp amplicon specific to EA can be observed in each lane. Simulated mixture contained both species in different ratios, Lanes 1 to 5 species specific amplification from the dried powder material having CP: EA in ratio of 90:10, 70:30, 50:50, 30:70 and 10:90, respectively; M: GeneRuler 50 bp DNA ladder (Thermo Scientific); N: no template control.
4. Conclusion
In the present study we developed a DNA-based assay to identify and distinguish between medicinal preparations of two Shankhpushpi plants. DNA-based tools can be used independently or in combination with conventional methods. The developed assays were able to detect the presence of either single plant or a variety of mixtures of the two plants. Successful amplification of DNA from dried and powdered material proves that the assays were not affected by the physical or physiological conditions of the DNA. The assays were able to detect very low quantities of the DNA even in the mixture. The present method will help to ensure quality and molecular standardization of these two plant species and contribute to the commercial identification of genuine Shankhpushpi starting material.
Acknowledgments
Sharma S is thankful to University Grant Commission, New Delhi (India) for financial support (Award letter No. 20-12/2009(ii) EU-IV). We thank the director and employees of the Directorate of Medicinal and Aromatic Plant Research, Anand (Gujarat); Dr. Mahesh Patel (Medicinal and Aromatic Plant department of Anand Agriculture University, Gujarat, India); Dr. Arun M. Gurav (National Research Institute of Basic Ayurvedic Science formerly Jawaharlal Nehru Ayurvedic Medicinal Plants Garden and Herbarium, Pune, India); Dr Rambabu Dube (Maharana Pratap Agriculture University, Udaipur, Rajasthan, India) for their assistance in plant collection and authentication. The authors are also thankful to Xcelris Labs Ltd. technical team, Ahmedabad, for helping in sequencing.
Footnotes
Peer review under responsibility of Institute of Materia Medica, Chinese Academy of Medical Sciences and Chinese Pharmaceutical Association.
Supplementary data associated with this article can be found in the online version at doi:10.1016/j.apsb.2016.02.003.
Appendix A. Supplementary material
Supplementary material
References
- 1.Ganie S.H., Ali Z., Das S., Srivastava P.S., Sharma M.P. Genetic diversity and chemical profiling of different populations of Convolvulus pluricaulis (Convolvulaceae): an important herb of ayurvedic medicine. 3 Biotech. 2015;5:295–302. doi: 10.1007/s13205-014-0227-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.KEW The Royal Botanic Gardens. Availlable from: 〈http://apps.kew.org/wcsp/namedetail.do?name_id=484749〉 accessed on 4.12.2015
- 3.Sethiya N.K., Trivedi A., Patel M.B., Mishra S.H. Comparative pharmacognostical investigation on four ethanobotanicals traditionally used as Shankhpushpi in India. J Adv Pharm Technol Res. 2010;1:388–395. doi: 10.4103/0110-5558.76437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Rao R.V., Descamps O., John V., Bredesen D.E. Ayurvedic medicinal plants for Alzheimer's disease: a review. Alzheimer's Res Ther. 2012;4:22. doi: 10.1186/alzrt125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Malik J., Karan M., Vasisht K. Attenuating effect of bioactive coumarins from Convolvulus pluricaulis on scopolamine-induced amnesia in mice. Nat Prod Res. 2016;30:578–582. doi: 10.1080/14786419.2015.1025398. [DOI] [PubMed] [Google Scholar]
- 6.Nahata A., Patil U.K., Dixit V.K. Effect of Evolvulus alsinoides Linn. on learning behavior and memory enhancement activity in rodents. Phytother Res. 2010;24:486–493. doi: 10.1002/ptr.2932. [DOI] [PubMed] [Google Scholar]
- 7.Austin D.F. Evolvulus alsinoides (Convolvulaceae): an American herb in the old world. J Ethnopharmacol. 2008;117:185–198. doi: 10.1016/j.jep.2008.01.038. [DOI] [PubMed] [Google Scholar]
- 8.Gomathi D., Kalaiselvi M., Ravikumar G., Devaki K., Uma C. GC3MS analysis of bioactive compounds from the whole plant ethanolic extract of Evolvulus alsinoides (L.) L. J Food Sci Technol. 2015;52:1212–1217. doi: 10.1007/s13197-013-1105-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Malik J., Karan M., Vasisht K. Nootropic, anxiolytic and CNS-depressant studies on different plant sources of Shankhpushpi. Pharm Biol. 2011;49:1234–1242. doi: 10.3109/13880209.2011.584539. [DOI] [PubMed] [Google Scholar]
- 10.Madhavan V., Yoganarasimhan S.N., Gurudeva M.R. Pharmacognostical studies on Sankhapushpi (Convolvulus microphyllus Sieb. ex Spreng. and Evolvulus alsinoides (L.) L. Indian J Tradit Knowl. 2008;7:529–541. [Google Scholar]
- 11.Sethiya N.K., Mishra S. Simultaneous HPTLC analysis of ursolic acid, betulinic acid, stigmasterol and lupeol for the identification of four medicinal plants commonly available in the indian market as Shankhpushpi. J Chromatogr Sci. 2014;53:816–823. doi: 10.1093/chromsci/bmu111. [DOI] [PubMed] [Google Scholar]
- 12.Joshi K., Chavan P., Warude D., Patwardhan B. Molecular markers in herbal drug technology. Curr Sci. 2004;87:159–165. [Google Scholar]
- 13.Long P., Cui Z.H., Wang Y.L., Zhang C.H., Zhang N., Li M.H. Commercialized non-Camellia tea: traditional function and molecular identification. Acta Pharm Sin B. 2014;4:227–237. doi: 10.1016/j.apsb.2014.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chen S.L., Pang X.H., Song J.Y., Shi L.C., Yao H., Han J.P. A renaissance in herbal medicine identification: from morphology to DNA. Biotechnol Adv. 2014;32:1237–1244. doi: 10.1016/j.biotechadv.2014.07.004. [DOI] [PubMed] [Google Scholar]
- 15.Sarin Y.K. Council of Scientific Industrial Research; New Delhi: 1996. Illustrated manual of herbal drugs used in Ayurveda. [Google Scholar]
- 16.. Convolvulus microphyllus Sieb. ex Spreng. In: Gupta A.K., Tondon N., Sharma M., editors. Quality standards of Indian medicinal plants. ICMR; New Delhi: 2006. pp. 143–153. [Google Scholar]
- 17.Chen S.L., Yao H., Han J.P., Liu C., Song J.Y., Shi L.C. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS One. 2010;5:e8613. doi: 10.1371/journal.pone.0008613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Doyle J.J., Doyle J.L. Isolation of plant DNA from fresh tissue. Focus. 1990;12:13–15. [Google Scholar]
- 19.White T.J., Bruns T., Lee S., Taylor J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J., editors. PCR protocols: a guide to methods and applications. Academic Press Inc; New York: 1990. pp. 315–322. [Google Scholar]
- 20.Altschul S.F., Gish W., Miller W., Myers E.W., Lipman D.J. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. Available from: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- 21.Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kibbe W.A. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 2007;35:W43–W46. doi: 10.1093/nar/gkm234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Untergasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B.C., Remm M. Primer3-new capabilities and interfaces. Nucleic Acids Res. 2012;40:e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Wang L.L., Kong W.J., Yang M.H., Han J.P., Chen S.L. Safety issues and new rapid detection methods in traditional Chinese medicinal materials. Acta Pharm Sin B. 2015;5:38–46. doi: 10.1016/j.apsb.2014.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ganie S.H., Srivastava P.S., Narula A., Ali Z., Sharma M.P. Authentication of Shankhpushpi by RAPD markers. Eurasia J Biosci. 2012;6:39–46. [Google Scholar]
- 26.Ganie S.H., Sharma M.P. Molecular and chemical profiling of different populations of Evolvulus alsinoides (L.) L. Intl J Agri Crop Sci. 2014;7:1322–1331. [Google Scholar]
- 27.Galimberti A., De Mattia F., Losa A., Bruni I., Federici S., Casiraghi M. DNA barcoding as a new tool for food traceability. Food Res Int. 2013;50:55–63. [Google Scholar]
- 28.Xin T.Y., Yao H., Gao H.H., Zhou X.Z., Ma X.C., Xu C.Q. Super food Lycium barbarum (Solanaceae) traceability via an internal transcribed spacer 2 barcode. Food Res Int. 2013;54:1699–1704. [Google Scholar]
- 29.Xin T.Y., Li X.J., Yao H., Lin Y.L., Ma X.C., Cheng R.Y. Survey of commercial Rhodiola products revealed species diversity and potential safety issues. Sci Rep. 2015;5:8337. doi: 10.1038/srep08337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Mishra P., Kumar A., Nagireddy A., Mani D.N., Shukla A.K., Tiwari R. DNA barcoding: an efficient tool to overcome authentication challenges in the herbal market. Plant Biotechnol J. 2015;14:8–21. doi: 10.1111/pbi.12419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Madesis P., Ganopoulos I., Sakaridis I., Argiriou A., Tsaftaris A. Advances of DNA-based methods for tracing the botanical origin of food products. Food Res Int. 2014;60:163–172. [Google Scholar]
- 32.Seethapathy G.S., Balasubramani S.P., Venkatasubramanian P. nrDNA ITS sequence based SCAR marker to authenticate Aconitum heterophyllum and Cyperus rotundus in Ayurvedic raw drug source and prepared herbal products. Food Chem. 2014;145:1015–1020. doi: 10.1016/j.foodchem.2013.09.027. [DOI] [PubMed] [Google Scholar]
- 33.Newton C.R., Graham A., Heptinstall L.E., Powell S.J., Summers C., Kalsheker N. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS) Nucleic Acids Res. 1989;17:2503–2516. doi: 10.1093/nar/17.7.2503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Liu J., Huang S.M., Sun M.Y., Liu S.Y., Liu Y.M., Wang W.X. An improved allele-specific PCR primer design method for SNP marker analysis and its application. Plant Methods. 2012;8:34. doi: 10.1186/1746-4811-8-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Schrader C., Schielke A., Ellerbroek L., Johne R. PCR inhibitors-occurrence, properties and removal. J Appl Microbiol. 2012;113:1014–1026. doi: 10.1111/j.1365-2672.2012.05384.x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary material





