A multilocus variable number tandem repeat analysis assay provides high discrimination for genotyping Leptospira santarosai strains

Camila Hamond; Melissa Pinna; Marco Alberto Medeiros; Pascale Bourhy; Walter Lilenbaum; Mathieu Picardeau

doi:10.1099/jmm.0.000045

. 2015 May;64(Pt 5):507–512. doi: 10.1099/jmm.0.000045

A multilocus variable number tandem repeat analysis assay provides high discrimination for genotyping Leptospira santarosai strains

Camila Hamond ¹, Melissa Pinna ², Marco Alberto Medeiros ³, Pascale Bourhy ⁴, Walter Lilenbaum ¹, Mathieu Picardeau ^4,^✉

PMCID: PMC4857445 PMID: 25721051

Abstract

Considering the prevalence of Leptospira santarosai infections in the Americas and the scarce information about the species, we aimed to apply a multilocus variable number tandem repeat (VNTR) analysis (MLVA) for the molecular typing of L. santarosai isolates from various sources. Amplification of three VNTR loci selected from L. santarosai genome sequences resulted in a wide range of sizes for the amplified products amongst the 21 L. santarosai strains analysed. This suggested a variation in tandem repeat copy numbers in the VNTR loci. secY sequencing also showed a high nucleotide diversity, confirming the MLVA data. In conclusion, this novel MLVA provided a high level of discrimination between L. santarosai isolates, and this new typing tool could be used to investigate leptospirosis in regions where L. santarosai predominates.

Introduction

Leptospirosis, a worldwide zoonosis, is a re-emerging infectious disease caused by pathogenic Leptospira species. Infected animals are mostly subclinical and may act as reservoir hosts to a particular serovar of leptospires, shedding the bacteria through their urine for prolonged periods of time. There is a wide range of animal hosts, including wild and domestic animals, especially rodents, small marsupials, pigs, horses, dogs and cattle (Roqueplo et al., 2013).

In cattle, the infection has been established as a major infectious disease, due to its negative impacts on reproduction (abortion, embryonic death, stillbirths and infertility), decreased milk production and growth rates, as well as indirect costs associated with treatments and veterinary assistance (Mughini-Gras et al., 2014). Whilst Leptospira borgpetersenii sv. Hardjo subtype Hardjobovis (Hardjobovis) has been referred as the main causative agent of bovine leptospirosis in Australia, New Zealand and Chile (Salgado et al., 2014), Leptospira interrogans sv. Hardjo subtype Hardjoprajitno seems to prevail in other regions (Carmona-Gasca et al., 2011). In this context, the real role of other leptospiral species remains to be elucidated.

Other pathogenic Leptospira species include Leptospira santarosai, which has been mostly isolated in the Americas, particularly in Latin America (Nalam et al., 2010). Strains have been isolated from different hosts, including humans as well as domestic and wild animals (see the collections of Leptospira reference strains at the Leptospirosis Reference Centers at the Institute Pasteur, France, http://www.pasteur.fr/recherche/Leptospira/LeptospiraF.html, and KIT Biomedical Research, The Netherlands, http://www.kit.nl/biomedical-research/product-category/leptospira-strains/). In ruminants, to our knowledge, only five L. santarosai strains have been isolated until now, including four from the Americas: two from Brazil [L. santarosai strain Bov-G (serogroup Hebdomadis) from a cow (Santa Rosa et al., 1980) and L. santarosai sv. Guaricura (serogroup Sejroe) from a buffalo (Vasconcellos et al., 2001)], and two from cattle in Peru (Rivera et al., 2012).

Multilocus variable number tandem repeat (VNTR) analysis (MLVA) is a molecular method used for the DNA fingerprinting of pathogenic Leptospira, and is currently available for L. interrogans, Leptospira kirschneri and L. borgpetersenii species (Slack et al., 2005; Salaün et al., 2006). Nevertheless, it has never been applied to L. santarosai strains.

In this context, considering the importance of L. santarosai in the Americas and the scarce information about the species, we aimed to develop an MLVA assay for the molecular typing of L. santarosai isolates from various sources.

Methods

Studied strains and DNA.

A total of 21 L. santarosai isolates were studied, 15 of them obtained in the Americas. Seven belonged to the Leptospira Collection of Veterinary Bacteriology Laboratory of Universidade Federal Fluminense and had been obtained from cattle form Rio de Janeiro, Brazil, in 2013. The other 14 strains were from the collection of the French National Reference Center and WHO Collaborating Center for Leptospirosis (http://www.pasteur.fr/recherche/Leptospira/), and were obtained from humans (seven strains) and wild animals (seven strains) (see Table 2 below). Additionally, DNA of 10 reference strains (L. interrogans sv. Autumnalis strain Akiyami, L. interrogans sv. Copenhageni strain Winjberg, L. kirschneri sv. Grippotyphosa strain Moskva V, L. kirschneri sv. Cynopteri strain 3522C, L. borgpetersenii sv. Hardjobovis strain Sponselee, L. borgpetersenii sv. Tarassovi strain Perepelitsin, Leptospira noguchii sv. Panama strain CZ214K, L. noguchii sv. Louisiana strain LUC 1945, Leptospira biflexa sv. Patoc strain Patoc 1 and Leptospira weilli sv. Sarmin strain Sarmin) was used to check the specificity of the primers.

Table 2. Characterization of 21 strains of L. santarosai from different origins and hosts according to serogrouping and MLVA results.

ID	Serogroup	Serovar	Strain	Country	Host	Estimated locus copy no.			Profile
VNTR S1	VNTR S2	VNTR S9	VNTR	secY
1	Shermani	Shermani	1342KT	Panama	Spiny rat	4	1	10	A1	4
2	Mini	Beye	1537 U	Panama	Spiny rat	2	2	10	B1	nd
3	Tarassovi	Atlantae	LT 81	USA	Opossum	4	3	10	A2	4
4	Mini	Georgia	LT 117	USA	Raccoon	3	4	11	E	8
5	Mini	Tabaquite	TRVL 3214	Trinidad	Human	2	5	11	C1	6
6	Shermani	Unidentified*	2013_U152	Brazil	Cattle	2	6	6	F	9
7	Sarmin	Unidentified*	2013_U160	Brazil	Cattle	1	7	–	I	10
8	Tarassovi	Unidentified*	2013_U164	Brazil	Cattle	2	8	11	C2	11
9	Sejroe	Guaricura	2013_U214	Brazil	Cattle	2	9	4	G	3
10	Grippotyphosa	Bananal	2013_U233	Brazil	Cattle	2	10	11	C3	1
11	Shermani	Unidentified*	2013_U278	Brazil	Cattle	2	6	6	F	9
12	Grippotyphosa	Bananal	2013_U280	Brazil	Cattle	2	10	10	B2	1
13	Shermani	Shermani	LT 821	Panama	Rat	4	3	10	A2	nd
14	Ballum	Peru	MW 10	Peru	Opossum	3	11	10	D	5
15	Bataviae	Bataviae	Schoolby	Panama	Human	4	3	10	A2	nd
16	Grippotyphosa	Canalzonae	CZ 188	Panama	Spiny rat	2	9	10	B3	6
17	Mini	Tabaquite	201103484	French West Indies	Human	2	–	10	B4	6
18	Mini	Tabaquite	201103460	French West Indies	Human	13	12	10	H	2
19	Mini	Tabaquite	201102932	French West Indies	Human	2	13	10	B5	6
20	Mini	Tabaquite	201102931	French West Indies	Human	2	13	10	B5	6
21	Mini	Tabaquite	201101963	French West Indies	Human	2	14	–	J	7

Open in a new tab

nd, Not done.

Possibly refers to new genotype/serovar.

Molecular and serological characterization of Leptospira isolates.

The strains were characterized by serogrouping (Bourhy et al., 2013; Hamond et al., 2015) (21 strains), and by sequencing of rrs (Mérien et al., 1992) (21 strains) and secY (Ahmed et al., 2006) (18 isolates) genes. All molecular epidemiological data were stored and analysed with Bionumerics software (version 6.5; Applied-Maths).

Identification of VNTR-like regions.

The nucleotide sequences of the draft genomes of L. santarosai sv. Shermani strain 1342KT and L. santarosai sv. Shermani strain LT 821 (Chou et al., 2012) were analysed using the Tandem Repeats Database (http://tandem.bu.edu/cgi-bin/trdb/trdb.exe).

The GenBank accession numbers of the genome sequences of strains 1342KT and LT 821 are NZ_AOHB00000000.2 and NZ_ADOR00000000.1, respectively. The genome sequence of L. santarosai sv. Shermani strain 1342KT is part of the ‘Leptospira Genomics and Human Health’ project from the J. Craig Venter Institute Genomic Center for Infectious Diseases (http://gsc.jcvi.org/).

Ten VNTR-like loci were initially selected after comparing the length (67–76 bp), sequence identity (>88 %) and copy number (between three and 10 copies) of repeats. These criteria were considered to allow a simple and easy determination of the size of the PCR products on agarose gels following electrophoresis (length of PCR products should be <1 kb). Primer pairs flanking the VNTR loci (called VNTR S1, S2, etc.) were then designed and PCR was performed with the 10 selected VNTR loci on genomic DNA of six reference strains (see conditions below). VNTR loci (i.e. VNTR S1, S2 and S9) that exhibited PCR products whose size could be easily determined in an agarose gel electrophoresis for the six reference strains were further evaluated with a larger panel of strains.

PCR-VNTR.

For VNTR, the DNA was amplified using Taq polymerase (Illustra; GE Healthcare) under the following conditions: one denaturation cycle at 94 °C for 5 min; 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s and elongation at 72 °C for 1 min; and a final elongation at 72 °C for 10 min. The amplified products were analysed by 1 % agarose gel electrophoresis. The sizes of the amplicons were estimated by comparison with a 100 bp ladder (Invitrogen).

Results

Based upon the genome sequences of L. santarosai, 10 VNTR-like loci were analysed by PCR. Analysis of the amplified products of PCR-VNTR by agarose gel electrophoresis revealed size variations for most of the primer pairs. However, either no amplification (VNTR S6 and S7) or amplification for only a minority of strains (VNTR S3, S4, S8 and S10) was obtained for several primer pairs, which were therefore excluded from this study (data not shown). The three most discriminative VNTR loci were VNTR S1, S2 and S9, which are shown in Table 1. VNTR S2 showed a profile containing multiple bands and was used to differentiate between genetically related strains. VNTR S9 amplified more than one band for two of the studied strains. The developed L. santarosai VNTR scheme did not amplify DNA obtained from L. interrogans, L. kirschneri, L. borgpetersenii, L. noguchii, L. biflexa or L. weilli species.

Table 1. VNTR loci from the L. santarosai sv. Shermani genome used in this study.

VNTR locus	Primer (5′→3′)	GenBank accession no.	Position (bp)	Unit length (bp)	Copy no.
Strain 1342KT	Strain LT 821
VNTR S1	1F _CGAGTGAACCTTGCTTGACA	NZ_AOHB00000000.2	11431–11653	71	4	4
1R_CGGTCATAGGCATAGTGGGA
VNTR S2	2F_AAGACCCTACAAGCCGCTTC	NZ_AOHB00000000.2	29481–29773	75	6	3
2R_TCCATACCCGGTCCTTTACT
VNTR S9	9F_GCGGAAAAGTCGTGAATGGA	NZ_ADOR00000000.1	177151–177848	67	10	10
9R_AACTCACAACCCTCCCGAAA

Open in a new tab

When PCR-VNTR was performed for the 21 L. santarosai strains with the three selected VNTR loci, the sizes of the amplified products displayed a high polymorphism. This suggested a variation in tandem repeat copy numbers in the VNTR S1 (Fig. 1), S2 (Fig. 2) and S9 (Fig. 3) loci. Using VNTR S1 and S9, 10 different profiles (designated profiles A–J) could be identified, including one (profile C) which was predominant (six strains). Other profiles included four (A), three (B), two (F) and one (D, E, G, H, I and J) strains. When VNTR S2 was included, a higher level of discrimination was obtained and 17 profiles were observed. The results are summarized in Table 2.

Fig. 1. — PCR analysis of the polymorphism of VNTR S1 loci for 21 *L. santarosai* strains. M, 100 bp DNA ladder; 1, *L. santarosai* sv. Shermani; 2, *L. santarosai* sv. Beye; 3, *L. santarosai* sv. Atlantae; 4, *L. santarosai* sv. Georgia; 5, *L. santarosai* sv. Tabaquite; 6, *L. santarosai* strain 2013_U152; 7, *L. santarosai* strain 2013_U160; 8, *L. santarosai* strain 2013_U164; 9, *L. santarosai* strain 2013_U214; 10, *L. santarosai* strain 2013_U233; 11, *L. santarosai* strain 2013_U278; 12, *L. santarosai* strain 2013_U280; 13, *L. santarosai* sv. Shermani LT821; 14, *L. santarosai* sv. Peru; 15, *L. santarosai* sv. Bataviae; 16, *L. santarosai* sv. Canalzonae; 17, *L. santarosai* strain 201103484; 18, *L. santarosai* strain 201103460; 19, *L. santarosai* strain 201102932; 20, *L. santarosai* strain 201102931; 21, *L. santarosai* strain 201101963, NC, negative control.

Fig. 2. — PCR analysis of the polymorphism of VNTR S2 loci for 21 *L. santarosai* strains. M, 100 bp DNA ladder; 1, *L. santarosai* sv. Shermani; 2, *L. santarosai* sv. Beye; 3, *L. santarosai* sv. Atlantae; 4, *L. santarosai* sv. Georgia; 5, *L. santarosai* sv. Tabaquite; 6, *L. santarosai* strain 2013_U152; 7, *L. santarosai* strain 2013_U160; 8, *L. santarosai* strain 2013_U164; 9, *L. santarosai* strain 2013_U214; 10, *L. santarosai* strain 2013_U233; 11, *L. santarosai* strain 2013_U278; 12, *L. santarosai* strain 2013_U280; 13, *L. santarosai* sv. Shermani LT821; 14, *L. santarosai* sv. Peru; 15, *L. santarosai* sv. Bataviae; 16, *L. santarosai* sv. Canalzonae; 17, *L. santarosai* strain 201103484; 18, *L. santarosai* strain 201103460; 19, *L. santarosai* strain 201102932; 20, *L. santarosai* strain 201102931; 21, *L. santarosai* strain 201101963, NC, negative control.

Fig. 3. — PCR analysis of the polymorphism of VNTR S9 loci for 21 *L. santarosai* strains. M, 100 bp DNA ladder; 1, *L. santarosai* sv. Shermani; 2, *L. santarosai* sv. Beye; 3, *L. santarosai* sv. Atlantae; 4, *L. santarosai* sv. Georgia; 5, *L. santarosai* sv. Tabaquite; 6, *L. santarosai* strain 2013_U152; 7, *L. santarosai* strain 2013_U160; 8, *L. santarosai* strain *2013_*U164; 9, *L. santarosai* strain *2013_*U214; 10, *L. santarosai* strain 2013_U233; 11, *L. santarosai* strain 2013_U278; 12, *L. santarosai* strain 2013_U280; 13, *L. santarosai* sv. Shermani LT821; 14, *L. santarosai* sv. Peru; 15, *L. santarosai* sv. Bataviae; 16, *L. santarosai* sv. Canalzonae; 17, *L. santarosai* strain 201103484; 18, *L. santarosai* strain 201103460; 19, *L. santarosai* strain 201102932; 20, *L. santarosai* strain 201102931; 21, *L. santarosai* strain 201101963, NC, negative control.

Sequencing of the secY gene enabled genotyping of Leptospira strains at the subspecies level (Fig. 4). The MLVA patterns were in close agreement with the alleles determined by secY sequencing (Table 2). For example, the genotype of strain 201103640 was unique amongst the strains tested by both MLVA and secY sequencing, and strains 2013_U152 and 2013_U278 were indistinguishable by both molecular techniques.

Discussion

L. santarosai is found almost exclusively in the Americas, particularly in Latin America. This species has been isolated mostly from humans and wild animals, but has also been reported in ruminants in Brazil (Santa Rosa et al., 1980; Vasconcellos et al., 2001). Therefore, it is not surprising that seven of the strains isolated from cattle in Brazil were from L. santarosai. Amongst these isolates, members of serogroup Grippotyphosa are usually associated with environmental contamination and are maintained by wildlife species. From that serogroup, Bananal is a local serovar that has already been isolated in Brazil from mice, capybaras and goats (Lilenbaum et al., 2014), but had never been recovered from cattle. Serogroup Sejroe is the most common in ruminants worldwide, as well as in Brazil (Cosate et al., 2012). Nevertheless, although serovar Hardjo is the most frequently reported, the epidemiological role of serovar Guaricura, a local strain that was first obtained from a buffalo, remains to be elucidated. In contrast, L. santarosai strains belonging to serogroups Sarmin, Shermani and Tarassovi had never been reported from cattle in Brazil, and may have been neglected as agents of bovine leptospirosis. These findings, considering both the species and serogroups of the isolates, suggest that the aetiology of bovine leptospirosis in the Americas may be much more variable and complex than previously thought.

Detailed characterization of leptospiral isolates is important for understanding the epidemiology of leptospirosis (Bourhy et al., 2013). Identification of leptospiral isolates is usually based on serological and molecular methods (Benacer et al., 2013). However, molecular characterization of Leptospira strains does not always match with the original serological classification. Identification of serovars, which is defined by the complex, laborious and expensive cross-agglutinin absorption test, may not be accurate to cluster phylogenetically and/or epidemiologically related strains (Bourhy et al., 2013).

The VNTR analysis rendered 18 genotypes amongst the isolates. Importantly, genetic analysis did not match serology. Strains from the same serogroup (e.g. Shermani) rendered different genotypes, whilst strains from the same genotype (e.g. A2) were found to belong to different serogroups (Shermani, Tarassovi and Bataviae). Discrepancies between serology and genetic classification are not unexpected. Several authors have commented on this, and there is a consensus that more isolates and loci are needed to obtain an improved typing method for Leptospira characterization (Nalam et al., 2010; Caimi et al., 2012). Thus, a combined molecular (VNTR, multilocus sequence typing) and serological analysis seems to be a better approach for the typing of Leptospira isolates in order to obtain a greater insight into the evolutionary biology and epidemiology of this important pathogen.

In this study, secY sequencing and MLVA were used to characterize the L. santarosai isolates. MLVA showed a strong correlation with the secY sequence analysis, which was previously used for taxonomic and epidemiological purposes (Ahmed et al., 2006; Perez & Goarant, 2010; Paiva-Cardoso et al., 2013). Amongst the molecular techniques, genotyping L. interrogans strains by MLVA is increasingly being utilized for identification and epidemiological studies (Slack et al., 2005; Li et al., 2012; Caimi et al., 2012). In the present study, MLVA of L. santarosai showed that serovars from either the same serogroup or the same geographical area were not grouped together. In contrast, strains belonging to distinct serovars (e.g. Atlantae, Shermani and Bataviae) showed identical VNTR patterns (Table 2). The discrepancies between serovar and VNTR patterns may reflect a higher stability of the genome of serovars/genotypes with specific animal reservoirs or ecological niches over time and geographical distribution.

Altogether, serological and molecular tools allowed a reliable characterization of the isolates, and represent a contribution to the understanding of the epidemiology of L. santarosai in various hosts. Using these tools, a deeper understanding on the transmission of the disease in cattle is possible. The role of cow-to-cow transmission in an infected herd and the impact of the environment or wild animals in tropical regions have been speculated, but are still uncertain under many conditions. Understanding the epidemiology is mandatory for an adequate control program, and molecular tools developed for L. santarosai may contribute to its understanding and control, particularly in Latin America. In this context, the MLVA scheme described here can be applied to L. santarosai isolates and this new typing tool can contribute to a better understanding of the epidemiology of circulating strains in the Americas.

Acknowledgements

This study was supported by FAPERJ, CNPq and CAPES. W. L. and M. A. M. are CNPq fellows. The authors thank J. Vinetz and D. Fouts for their permission to use the draft genome of L. santarosai strain 1342KT, which is part of a project which was funded with federal funds from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services (contract HHSN272200900007C).

Abbreviations:

MLVA: multilocus variable number tandem repeat analysis
VNTR: variable number tandem repeat

References

Ahmed N., Devi S. M., de los Á Valverde M., Vijayachari P., Machang’u R. S., Ellis W. A., Hartskeerl R. A. ( 2006. ). Multilocus sequence typing method for identification and genotypic classification of pathogenic Leptospira species. Ann Clin Microbiol Antimicrob 5, 28–44. 10.1186/1476-0711-5-28 [DOI] [PMC free article] [PubMed] [Google Scholar]
Benacer D., Woh P. Y., Mohd Zain S. N., Amran F., Thong K. L. ( 2013. ). Pathogenic and saprophytic Leptospira species in water and soils from selected urban sites in peninsular Malaysia. Microbes Environ 28, 135–140. 10.1264/jsme2.ME12154 [DOI] [PMC free article] [PubMed] [Google Scholar]
Bourhy P., Herrmann Storck C., Theodose R., Olive C., Nicolas M., Hochedez P., Lamaury I., Zinini F., Brémont S., et al. ( 2013. ). Serovar diversity of pathogenic Leptospira circulating in the French West Indies. PLoS Negl Trop Dis 7, e2114. 10.1371/journal.pntd.0002114 [DOI] [PMC free article] [PubMed] [Google Scholar]
Caimi K., Varni V., Melendez Y., Koval A., Brihuega B., Ruybal P. ( 2012. ). A combined approach of VNTR and MLST analysis: improving molecular typing of Argentinean isolates of Leptospira interrogans . Mem Inst Oswaldo Cruz 107, 644–651. 10.1590/S0074-02762012000500011 [DOI] [PubMed] [Google Scholar]
Carmona-Gasca C. A., León L. L., Castillo-Sánchez L. O., Ramírez-Ortega J. M., Ko A., Luna C. P., Peña-Moctezuma A. ( 2011. ). [Detection of Leptospira santarosai and L. kirschneri in cattle: new isolates with potential impact on cattle production and public health]. Vet. Mexico 42, 277–288 (in Spanish). [Google Scholar]
Chou L. F., Chen Y. T., Lu C. W., Ko Y. C., Tang C. Y., Pan M. J., Tian Y. C., Chiu C. H., Hung C. C., Yang C. W. ( 2012. ). Sequence of Leptospira santarosai serovar Shermani genome and prediction of virulence-associated genes. Gene 511, 364–370. 10.1016/j.gene.2012.09.074 [DOI] [PubMed] [Google Scholar]
Cosate M. R., Barouni A. S., Moreira E. C., Veloso I. F., Gomes M. T., Salas C. E. ( 2012. ). Molecular characterization by LSSP-PCR and DNA sequencing of a pathogenic isolate of Leptospira interrogans from Brazil. Zoonoses Public Health 59, 379–388. 10.1111/j.1863-2378.2012.01470.x [DOI] [PubMed] [Google Scholar]
Hamond C., Martins G., Lilenbaum W., Pinna M., Medeiros M. A. ( 2015. ). Infection by Leptospira spp. in cattle in a tropical region, Rio de Janeiro, Brazil. Am J Trop Med Hyg 92, 210. 10.4269/ajtmh.14-0519 [DOI] [PMC free article] [PubMed] [Google Scholar]
Li S. J., Zhang C. C., Li X. W., Tian K. C., Tang G. P., Wang D. M., Liu Y., Nie Y. X., Jiang X. G. ( 2012. ). Molecular typing of Leptospira interrogans strains isolated from Rattus tanezumi in Guizhou Province, Southwest of China. Biomed Environ Sci 25, 542–548. [DOI] [PubMed] [Google Scholar]
Lilenbaum W., Kremer F., Ristow P., Dellagostin O., Bourhy P., Hartskeerl R., Vasconcellos S. ( 2014. ). Molecular characterization of the first leptospires isolated from goats in Brazil. Braz J Microbiol 45, 1527–1530. 10.1590/S1517-83822014000400050 [DOI] [PMC free article] [PubMed] [Google Scholar]
Mérien F., Amouriaux P., Perolat P., Baranton G., Saint Girons I. ( 1992. ). Polymerase chain reaction for detection of Leptospira spp. in clinical samples. J Clin Microbiol 30, 2219–2224. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mughini-Gras L., Bonfanti L., Natale A., Comin A., Ferronato A., La Greca E., Patregnani T., Lucchese L., Marangon S. ( 2014. ). Application of an integrated outbreak management plan for the control of leptospirosis in dairy cattle herds. Epidemiol Infect 142, 1172–1181. 10.1017/S0950268813001817 [DOI] [PMC free article] [PubMed] [Google Scholar]
Nalam K., Ahmed A., Devi S. M., Francalacci P., Baig M., Sechi L. A., Hartskeerl R. A., Ahmed N. ( 2010. ). Genetic affinities within a large global collection of pathogenic Leptospira: implications for strain identification and molecular epidemiology. PLoS One 5, e12637. 10.1371/journal.pone.0012637 [DOI] [PMC free article] [PubMed] [Google Scholar]
Paiva-Cardoso M., Arent Z., Gilmore C., Hartskeerl R., Ellis W. A. ( 2013. ). Altodouro, a new Leptospira serovar of the Pomona serogroup isolated from rodents in northern Portugal. Infect Genet Evol 13, 211–217. 10.1016/j.meegid.2012.09.013 [DOI] [PubMed] [Google Scholar]
Perez J., Goarant C. ( 2010. ). Rapid Leptospira identification by direct sequencing of the diagnostic PCR products in New Caledonia. BMC Microbiol 10, 325. 10.1186/1471-2180-10-325 [DOI] [PMC free article] [PubMed] [Google Scholar]
Rivera P., Ticlla M., Balda L., Gonzalez D., Céspedes M. ( 2012. ). [Genetic diversity of Peruvian isolates of Leptospira spp. through pulsed field gel electrophoresis]. Rev Peru Med Exp Salud Publica 29, 469–476 (in Spanish). 10.1590/S1726-46342012000400008 [DOI] [PubMed] [Google Scholar]
Roqueplo C., Cabre O., Davoust B., Kodjo A. ( 2013. ). Epidemiological study of animal leptospirosis in New Caledonia. Vet Med Int 2013, 826834. 10.1155/2013/826834 [DOI] [PMC free article] [PubMed] [Google Scholar]
Salaün L., Mérien F., Gurianova S., Baranton G., Picardeau M. ( 2006. ). Application of multilocus variable-number tandem-repeat analysis for molecular typing of the agent of leptospirosis. J Clin Microbiol 44, 3954–3962. 10.1128/JCM.00336-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
Salgado M., Otto B., Sandoval E., Reinhardt G., Boqvist S. ( 2014. ). A cross sectional observational study to estimate herd level risk factors for Leptospira spp. serovars in small holder dairy cattle farms in southern Chile. BMC Vet Res 10, 126. 10.1186/1746-6148-10-126 [DOI] [PMC free article] [PubMed] [Google Scholar]
Santa Rosa C. A., Sulzer C. R., de Castro A. F., Yanaguita R. M., Giorgi W. ( 1980. ). Two new leptospiral serovars in the Hebdomadis group isolated from cattle in Brazil. Int J Zoonoses 7, 158–163. [PubMed] [Google Scholar]
Slack A. T., Dohnt M. F., Symonds M. L., Smythe L. D. ( 2005. ). Development of a multiple-locus variable number of tandem repeat analysis (MLVA) for Leptospira interrogans and its application to Leptospira interrogans serovar Australis isolates from Far North Queensland, Australia. Ann Clin Microbiol Antimicrob 4, 10. 10.1186/1476-0711-4-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
Vasconcellos S. A., Oliveira J. C. F., Morais Z. M., Baruselli P. S., Amaral R., Pinheiro S. R., Ferreira F., Ferreira-Neto J. S., Schönberg A., Hartskeerl R. A. ( 2001. ). Isolation of Leptospira santarosai, serovar Guaricura from buffaloes (Bubalus bubalis) in vale do Ribeira, São Paulo, Brazil. Braz J Microbiol 32, 298–300. 10.1590/S1517-83822001000400008 [DOI] [Google Scholar]

[r1] Ahmed N., Devi S. M., de los Á Valverde M., Vijayachari P., Machang’u R. S., Ellis W. A., Hartskeerl R. A. ( 2006. ). Multilocus sequence typing method for identification and genotypic classification of pathogenic Leptospira species. Ann Clin Microbiol Antimicrob 5, 28–44. 10.1186/1476-0711-5-28 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r2] Benacer D., Woh P. Y., Mohd Zain S. N., Amran F., Thong K. L. ( 2013. ). Pathogenic and saprophytic Leptospira species in water and soils from selected urban sites in peninsular Malaysia. Microbes Environ 28, 135–140. 10.1264/jsme2.ME12154 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r3] Bourhy P., Herrmann Storck C., Theodose R., Olive C., Nicolas M., Hochedez P., Lamaury I., Zinini F., Brémont S., et al. ( 2013. ). Serovar diversity of pathogenic Leptospira circulating in the French West Indies. PLoS Negl Trop Dis 7, e2114. 10.1371/journal.pntd.0002114 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r4] Caimi K., Varni V., Melendez Y., Koval A., Brihuega B., Ruybal P. ( 2012. ). A combined approach of VNTR and MLST analysis: improving molecular typing of Argentinean isolates of Leptospira interrogans . Mem Inst Oswaldo Cruz 107, 644–651. 10.1590/S0074-02762012000500011 [DOI] [PubMed] [Google Scholar]

[r5] Carmona-Gasca C. A., León L. L., Castillo-Sánchez L. O., Ramírez-Ortega J. M., Ko A., Luna C. P., Peña-Moctezuma A. ( 2011. ). [Detection of Leptospira santarosai and L. kirschneri in cattle: new isolates with potential impact on cattle production and public health]. Vet. Mexico 42, 277–288 (in Spanish). [Google Scholar]

[r6] Chou L. F., Chen Y. T., Lu C. W., Ko Y. C., Tang C. Y., Pan M. J., Tian Y. C., Chiu C. H., Hung C. C., Yang C. W. ( 2012. ). Sequence of Leptospira santarosai serovar Shermani genome and prediction of virulence-associated genes. Gene 511, 364–370. 10.1016/j.gene.2012.09.074 [DOI] [PubMed] [Google Scholar]

[r7] Cosate M. R., Barouni A. S., Moreira E. C., Veloso I. F., Gomes M. T., Salas C. E. ( 2012. ). Molecular characterization by LSSP-PCR and DNA sequencing of a pathogenic isolate of Leptospira interrogans from Brazil. Zoonoses Public Health 59, 379–388. 10.1111/j.1863-2378.2012.01470.x [DOI] [PubMed] [Google Scholar]

[r10] Hamond C., Martins G., Lilenbaum W., Pinna M., Medeiros M. A. ( 2015. ). Infection by Leptospira spp. in cattle in a tropical region, Rio de Janeiro, Brazil. Am J Trop Med Hyg 92, 210. 10.4269/ajtmh.14-0519 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r11] Li S. J., Zhang C. C., Li X. W., Tian K. C., Tang G. P., Wang D. M., Liu Y., Nie Y. X., Jiang X. G. ( 2012. ). Molecular typing of Leptospira interrogans strains isolated from Rattus tanezumi in Guizhou Province, Southwest of China. Biomed Environ Sci 25, 542–548. [DOI] [PubMed] [Google Scholar]

[r12] Lilenbaum W., Kremer F., Ristow P., Dellagostin O., Bourhy P., Hartskeerl R., Vasconcellos S. ( 2014. ). Molecular characterization of the first leptospires isolated from goats in Brazil. Braz J Microbiol 45, 1527–1530. 10.1590/S1517-83822014000400050 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r14] Mérien F., Amouriaux P., Perolat P., Baranton G., Saint Girons I. ( 1992. ). Polymerase chain reaction for detection of Leptospira spp. in clinical samples. J Clin Microbiol 30, 2219–2224. [DOI] [PMC free article] [PubMed] [Google Scholar]

[r15] Mughini-Gras L., Bonfanti L., Natale A., Comin A., Ferronato A., La Greca E., Patregnani T., Lucchese L., Marangon S. ( 2014. ). Application of an integrated outbreak management plan for the control of leptospirosis in dairy cattle herds. Epidemiol Infect 142, 1172–1181. 10.1017/S0950268813001817 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r16] Nalam K., Ahmed A., Devi S. M., Francalacci P., Baig M., Sechi L. A., Hartskeerl R. A., Ahmed N. ( 2010. ). Genetic affinities within a large global collection of pathogenic Leptospira: implications for strain identification and molecular epidemiology. PLoS One 5, e12637. 10.1371/journal.pone.0012637 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r17] Paiva-Cardoso M., Arent Z., Gilmore C., Hartskeerl R., Ellis W. A. ( 2013. ). Altodouro, a new Leptospira serovar of the Pomona serogroup isolated from rodents in northern Portugal. Infect Genet Evol 13, 211–217. 10.1016/j.meegid.2012.09.013 [DOI] [PubMed] [Google Scholar]

[r18] Perez J., Goarant C. ( 2010. ). Rapid Leptospira identification by direct sequencing of the diagnostic PCR products in New Caledonia. BMC Microbiol 10, 325. 10.1186/1471-2180-10-325 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r19] Rivera P., Ticlla M., Balda L., Gonzalez D., Céspedes M. ( 2012. ). [Genetic diversity of Peruvian isolates of Leptospira spp. through pulsed field gel electrophoresis]. Rev Peru Med Exp Salud Publica 29, 469–476 (in Spanish). 10.1590/S1726-46342012000400008 [DOI] [PubMed] [Google Scholar]

[r20] Roqueplo C., Cabre O., Davoust B., Kodjo A. ( 2013. ). Epidemiological study of animal leptospirosis in New Caledonia. Vet Med Int 2013, 826834. 10.1155/2013/826834 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r21] Salaün L., Mérien F., Gurianova S., Baranton G., Picardeau M. ( 2006. ). Application of multilocus variable-number tandem-repeat analysis for molecular typing of the agent of leptospirosis. J Clin Microbiol 44, 3954–3962. 10.1128/JCM.00336-06 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r22] Salgado M., Otto B., Sandoval E., Reinhardt G., Boqvist S. ( 2014. ). A cross sectional observational study to estimate herd level risk factors for Leptospira spp. serovars in small holder dairy cattle farms in southern Chile. BMC Vet Res 10, 126. 10.1186/1746-6148-10-126 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r23] Santa Rosa C. A., Sulzer C. R., de Castro A. F., Yanaguita R. M., Giorgi W. ( 1980. ). Two new leptospiral serovars in the Hebdomadis group isolated from cattle in Brazil. Int J Zoonoses 7, 158–163. [PubMed] [Google Scholar]

[r24] Slack A. T., Dohnt M. F., Symonds M. L., Smythe L. D. ( 2005. ). Development of a multiple-locus variable number of tandem repeat analysis (MLVA) for Leptospira interrogans and its application to Leptospira interrogans serovar Australis isolates from Far North Queensland, Australia. Ann Clin Microbiol Antimicrob 4, 10. 10.1186/1476-0711-4-10 [DOI] [PMC free article] [PubMed] [Google Scholar]

[r25] Vasconcellos S. A., Oliveira J. C. F., Morais Z. M., Baruselli P. S., Amaral R., Pinheiro S. R., Ferreira F., Ferreira-Neto J. S., Schönberg A., Hartskeerl R. A. ( 2001. ). Isolation of Leptospira santarosai, serovar Guaricura from buffaloes (Bubalus bubalis) in vale do Ribeira, São Paulo, Brazil. Braz J Microbiol 32, 298–300. 10.1590/S1517-83822001000400008 [DOI] [Google Scholar]

PERMALINK

A multilocus variable number tandem repeat analysis assay provides high discrimination for genotyping Leptospira santarosai strains

Camila Hamond

Melissa Pinna

Marco Alberto Medeiros

Pascale Bourhy

Walter Lilenbaum

Mathieu Picardeau

Abstract

Introduction