USP5 Is Dispensable for Monoubiquitin Maintenance in Drosophila

Abstract

Ubiquitination is a post-translational modification that regulates most cellular pathways and processes, including degradation of proteins by the proteasome. Substrate ubiquitination is controlled at various stages, including through its reversal by deubiquitinases (DUBs). A critical outcome of this process is the recycling of monoubiquitin. One DUB whose function has been proposed to include monoubiquitin recycling is USP5. Here, we investigated whether Drosophila USP5 is important for maintaining monoubiquitin in vivo. We found that the fruit fly orthologue of USP5 has catalytic preferences similar to its human counterpart and that this DUB is necessary during fly development. Our biochemical and genetic experiments indicate that reduction of USP5 does not lead to monoubiquitin depletion in developing flies. Also, introduction of exogenous ubiquitin does not suppress developmental lethality caused by loss of endogenous USP5. Our work indicates that a primary physiological role of USP5 is not to recycle monoubiquitin for reutilization, but that it may involve disassembly of conjugated ubiquitin to maintain proteasome function.

Introduction

Ubiquitination is an important post-translational modification of numerous proteins in the cell, where it is involved in the regulation of various processes ranging from DNA transcription to protein degradation. Three different classes of enzymes are responsible for carrying out this modification: E1 (ubiquitin-activating enzymes), E2 (ubiquitin-conjugating enzymes), and E3 (ubiquitin ligases) (1). Through the coordinated action of these proteins, a ubiquitin molecule is conjugated most commonly to a lysine residue of a substrate protein through an isopeptide bond. Because ubiquitin itself has seven lysine residues, which are available for isopeptide bond formation, and because ubiquitin moieties can also be connected “head to tail,” ubiquitin chains of different conformations are generated (2, 3). Different chains impart specific outcomes on the fate of the protein to which they are conjugated. For example, Lys⁴⁸-linked ubiquitin targets proteins for proteasomal degradation, whereas Lys⁶³-linked species have been associated with autophagy and other non-proteasomally dependent events (4–7).

Ubiquitination and ubiquitin recycling are tightly controlled to fine-tune the process, to bring a cellular event to an end, to regulate protein fate, and to recycle ubiquitin for reuse. The reversal of ubiquitination is carried out by a class of proteases known as deubiquitinating enzymes (DUBs).² DUBs are divided into five families, based on similarity in their catalytic domains: ubiquitin-specific proteases, ubiquitin C-terminal hydrolases, Machado-Joseph disease proteins, otubain proteases, and the JAB1/MPN/Mov34 metalloenzymes. Nearly 100 genes encoding DUBs have been identified in humans, but the functions of many of them remain to be discovered (3, 7–10).

Ubiquitin-specific protease 5 (USP5, also known as isopeptidase T) is one DUB whose structural properties are well understood. USP5 is reportedly an exopeptidase that hydrolyzes isopeptide bonds in polyubiquitin from the free C-terminal end to produce monoubiquitin, which can then be reconjugated to substrate proteins (11–13). Depletion of USP5 orthologues in yeast and in mammalian cells leads to accumulation of unanchored ubiquitin chains and causes proteasomal inhibition (14). These and other findings place USP5 at the proteasome: before a protein is degraded by the proteasome, the ubiquitin chain signaling its degradation is removed en bloc by another DUB, RPN11/POH1, leaving unanchored polyubiquitin. USP5 processes this unanchored chain to yield monoubiquitin (3, 10). Thus, this DUB is thought of as a ubiquitin recycler, helping to maintain a monoubiquitin pool for reutilization (7, 15, 16). Most ubiquitin is found in conjugated forms in various tissues tested, leaving only a small portion available in the unconjugated, monoubiquitin pool (16–18). Because there is persistent demand for protein modification through ubiquitination, there is a constant need to generate monoubiquitin through recycling or through new synthesis via ubiquitin-encoding genes.

It is not entirely clear whether a primary role for USP5 in vivo is monoubiquitin maintenance. Here, we tested this possibility in the fruit fly Drosophila melanogaster, whose USP5 is necessary during development (16, 19, 20). Our biochemical and genetic experiments indicate that Drosophila USP5 is not necessary for maintaining a ready pool of monoubiquitin in vivo.

Experimental Procedures

Drosophila Lines and Related Procedures

RNAi-1 and RNAi-2 targeting USP5 were from the Vienna Drosophila RNAi Center (21). These two fly lines contain the same targeting sequence inserted at different chromosomal sites. RNAi-3, the UAS-monoubiquitin overexpression line, and the Gal80^ts line were from the Bloomington Drosophila Stock Center. The UAS-USP14 line was from FlyORF. The UAS-CL1-GFP line was a generous gift from Dr. Udai Pandey (University of Pittsburgh), the actin-Gal4 and the sqh-Gal4 lines were a generous gift from Dr. Daniel Eberl (University of Iowa), and the da-Gal4 line was generously donated by Dr. R. J. Wessells (Wayne State University). Flies were maintained at 25 °C and ∼40–60% humidity in regulated diurnal environments. Where noted in figures and legends, the flies were maintained at 18 and 30 °C, ∼40–60% humidity under diurnal cycle for Gal80 experiments. Fly lines are listed in Table 1.

TABLE 1.

Drosophila lines

Stocks	Source	ID	Description
w[1118]; P{GD6741}v17567	Vienna Drosophila RNAi Center	17567	DmUSP5 UAS-RNAi-1
w[1118]; P{GD6741}v17568	Vienna Drosophila RNAi Center	17568	DmUSP5 UAS-RNAi-2
y[1] v[1]; P{TRiP.JF02163}attP2	Bloomington Drosophila Stock Center	31886	DmUSP5 UAS-RNAi-3
y[1] v[1]; P{y[+t7.7] = CaryP}attP2	Bloomington Drosophila Stock Center	36303	Host strain for RNAi-3
w[1118]	Vienna Drosophila RNAi Center	60000	Host strain for RNAi-1, -2
w[*]; UAS-HA-Ubiquitin	Bloomington Drosophila Stock Center	32055	Expresses HA-tagged ubiquitin under UAS control
M{UAS-CG5384.ORF.3xHA}ZH-86Fb	FlyORF	F001032	Expresses HA-tagged USP14 under UAS control
w[*]; tubP-Gal80ts	Bloomington Drosophila Stock Center	7018	Temperature-sensitive Gal80 that is expressed under the control of the αTub84B promoter
w[*]; UAS-CL1-GFP	Dr. Udai Pandey		GFP with CL1 degron, reporter of ubiquitin-dependent proteasome activity, under UAS control
w[*]; sqh-Gal4	Dr. Daniel Eberl		Ubiquitous driver
w[*]; actin-Gal4	Dr. Daniel Eberl		Ubiquitous driver
w[*]; da-Gal4	Dr. R. J. Wessells		Ubiquitous driver

SDS-PAGE, Western Blotting, and Quantification

Larvae, pupae, or flies, as indicated in figures and legends, were homogenized in boiling SDS lysis buffer (50 mm Tris, pH 6.8, 2% SDS, 10% glycerol, and 100 mm DTT), sonicated, boiled for 10 min, centrifuged for 10 min at 13,000 × g at room temperature, loaded onto SDS-PAGE gels, electrophoresed at 160–170 V, and transferred onto PVDF membranes (Bio-Rad) for Western blotting, as previously described (19, 22–25). 10 larvae, 5 pupae, or 5 adults were collected per group in 15 μl of lysis buffer per larva, 20 μl of lysis buffer per pupa, or 30 μl of buffer per adult. For direct blue staining of PVDF membranes, 0.1% DB71 (Sigma-Aldrich) stock solution in ultra pure water was dissolved in 40% ethanol and 10% acetic acid solvent to a final concentration of 0.01%, and membrane was immersed for 5 min, rinsed briefly with solvent, then ultra pure water, and air dried. Coomassie Blue staining was conducted as described before (26, 27). Western blots were imaged with a charge-coupled device-equipped VersaDoc 5000MP system (Bio-Rad) (22, 23). Quantification of signals from subsaturated blots was conducted with Quantity One Software (Bio-Rad) with universal background subtraction. Experimental lanes were normalized to their respective controls. Student's t tests (one- or two-tailed, as appropriate) or analysis of variance with Tukey's post hoc correction were used for statistical comparisons.

Antibodies

Anti-ubiquitin (DAKO rabbit polyclonal, 1:500, catalog no. Z0458), P4D1 (mouse monoclonal, 1:500, Santa Cruz Biotechnology, catalog no. SC2017, used only in Fig. 3C), anti-tubulin (mouse monoclonal, 1:5,000, Sigma-Aldrich, catalog no. T5168), anti-actin (JLA20 mouse monoclonal, 1:500, Developmental Studies Hybridoma Bank), anti-HA (Y11, rabbit polyclonal, 1:1,000, Santa Cruz Biotechnology, catalog no. SC805), anti-GFP (mouse monoclonal, 1:1,000, Roche, catalog no. 11814460001), anti-CHIP (rabbit monoclonal, 1:1,000, Cell Signaling Technology, catalog no. 2080S), anti-HSP70 (mouse monoclonal, 1:1,000, Rockland, catalog no. 200–301-A27), anti-cyclin A (A12 mouse monoclonal, 1:100, Developmental Studies Hybridoma Bank), anti-Sin3 (rabbit polyclonal, 1:2,000), anti-VCP (valosin-containing protein; rabbit monoclonal, 1:1,000; Cell Signaling Technology catalog no. 2648S) peroxidase-conjugated secondary antibodies (goat anti-rabbit and goat anti-mouse, 1:5,000; Jackson Immunoresearch). Sin3 antibody was a generous gift from Dr. Lori Pile (Wayne State University) (28). The JLA20 and A12 antibodies were procured from the Developmental Studies Hybridoma Bank, created by the NICHD, National Institutes of Health and maintained at the Department of Biology of the University of Iowa (Iowa City, IA). JLA20 was deposited to the Developmental Studies Hybridoma Bank by J. J.-C Lin. A12 was deposited to the Developmental Studies Hybridoma Bank by C. F. Lehner.

FIGURE 3.

Knockdown of DmUSP5 does not deplete monoubiquitin. A, Western blots from larval or pupal lysates when DmUSP5-RNAi was driven by sqh-Gal4. 4–20% gradient gels were used. All flies were heterozygous for UAS-RNAi (1, 2, or 3) and sqh-Gal4. Brackets indicate conjugated ubiquitin species that were quantified for B. Control, Gal4 driver on the background host line of RNAi. B, quantifications of blots in A and other similar, independent experiments. p values are from Student's t tests. Error bars indicate S.D., n = 4 independently conducted experiments. C, Western blots of whole larval or pupal lysates where sqh-Gal4 was driving the expression of UAS-RNAi-3 (larvae) or UAS-RNAi-2 (pupae). 4–20% gradient gels were used. Anti-ubiquitin antibody used was different from the one in the other panels. This antibody (monoclonal P4D1) also shows increased levels of conjugated ubiquitin whereas monoubiquitin is also not depleted, similar to what we observe with the other antibody, shown in A and in the rest of the figures of this manuscript.

Cloning and Protein Purification

DmUSP5 was cloned in two fragments from a Drosophila w¹¹¹⁸ cDNA library generated in our laboratory. Fragment A was PCR-amplified by using forward primer (5′-GTT TAT GAG AAA AGA GCT GCC TAC A-3′) and reverse primer (5′-CAA TAC TGC TGT ACT TTC CCG ACT-3′). Fragment B was PCR-amplified by using forward primer (5′- GGC AAC TCC TGC TAC ATA AAC AG-3′) and reverse primer (5′- CGA ATA ATA TTA GCT TGT GGG ACT G-3′). The fragments were ligated and inserted into pCR Blunt II TOPO vector (ThermoFisher). Full-length DmUSP5 was then subcloned into pGEX6p1 (GE Healthcare). The human USP5 construct was purchased from Addgene, a generous gift of the Arrowsmith Lab (plasmid 25299).

DmUSP5 in pGEX6p1 and human USP5 in pET28 were transformed into BL21 Escherichia coli. Individual colonies were grown at 37 °C overnight in LB with ampicillin or kanamycin, as needed. 10 ml was used to inoculate 500 ml of LB and was grown for an additional 3 h at 37 °C. Protein expression was induced by 0.5 mm of isopropyl-1-β-d-galactopyranoside (A. G. Scientific) for 2 h at 30 °C. DmUSP5 was purified by GST pulldown. Bacterial cells were pelleted by centrifugation and resuspended in NETN lysis buffer (50 mm Tris, pH 7.5, 150 mm NaCl, 0.5% Nonidet P-40), sonicated, and then centrifuged for 20 min at 4 °C. 250 μl of glutathione-Sepharose beads (GE Healthcare) were washed with NETN, and lysates were added to beads and tumbled at 4 °C. The beads were then washed with NETN buffer thrice followed by two PBS washes. Prescission Protease (GE Healthcare) with 1% DTT was used to elute the bead-bound protein. His-tagged human USP5 was purified with nickel beads. Pelleted bacterial cells were resuspended in buffer A (50 mm Tris, pH 7.5, 150 mm NaCl), sonicated, and centrifuged. 400 μl of nickel-nitrilotriacetic acid beads (Qiagen) were washed in buffer A and incubated with lysates. The beads were then rinsed twice each with buffers A, B (50 mm Tris, pH 7.5, 1 m NaCl, 20 mm immidazole), and C (50 mm Tris, pH 7.5, 100 mm NaCl, 20 mm imidazole, 0.5% Triton X-100). Protein was eluted with buffer C containing 300 mm imidazole and 1% DTT. Catalytically inactive DmUSP5 was created using the QuikChange mutagenisis kit (Agilent) (23). The catalytic cysteine at position 341 was mutated to an alanine. Recombinant protein concentration was determined using NanoDrop and Coomassie Blue staining of SDS-PAGE gels.

In Vitro Reactions

50 nm of recombinant DmUSP5 or human USP5 was added to kinase buffer (0.5 m Tris pH 7.5, 0.5 m KCl, 0.2% DTT) with 1 μm of ubiquitin chains with specific linkages for a total reaction volume of 60 μl. Reactions were incubated at 37 °C for human USP5 or 25 °C for fly USP5, and 15 μl were taken from each reaction at the indicated time points. The reaction was stopped by the addition of 10 μl of sample loading buffer and boiled for 2 min. DUB reactions were also repeated at 37 °C for Drosophila USP5, with similar results to those at 25 °C. Ubiquitin chains were purchased from Boston Biochem.

CHIP and HSP70 ubiquitination was carried out as previously described (26, 27) for 1 h at 37 °C in 100 μl of kinase buffer. Ub^mix (2.5 mm ATP, 2.5 mm MgCl₂, 100 nm Ube1, and 250 μm ubiquitin), 1 μm E2 (Ube2w for monoubiquitinated CHIP or UbcH5c for polyubiquitinated CHIP and HSP70), 1 μm CHIP, and 1 μm HSP70. The reactions were stopped by the addition of excess EDTA, and 50 nm (final) DmUSP5 or human USP5 was added to the complex. Reaction time points were separated on 4–20% polyacrylamide gels and analyzed by Western blotting.

Quantitative Real Time PCR

Total RNA was extracted using TRIzol reagent (Invitrogen), followed by treatment with TURBO DNase (Ambion) to eliminate contaminating DNA. A high capacity kit (ABI) was used to perform reverse transcription. Messenger RNA levels were quantified with PlusOne real time quantitative system using Fast SYBR Green (ABI). rp49 was used as a control. All quantitative real time (qRT)-PCR primers are listed in Table 2.

TABLE 2.

qRT-PCR primers used

Target	Forward primer 5′-3′	Reverse primer 5′-3′
Primers used
rp49	AGATCGTGAAGAAGCGCACCAAG	CACCAGGAACTTCTTGAATCCGG
bap1/calypso	CAACAACAGTCTCAGCCACAAT	GACGAATATCTCAGCAGTTGTCTC
rpn11	CTCAATCGCCACTACTACTCGAT	CATAACCTTGTCCACCTTCTCCT
uch	GTGCCGGTAATTGTGTGTAGAA	GAATCCATTCCAAGGTGTCATC
uch-l5/uchl3	ACGGTGCTGGAAATTGGTGTCTCATTG	AAGAAGATGTTCTCCCGATCCAG
usp1	ACCTTGCGCTGCTACAGTCTAC	GCTCTTGAGCCTCTTCAATTCT
usp5	GTACGAGATCAAGGACACGTACAG	GTCAGATTAAGCCAGAGGTTGTTG
usp8	GCATTACAAGTCACCAACACCTTC	CCAGATTCTTCAGTCCAGTCAGT
usp14	ACTCCTGTCAAATTCATTGAGGAC	CAAATATAGACTTCATGGCAGACG
usp32	TTGATCTGTTCTACGGCCAGTT	AGTACTTGCAATCGGAGTTCAGAC
usp20–33	CTTGTGGAGTACATAGCAGAGCAG	CTGCTGCTGAAGTGACTGGTATT
usp47	ACGTATTCCCATCAAAATTCTGTC	TCGCTGATCTGTGATAATGAAAGT
CG2960	CTCTCTTTTCCCTTTTTCTTT	GTGGACTCCTTCTGAATGTTGTAGT
CG5271	CGCACCCTCTCTGACTATAACATT	CCGTTCTCGTCAACCTTGTAGTAT
CG32744	GGACGTCCGAGCAAGTAAAA	ATGGCTCAACCTCCAAAGTG
CG11624	CTTCGTCTCCGTGGTGGTAT	AGGGTGGACTCCTTCTGGAT
CL1-GFP	ACGTAAACGGCCACAAGTTC	AAGTCGTGCTGCTTCATGTG
Alternative DmUSP5 primers used, with similar results
usp5	GGCGGCCAAATACGTAAATA	CGTCCTTGTAGATGGGAGGA
usp5	CTCCGCACCTGGATAAGAAG	CGGTCAGATTAAGCCAGAGG
usp5	TCGGATGTGTTCTCCTACCC	CCATCGACTTCTCGCTCTTC

Results

Drosophila and Human USP5 Disassemble Unanchored Ubiquitin Chains Similarly in Vitro

CG12082 is the Drosophila gene whose product most closely aligns with mammalian USP5 (19). Like its human counterpart, CG12082 contains the ubiquitin-specific protease (USP) domain, the ubiquitin-associated domains that bind to ubiquitin moieties in polyubiquitin chains, and a zinc finger-like region (11–13, 29–31) (Fig. 1A).

FIGURE 1.

Conserved catalytic activity in vitro between Drosophila and human USP5. A, DmUSP5 closely resembles its human counterpart. 827 amino acid residues long, this DUB contains two ubiquitin-associated domains (UBA), a USP domain, and a zinc finger (ZnF) area. The catalytic cysteine of DmUSP5 is at position 341 (19). B–D, Western blots of in vitro deubiquitinating reactions containing either 50 nm human (h) USP5 or 50 nm Drosophila (Dm) USP5 with 1 μm ubiquitin chain of the indicated linkage in reaction buffer. The samples were run on 18% (B) or 15% polyacrylamide gels (C and D) and analyzed by Western blotting. For D, where indicated, 50 nm catalytically inactive recombinant DmUSP5 was used. The mutation is C341A. The blots are representative of experiments conducted at least three independent times, with similar results. Note that in Lys²⁹-only chains, there are also higher (bracketed) species, most likely tri- and tetraubiquitin, as well as higher order forms, which disappear over time. Their cleavage probably supplants diubiquitin Lys²⁹ species as the experiment progresses. Such higher order forms are not present as much or at all in the other ubiquitin species used. E, Western blots of in vitro deubiquitinating reactions with ubiquitinated proteins. CHIP and HSP70 were ubiquitinated as described under “Experimental Procedures.” The ubiquitination reaction was stopped with excess EDTA, and then 50 nm (final concentration) recombinant human (hUSP5) or Drosophila (Dm) USP5 was added to the mix. Samples were collected at the indicated time points after the addition of the DUB, resolved in 4–20% SDS-PAGE gels, and blotted as indicated. The blots are representative of deubiquitination reactions conducted at least three independent times with similar results.

Recombinant, human USP5 has been reported to hydrolyze polyubiquitin chains of different linkages in vitro (11–13, 29–31). We began our studies of Drosophila USP5 (DmUSP5) by comparing ubiquitin chain cleavage preferences between it and the human counterpart in vitro. We carried out deubiquitination reactions at 37 °C, optimal for human USP5, and 25 °C, optimal for Drosophila USP5, although the same results were also obtained at 37 °C (Fig. 1 and data not shown). We observed that DmUSP5 and human USP5 both hydrolyze unanchored polyubiquitin chains of different linkages (Fig. 1B). The recombinant proteases have different proficiencies: Lys¹¹, Lys⁴⁸, Lys⁶³, and linear (head to tail) species were cleaved more rapidly than Lys⁶- and Lys²⁹-linked diubiquitin. Both DUBs were also able to cleave rapidly di- and tetraubiquitin chains (Fig. 1B). We noticed that as Lys⁶ and Lys³³ diubiquitin disappear, monoubiquitin does not always seem to mirror the reduction of the substrate species (Fig. 1B). This is not because of indiscriminate cleaving of ubiquitin, e.g. from the presence of non-ubiquitin proteases, because the chains are stable over time in the absence of DmUSP5 (Fig. 1C); instead, it might result from reduced antibody affinity toward ubiquitin with only specific lysines present, which could affect epitope exposure/recognition in di- versus monoubiquitin. Based on these data, we conclude that the Drosophila and human USP5 enzymes have similar catalytic affinity toward most ubiquitin linkages. As shown in Fig. 1D, the catalytic cysteine at position 341 of the Drosophila USP5 is necessary for its protease activity.

There is evidence that mammalian USP5 can disassemble not only unanchored chains, but that it can also deubiquitinate specific substrates (26, 32). We thus examined whether DmUSP5 and human USP5 could remove ubiquitin from ubiquitinated, recombinant proteins in an in vitro setting. We used a previously published protocol to ubiquitinate CHIP (an E3 ubiquitin ligase) and HSP70 (the molecular chaperone (26)). As shown in Fig. 1E, both human and Drosophila USP5 deubiquitinate monoubiquitinated and polyubiquitinated CHIP, but do not affect ubiquitinated HSP70. These findings support the notion that USP5 can act on specific substrates.

DmUSP5, Important during Fly Development, Is Dispensable in Adults

To progress toward our major goal, to determine whether DmUSP5 is required for monoubiquitin maintenance in vivo in Drosophila, we next tested the importance of this DUB during development and in adults. Our group and others previously reported that RNAi-dependent knockdown of DmUSP5 and mutations in its gene lead to developmental lethality in the fruit fly (16, 19, 20). To examine whether this DUB is also important in adults, we employed the power of the Gal4-UAS system (33).

We began by testing the efficacy of various RNAi lines targeting DmUSP5. DmUSP5 is expressed throughout the fly (20); therefore, we targeted this protease in the whole organism by using the ubiquitous drivers sqh-Gal4, actin-Gal4, and da-Gal4 with similar results. We used three different RNAi lines specific for DmUSP5 that target different sites of its mRNA. RNAi-1 and -2 were generated through P-element-mediated insertions of a UAS-based transgene (21), whereas RNAi-3 was generated through site-specific recombination by using the phiC31 integrase (34).

Knocking down DmUSP5 in the whole fly using ubiquitous drivers causes third instar larval lethality with RNAi-3 and mid pupal lethality with RNAi-1 and -2, compared with their respective host line controls (Fig. 2A). Death at third instar larval stage is the same as observed with DmUSP5 null mutation (20). The level of knockdown obtained by the ubiquitous sqh-Gal4 driver was determined through qRT-PCR and is shown in Fig. 2B. We consistently observe a more pronounced phenotype with RNAi-3 compared with the two other RNAi lines. This is most likely due to RNAi-3 reducing the levels of DmUSP5 mRNA more strongly than RNAi-1 and -2 (Fig. 2B).

FIGURE 2.

DmUSP5 is necessary during fly development but not in adults. A, summary of phenotypes when DmUSP5 is knocked down throughout the fly. The flies were heterozygous for all transgenes. The results and percentages are from independent crosses conducted at least 10 times each, with similar outcomes. No larvae (RNAi-3) or pupae (RNAi-1 and -2) varied from the indicated stage of death when DmUSP5 was knocked down. B, qRT-PCR results from flies expressing DmUSP5-RNAi driven by sqh-Gal4. The flies were heterozygous for UAS-RNAi and sqh-Gal4. Control, sqh-Gal4 on the background host line for each RNAi. Black font p values compare RNAi-1, -2 and -3 to the control line. Red font p values compare RNAi-2 and RNAi-3 to RNAi-1. p values are from analysis of variance with Tukey's post hoc correction. Error bars indicate S.D., n = 6 independently conducted experiments. C, diagram summarizing the mechanism of Gal80. Please see text for additional details for this method. D, time line summarizing when flies were moved from the permissive to the restrictive Gal80 temperature and the effect of switching on Gal4-driven knockdown of DmUSP5. Driver was sqh-Gal4, and the RNAi line was UAS-RNAi-3. The flies were heterozygous for all transgenes. The results are from at least n = 5 independent crosses for each point, with similar results. At least 200 adults flies per group were monitored for the longevity experiment where adults successfully eclosed from their pupal cases. E, qRT-PCR from adult flies maintained at the restrictive Gal80 temperature for either 1 or 28 days, showing decreased levels of DmUSP5 mRNA when Gal4 is active. p value is from Student's t test. Error bar indicates S.D., n = 5 independent replicates. All flies were heterozygous for sqh-Gal4, Gal80, and UAS-RNAi-3 targeting DmUSP5.

Although the importance of DmUSP5 during development is clear, it has not been reported before whether this DUB is also required in later stages, including adults. We next utilized a ubiquitously expressed, temperature-sensitive Gal80^ts construct (35) to control when UAS-RNAi-3 targeting DmUSP5 is expressed (Fig. 2C). Gal80 binds to Gal4 and prevents this transcription factor from driving the expression of UAS-based transgenes, in this case, UAS-RNAi-3. When flies containing the Gal80 construct alongside RNAi-3 and the ubiquitous sqh-Gal4 driver are placed at the permissive temperature (18 °C), Gal80 impedes RNAi-3 expression. When flies are moved to the Gal80 restrictive temperature (30 °C), sqh-Gal4 can drive expression of UAS-RNAi-3.

We began by examining the effect of DmUSP5 knockdown when RNAi-3 targeting its mRNA is enabled from the beginning (Fig. 2D); these flies die as third instar larvae, in accordance with data in Fig. 2A. Induction of USP5 knockdown beginning at larval and pupal stages results in death during pupal and pharate adult stages, respectively (Fig. 2D). However, when developing flies are moved to the restrictive Gal80 temperature as soon as they enter the pharate adult stage, these flies eclose normally and live a life span not different from their control siblings. When adults are moved to the restrictive temperature as soon as they eclose from the pupal case, they also survive and live a life span not different from controls that do not express RNAi-3 (Fig. 2D). Fig. 2E confirms reduction of DmUSP5 message when Gal80 is restricted. Based on these findings, USP5 is required during development but is not critically important in adults.

DmUSP5 Knockdown Leads to Increased Conjugated Ubiquitin Species without Depleting Monoubiquitin

USP5 is considered to be primarily a ubiquitin chain dismantler for the purpose of monoubiquitin recycling (3, 7, 15, 16). To examine the effect of DmUSP5 knockdown on overall ubiquitin species in developing flies, we performed Western blotting from whole larval and pupal lysates and probed for ubiquitin (Fig. 3A).

Lysates were prepared from developing flies harvested before death. The larvae were from crosses where UAS-RNAi-3 was driven by sqh-Gal4, whereas the pupae were from UAS-RNAi-1 and -2, also driven by sqh-Gal4. Compared with their controls, containing sqh-Gal4 on the respective host background of the UAS-RNAi transgenes, but without DmUSP5 knockdown, we observed increased levels of conjugated ubiquitin (brackets in Fig. 3A; quantified in Fig. 3B). Interestingly, we did not observe depletion of monoubiquitin alongside higher levels of conjugated ubiquitin (Fig. 3, A and B). In fact, we observed increased levels of monoubiquitin when DmUSP5 is knocked down. The important point, however, is that DmUSP5 knockdown in the fruit fly does not lead to decreased levels of monoubiquitin. We used two different anti-ubiquitin antibodies to assay conjugated and monoubiquitin in fly lysates, with similar results (Fig. 3, A and C, and other supportive data not shown). Based on these outcomes, knockdown of DmUSP5 does not lead to a reduction of monoubiquitin in developing flies.

Intrigued by a lack of depletion of monoubiquitin when DmUSP5 is knocked down, we examined why this may be the case. Monoubiquitin is maintained through de novo synthesis from genes that encode it as a fusion protein to additional ubiquitin moieties or to other proteins and by being cleaved from ubiquitin chains or substrates (15). We wondered whether knockdown of DmUSP5 leads to increased transcription of ubiquitin-encoding genes in Drosophila. We assessed by qRT-PCR the levels of different ubiquitin-encoding genes in the fly: the monoubiquitin encoding genes CG2960 and CG5271, which encode ribosomal fusion proteins RpL40 and RpS27A, respectively, and two polyubiquitin encoding genes, CG32744 and CG11624. Another gene, CG11700, which closely aligns with CG32744 (36), was assayed through CG32744 primer sets. We identified these genes by using the FlyBase resource (a database of Drosophila genes and genomes), through our own alignments with mammalian ubiquitin-encoding genes through BLASTp, and based on previously published work (36). Based on qRT-PCR results, there is no overall increase in ubiquitin gene expression when DmUSP5 is knocked down everywhere in the fly (Fig. 4A). In fact, in some instances we observe a statistically significant decrease in ubiquitin gene expression. These data suggest that lack of depletion of monoubiquitin when DmUSP5 is knocked down is not due to increased ubiquitin production at the transcript level.

FIGURE 4.

Ubiquitin-expressing genes are not up-regulated when DmUSP5 is knocked down. A, qRT-PCR results examining the expression of fly ubiquitin genes when the noted DmUSP5-RNAi constructs were driven by sqh-Gal4. p values are from Student's t tests. Error bars indicate S.D., n = 3 independently conducted experiments. The flies were heterozygous for driver and RNAi lines. Control, sqh-Gal4 on the host backgrounds of RNAi and at the same stage as RNAi lines (mid pupae for RNAi-1 and RNAi-2, third instar larvae for RNAi-3). B, qRT-PCR analyses of different Drosophila DUBs when DmUSP5 is knocked down using RNAi-3. All flies were heterozygous for UAS-RNAi-3 and sqh-Gal4, except for the control group, which contained sqh-Gal4 on the host background of RNAi-3. p values are from Student's t tests. Error bars indicate S.D., n = 4 independently conducted experiments. Red boxes, proteasome-associated DUBs. C, summary of results when UAS-USP14 is overexpressed in Drosophila, whereas DmUSP5 is knocked down using RNAi-1. All flies were heterozygous for the transgenes. The driver was sqh-Gal4. Summary is from at least eight independent crosses, with similar results. No pupae varied from the indicated stage of death when DmUSP5 was knocked down.

Next, we examined the expression levels of other DUBs that have been linked to monoubiquitin maintenance and that function, at least in part, by associating with the proteasome, where DmUSP5 is also proposed to act: USP14, RPN11, and UCH-L5 (19). Based on qRT-PCR, reduced DmUSP5 mRNA levels coincide with mildly, but statistically significantly, increased levels of USP14, RPN11, and UCH-L5 (Fig. 4B). The levels of expression of these DUBs during fly development and in adults vary from moderate to very high, similar to the expression of DmUSP5 (transcriptional data on FlyBase). This could suggest that some DmUSP5 functions might be complemented by increased transcription of these other DUBs, even though ultimately they fail to suppress lethality caused by the absence of DmUSP5 during development. Increased transcription of endogenous USP14, a DUB demonstrated to maintain monoubiquitin in mice (37–40), may account for monoubiquitin not being depleted when DmUSP5 is knocked down in developing flies. When we tested whether exogenous USP14 alleviates lethality caused by knockdown of DmUSP5, we found that this was not the case (Fig. 4C): USP14 overexpression alongside ubiquitous DmUSP5 knockdown results in developmental lethality at the same stage as DmUSP5 knockdown without exogenous USP14. Overexpression of USP14 by itself is not detrimental to the fly (data not shown).

Lastly, we used a UAS-based, HA-tagged monoubiquitin transgenic fly line to overexpress wild type ubiquitin (41). Expression of ubiquitin through this line leads to an overall increase in levels of conjugated ubiquitin in intact flies (Fig. 5A). Importantly, as shown in the right portion of Fig. 5A, the HA-tagged monoubiquitin that we overexpress is conjugated in flies (also see Fig. 5C). Monoubiquitin expression simultaneously with DmUSP5 knockdown, however, does not affect the stage at which developing flies die (Fig. 5B). Thus, lethality caused by DmUSP5 knockdown in Drosophila is unlikely to be due to a lack of monoubiquitin available for conjugation to various proteins. As shown in Fig. 5C, exogenous ubiquitin does not lead to an appreciable difference in ubiquitin species observed by Western blotting when DmUSP5 levels are reduced. Collectively, the data in Figs. 3–5 led us to conclude that DmUSP5 is not necessary for monoubiquitin maintenance in Drosophila.

FIGURE 5.

Monoubiquitin expression does not suppress lethality caused by knockdown of DmUSP5. A, Western blots from flies expressing UAS-monoubiquitin, driven by sqh-Gal4. Monoubiquitin is HA-tagged. The flies were heterozygous for all transgenes. Control, sqh-Gal4 on the background line of UAS-monoubiquitin. Shown are blots from three independent experiments, separated by dotted lines. The left set of blots was electrophoresed on a 15% SDS-PAGE gel; the rest were electrophoresed on 4–20% gels. Red numbers show conjugated protein levels compared with controls. Blue numbers show monoubiquitin levels compared with controls. For the right set of blots, which are from the same experiment, HA-tagged ubiquitin is incorporated into conjugated ubiquitin species. Note that the anti-HA antibody shows multiple nonspecific bands in the lane without monoubiquitin overexpression. B, summary of results when UAS-monoubiquitin is overexpressed in Drosophila, while DmUSP5 is knocked down using RNAi-1 or RNAi-3. All flies were heterozygous for the transgenes. The driver was sqh-Gal4. The summary is from at least five independent crosses, with similar results. No larvae (RNAi-3) or pupae (RNAi-1) varied from the indicated stage of death when DmUSP5 was knocked down. C, Western blots from pupae expressing RNAi-1, driven by sqh-Gal4, in the absence or presence of UAS-monoubiquitin coexpression. The flies were heterozygous for all transgenes. The blots are representative of experiments conducted independently at least five times, with similar results. In anti-HA blot, note again the presence of nonspecific bands in the absence of the HA-ubiquitin transgene. 4–20% gradient gel was used.

Accumulation of Conjugated Ubiquitin Species during DmUSP5 Knockdown Is an Early Event

The results shown in the previous figures were from samples collected preceding larval (RNAi-3) or pupal (RNAi-1 and -2) death when DmUSP5 is knocked down. To examine more temporally the changes in ubiquitin species when DmUSP5 levels are reduced, we analyzed developing flies of different stages when DmUSP5 is knocked down through RNA-1 or -2, which cause pupal death. As summarized in Fig. 6, when DmUSP5 is knocked down, accumulation of conjugated ubiquitin species begins at least as early as third instar larvae and continues through early and mid pupal stages, when they die. This increase in conjugated species is accompanied by an increase in monoubiquitin that appears more robust over time (Fig. 6).

FIGURE 6.

Conjugated ubiquitin accumulates early when DmUSP5 is knocked down. A, Western blots of larval and pupal lysates (17% gel) when DmUSP5-RNAi-1 or -2 were driven by sqh-Gal4. Samples were collected during three stages of development, as noted. The flies were heterozygous for RNAi and sqh-Gal4. Control, sqh-Gal4 on the host background of RNAi. Direct blue staining shows total protein loaded. B, quantifications of Western blots from A and other similar, independent experiments. p values are from Student's t tests. Error bars indicate S.D., n = 4 independently conducted experiments.

DmUSP5 Knockdown Leads to Impaired Proteasome Activity

Excess ubiquitin chains can compete for proteasomal binding with substrates destined for degradation, thereby impairing ubiquitin-dependent proteasome activity (4, 14, 42). As shown in earlier figures, there is an accumulation of conjugated ubiquitin species that results from knocking down DmUSP5 throughout the fly. Could these species coincide with impaired proteasome function? To examine this possibility, we used a reporter of ubiquitin-dependent proteasome function, CL1-GFP. This construct consists of a GFP moiety fused to the CL1 degron, a signal that targets GFP for proteasomal degradation through ubiquitination (43, 44). We used the ubiquitous driver, da-Gal4, to express the reporter throughout the fly while simultaneously knocking down USP5 with RNAi-1. da-Gal4 also leads to death at mid pupal stages with RNAi-1 and -2, similar to what we observe with the other driver, sqh-Gal4. As the blots in Fig. 7A show, there is an increase in CL1-GFP protein when DmUSP5 is knocked down compared with its respective, no knockdown control. Increased levels of CL1-GFP protein when DmUSP5 is reduced are not due to higher CL1-GFP mRNA (Fig. 7B), indicative of impaired ubiquitin-dependent proteasomal activity.

FIGURE 7.

Knockdown of DmUSP5 causes impairment of proteasome activity. A and C–E, left panels, Western blot of pupal lysates where the ubiquitous drivers da-Gal4 (A) or sqh-Gal4 (C–E) express DmUSP5 UAS-RNAi-1 throughout the fly. RNAi Ctrl, ubiquitous driver for each panel on the isogenic background of RNAi-1. A and B, UAS-CL1-GFP is also expressed in these pupae. C–E, no UAS-CL1-GFP is present. Right panels, quantification of data from each Western blot shown and other, independently conducted experiments. p values are from Student's t tests. Error bars indicte S.D., n ≥ 3 independently conducted experiments for each panel. Arrows in D, Sin3 has different isoforms, both of which are detected by this antibody. 4–20% gradient gels were used. B. qRT-PCR results from pupae with the same genotype and age as in A. n = 3 independent experiments. Error bar indicates S.D. p value is from Student's t test.

We then examined the levels of endogenous proteins that are proteasome substrates: cyclin A (45) and Sin3 (whose orthologue in mammals is degraded by the proteasome, (50)). None of these proteins has been linked to DmUSP5 so far. We also tested the protein levels of VCP/p97, whose expression is induced when proteasome function is reduced (46). As indicated by data in Fig. 7 (C–E), knockdown of DmUSP5 leads to statistically significantly higher levels of each of these endogenous proteins in developing flies. Based on data in Fig. 7, we conclude that ubiquitin-dependent proteasome activity is inhibited by reduced levels of USP5 in Drosophila.

Discussion

Ubiquitination is a critical regulator of most cellular pathways. Therefore, the process of protein ubiquitination and ubiquitin availability both are carefully monitored (1–3, 47). Important regulators of protein ubiquitination are the DUBs, one of which, USP5, has been proposed to function in part by maintaining monoubiquitin (3, 7, 15, 16). Here, our primary question was whether the fly orthologue of this protease is important for monoubiquitin recycling in vivo. We found that this is not the case in Drosophila.

Prior work conducted on DmUSP5 delivered some information on its role on monoubiquitin levels. One study (20) found either increased levels or nondepleted monoubiquitin in DmUSP5 mutants in Drosophila. However, whether this meant that fly USP5 is dispensable for monoubiquitin recycling was not clarified. Another study observed increased levels of conjugated ubiquitin, whereas the levels of monoubiquitin did not appear to be consistently depleted when the gene was mutated in the fruit fly (16). Both of these studies arrived at a similar conclusion: USP5 is important for ubiquitin homeostasis in Drosophila. The issue raised in our present work, whether USP5 is needed for monoubiquitin recycling in Drosophila, requires further investigation.

We here presented evidence that Drosophila USP5, which functions similarly to its human counterpart in vitro, is required during fly development but seems dispensable in adults. These findings correspond well with previously published reports by others and us, which showed that this DUB is required in developing flies: ubiquitous knockdown and knockdown in select tissues (e.g. neurons and glial cells) during development has negative effects (16, 19, 20).

In reconstituted systems, both human and fly USP5 efficiently cleave ubiquitin chains linked head to tail and through Lys¹¹, Lys⁴⁸, and Lys⁶³. Lys¹¹- and Lys⁴⁸-linked ubiquitin have been connected to the degradation of proteins by the proteasome, whereas Lys⁶³-linked chains have been associated with other pathways, including DNA repair, endosomal recycling, and autophagy (6, 48). Our in vitro data also hint at the possibility that USP5 may have specific substrates. This DUB was able to rapidly and efficiently deubiquitinate at least one recombinant, ubiquitinated protein in a reconstituted system, but not a second. There have been other reports of mammalian USP5 acting on specific substrates in vitro and in vivo (26, 32).

Although we found a clear importance for the presence of this DUB during larval and pupal stages, USP5 did not seem important when it was knocked down only during adult stages, even though it is well expressed in adults, based on transcriptional data aggregated on Flybase. If DmUSP5 is acting on specific substrates, perhaps they are not as critical in adults as in earlier stages. Alternatively, expression of other DUBs may at this point complement some of the USP5 functions that they could not in larval and pupal stages. We hope to identify specific DmUSP5 substrates in the near future through quantitative mass spectrometry.

Our collective genetic and biochemical experiments indicate that the function of DmUSP5 in flies is not to maintain monoubiquitin. Perhaps it is useful to compare our results with data from work conducted with another DUB, USP14, which is important for maintaining monoubiquitin in the nervous system of mice (37–40, 49). Mutations in USP14 lead to reduced monoubiquitin protein levels and increased transcription of ubiquitin-encoding genes (39). Importantly, introduction of wild type monoubiquitin alleviates some of the phenotypes caused by loss of USP14 (39). In our case, depletion of DmUSP5 does not lead to lower levels of monoubiquitin (in fact, we see a trend of increased monoubiquitin at the protein level), transcription of fly ubiquitin-encoding genes is not increased, and introduction of exogenous ubiquitin does not suppress the lethality effect of DmUSP5 knockdown. Thus, our work argues that DmUSP5 is not critically needed to maintain the monoubiquitin pool in vivo in Drosophila.

qRT-PCR results hint that maintenance of monoubiquitin when DmUSP5 is knocked down may result from increased transcription of other DUBs that can yield monoubiquitin, such as USP14. Other investigators also described increased levels of various DUBs when DmUSP5 was reduced or absent in the fly (16, 20). Up-regulation of these other DUBs, however, appears unable to suppress lethality caused by DmUSP5 knockdown or to normalize the levels of conjugated ubiquitin species that we observe in Western blots. These findings suggest a highly regulated and flexible system for DUB expression in vivo, while also underscoring the nonredundant roles that these proteases play in intact organisms, as we also described before (19).

Excess conjugated ubiquitin may hinder ubiquitin-dependent proteasomal degradation of proteins by competing for binding to the 19S proteasome. Based on our work with the reporter CL1-GFP and the endogenous proteins cyclin A, Sin3, and VCP/p97, proteasome function is indeed reduced when DmUSP5 is knocked down throughout the fly.

Our work leads us to propose that a primary function of DmUSP5 in Drosophila is the disassembly of conjugated ubiquitin, which helps, at least in part, to maintain proteasome activity. When this protease is unavailable, increased transcription of other DUBs could assist with the processing of some conjugated ubiquitin to recycle monoubiquitin. However, these proteases appear unable to fully complement DmUSP5 activities. We suggest that as the proteasome is inhibited by species that would have been disassembled by DmUSP5, conjugated and monoubiquitin levels increase as ubiquitinated substrates and ubiquitin (itself a proteasome substrate (47)) are degraded less rapidly. Ultimately death ensues, probably because of proteasomal inhibition.

In summary, we presented evidence that DmUSP5 is not required for monoubiquitin maintenance in vivo. Based on our additional work that DmUSP5 has wide, although not universal, ubiquitin chain linkage preferences, it will be of interest to continue to examine the various pathways and processes in which this developmentally required DUB is involved.

Author Contributions

G. R., W.-L. T., K. M. S., and S. V. T. designed the study. G. R., W.-L. T., E. G., A. J. K., K. M. S., and S. V. T. prepared the reagents and conducted the experiments. G. R., W.-L. T., E. G., K. M. S., and S. V. T. analyzed the data and prepared the figures. G. R., K. M. S., and S. V. T. wrote the manuscript.