Skip to main content
Clinical Microbiology Reviews logoLink to Clinical Microbiology Reviews
. 2016 Mar 30;29(3):487–524. doi: 10.1128/CMR.00072-15

Zika Virus

Didier Musso a,✉, Duane J Gubler b,c,✉
PMCID: PMC4861986  PMID: 27029595

SUMMARY

Zika virus (ZIKV) is an arthropod-borne virus (arbovirus) in the genus Flavivirus and the family Flaviviridae. ZIKV was first isolated from a nonhuman primate in 1947 and from mosquitoes in 1948 in Africa, and ZIKV infections in humans were sporadic for half a century before emerging in the Pacific and the Americas. ZIKV is usually transmitted by the bite of infected mosquitoes. The clinical presentation of Zika fever is nonspecific and can be misdiagnosed as other infectious diseases, especially those due to arboviruses such as dengue and chikungunya. ZIKV infection was associated with only mild illness prior to the large French Polynesian outbreak in 2013 and 2014, when severe neurological complications were reported, and the emergence in Brazil of a dramatic increase in severe congenital malformations (microcephaly) suspected to be associated with ZIKV. Laboratory diagnosis of Zika fever relies on virus isolation or detection of ZIKV-specific RNA. Serological diagnosis is complicated by cross-reactivity among members of the Flavivirus genus. The adaptation of ZIKV to an urban cycle involving humans and domestic mosquito vectors in tropical areas where dengue is endemic suggests that the incidence of ZIKV infections may be underestimated. There is a high potential for ZIKV emergence in urban centers in the tropics that are infested with competent mosquito vectors such as Aedes aegypti and Aedes albopictus.

INTRODUCTION

After the first isolation of Zika virus (ZIKV) in 1947 from a rhesus monkey (1), ZIKV infection in humans was first described in Nigeria (Africa) in 1954 (2). For half a century, fewer than 20 human infections were documented (3) and most of the data came from yellow fever virus (YFV) serosurveys. ZIKV was isolated from several mosquito species collected during arbovirus studies in Africa and during fever studies in Asia (1, 4–15). The first reported outbreak of Zika fever occurred in 2007 on the Western Pacific island of Yap in the Federated States of Micronesia (16); this was followed by a larger epidemic in French Polynesia in the South Pacific in 2013 and 2014 (17), with an estimated 30,000 symptomatic infections (18, 19). These epidemics were followed by smaller Pacific outbreaks in 2014 in New Caledonia (20), the Cook Islands (21), and Easter Island (22) and in 2015 in Vanuatu (23), the Solomon Islands (24), Samoa (25), and Fiji (26). In 2015, ZIKV emerged for the first time in the Americas (Brazil in March) and, as of the end of January 2016, autochthonous circulation of ZIKV has been reported in more than 20 countries or territories in South, Central, and North America and the Caribbean (24, 27–32), and an outbreak was reported in West Africa (Cape Verde) in November (33). The emergence of ZIKV was associated with the description of severe neurological complications: Guillain-Barré syndrome (GBS) in adults in French Polynesia and microcephaly in neonates in Brazil (31, 34–38).

Cocirculation of ZIKV with dengue virus (DENV) and chikungunya virus (CHIKV) has been documented in French Polynesia (39) and Brazil (27) but most likely also occurs throughout the Americas, Asia, several Pacific islands, and Africa, where DENV and CHIKV are endemic. It is now clear that ZIKV is following the path of DENV and CHIKV, spreading to all countries infested with Aedes aegypti and Aedes albopictus mosquitoes (40). Here we present a comprehensive review of the data available on this emerging virus.

ARBOVIRUSES: IMPORTANT CONCEPTS

History/Definition/Classification

The term arbovirus, a contraction of arthropod-borne virus, is an ecological term defining viruses that are maintained in nature through biological transmission between a susceptible vertebrate host and a hematophagous arthropod such as a mosquito (41). Arboviruses were first classified according to serological criteria (antigenic classification) (41–44). A new molecular basis for taxonomy is now used, and the genus Flavivirus is classified in clusters, species, and clades (45–48). The genus Flavivirus is composed of 53 virus species placed in three clusters: mosquito-borne viruses, tick-borne viruses, and viruses with no known vector (International Committee on Taxonomy of Viruses website chapter on virus families not assigned to an order, family Flaviviridae, http://ictvonline.org/virusTaxonomy.asp) (45, 49, 50). A fourth group of viruses found only in insects will also likely be placed in this genus (51). For additional information on the history, definition, classification, taxonomy, and diagnosis of arboviruses, see previously published reviews (51–56).

Hosts/Reservoirs

Most of the arboviruses cause zoonoses that usually depend on nonhuman animal species for maintenance in nature. Many animal species are host reservoirs (host of an infection in which the infectious agent multiplies and develops and on which the agent is dependent for survival in nature) of arboviruses (57, 58); humans, with few exceptions (DENV, CHIKV, or YFV) are dead-end or accidental hosts (hosts from which infectious agents are not transmitted to other susceptible hosts) (59). Arboviruses such as DENV have adapted completely to humans and can be maintained in large tropical urban centers in a mosquito-human-mosquito transmission cycle that does not depend on nonhuman reservoirs (57). However, sylvatic strains of DENV still occur and can infect humans, suggesting the possibility of reemergence of DENV from sylvatic cycles; arboreal mosquitoes are also capable of transmitting human DENV strains (60–62).

Vectors and Transmission

A vector of arboviruses may be defined as an arthropod that transmits the virus from one vertebrate to another by bite (63). The most common mode of biological transmission is infection during a viremic blood meal and injection of infectious saliva during blood feeding (horizontal transmission).

Nonvector arbovirus transmission has been reported to occur directly between vertebrates (64, 65), from mother to child (66–71), nosocomially (72–74), by transfusion (75–78), via bone marrow (79) or organ (80) transplantation, and sexually (81).

Emergence

In the last 40 years, there has been a resurgence of a number of well-known arboviruses (57), such as West Nile virus (WNV), DENV, and CHIKV. The capacity of arboviruses to adapt to new vectors may have a major impact on the geographic expansion of arboviruses. For example, DENV, YFV, and CHIKV can be transmitted by feral African, Asian, or American mosquitoes but have adapted to domesticated Ae. aegypti and Ae. albopictus (82). Other factors associated with the emergence of arboviruses include (57, 83) genetic changes for CHIKV (84–87), DENV (88–91), and WNV (92–94); climate change (95–97); uncontrolled use of insecticides (98); perturbations of natural systems that are frequently anthropogenic (97, 99, 100); expansion of the geographic distribution of mosquito vectors (101, 102); adaptation to new reservoir/amplification hosts (103); global growth of human populations with extensive urbanization (57, 95); lack of effective mosquito control (104); and increased travel (57, 105). We have presented only a few examples of arbovirus emergence, for additional data, see reviews of arbovirus emergence, especially those by Gubler (57), Kuno and Chang (65), Powers (83), Weaver et al. (95, 106), and Vazilakis et al. (107).

HISTORY AND EMERGENCE OF ZIKV

The discovery of ZIKV and many other arboviruses was the result of research programs on yellow fever sponsored by the Rockefeller Foundation from 1914 to 1970. ZIKV was discovered in the course of a study of the vector responsible for the cycle of sylvan YFV in Uganda (1, 108–110). Over a 10-year period from1937 to 1947, 10 different viruses were isolated at the Yellow Fever Research Institute, Entebbe, Uganda, including 7 new viruses (108): WNV (111) and Bwamba virus (112) in 1937, Semliki Forest virus in 1942 (113), Bunyamwera virus (114) and Ntaya virus (115) in 1943, and Uganda S virus (116) and ZIKV (1, 117) in 1947. With the exception of the Uganda S virus, all of these viruses were named after the geographic places where they were isolated. Four of these viruses were related, belonging to the genus Flavivirus (WNV, Ntaya virus, Uganda S virus, and ZIKV) (45). There are considerable data on the seroprevalence of ZIKV in Africa, but because of the large number of flaviviruses in that region and the extensive cross-reactivity among the viruses of that genus, the data are difficult to interpret. The fact that these viruses were discovered in Uganda does not necessarily reflect the origin of the viruses but rather indicates areas in Uganda where yellow fever studies were conducted.

Discovery

In April 1947, six sentinel platforms containing caged rhesus monkeys were placed in the canopy of the Zika Forest of Uganda (1). On 18 April, the temperature of one of the caged rhesus monkeys (no. 766) was 39.7°C. A blood sample was taken from that monkey on the third day of fever and injected intracerebrally and intraperitoneally into Swiss mice and subcutaneously into another rhesus monkey (no. 771). All of the mice inoculated intracerebrally showed signs of sickness on day 10 after inoculation, and a filterable transmissible agent was isolated from the brains of those sick mice. During the observation period, monkey no. 766 showed no abnormality other than pyrexia and monkey no. 771 showed neither an elevated body temperature nor any other abnormality. The agent isolated from monkey no. 766 was referred to as ZIKV (the ZIKV 766 strain). This agent was neutralized by convalescent-phase serum taken from monkey no. 766 1 month after the febrile episode and by serum taken from monkey no. 771 35 days after inoculation. Preinfection serum samples collected from these monkeys did not neutralize the ZIKV 766 strain.

In January 1948, mosquitoes were collected in the Zika Forest in an attempt to isolate YFV (1). Eighty-six Aedes africanus mosquitoes were collected, and mice were inoculated with the Seitz filtrate of pools of these mosquitoes. One mouse died on day 6 after inoculation, and one appeared sick on day 14. The virus isolated from Ae. africanus was designated ZIKV (E/1 strain). The remaining portion of the Seitz filtrate was inoculated subcutaneously into rhesus monkey no. 758. This monkey remained asymptomatic, but two mice inoculated intracerebrally with blood taken from this monkey died and another became sick; ZIKV (758 strain) was isolated from its serum. Rhesus monkey no. 758 developed neutralizing antibodies to the agent isolated from its serum, to the strain of virus isolated from Ae. africanus (ZIKV E/1 strain), and to the strain isolated from rhesus monkey no. 766 (the ZIKV 766 strain). Cross neutralization tests (NT) showed that ZIKV was different from YFV, DENV, and Theiler's encephalomyelitis virus; NT with ZIKV and the antisera from other neurotropic viruses showed no relationship. Cross-reactions performed by complement fixation (CF) confirmed that ZIKV was a distinct virus (118).

The first human ZIKV isolate came from a 10-year-old Nigerian female in 1954 (2). ZIKV was isolated in mice inoculated with the patient's serum. Interpretation of the clinical presentation of the patient was difficult because the patient's blood also contained numerous malaria parasites. The other two cases of human ZIKV infection reported in 1954 in Nigeria were confirmed by a rise in serum neutralizing antibodies (2). Outside Africa, ZIKV was isolated for the first time from mosquitoes (Ae. aegypti) in 1969 in Malaysia (4); subsequently, the first human infections were reported in central Java, Indonesia, in 1977 (119).

ZIKV Serosurveys in the 1950s in Africa and Asia

Serosurveys for arboviruses were conducted by using a hemagglutination inhibition (HI) test (120), a CF test (121), an NT (117), a mouse protection test (2), a hemagglutination assay (122), and an enzyme-linked immunosorbent assay (ELISA) (123). The HI test described by Clarke and Casals (124) has been the most extensively employed (52).

Interpretation of Flavivirus serological results is difficult because cross-reactions within this group of arboviruses were not well characterized when the first serosurveys were conducted. Discrepant results were observed when sera were tested by different methods (125–127) and even when the same method was used (128). Some studies reported results only for “arbovirus group B,” but results for ZIKV were not available (129). ZIKV was not always included in the panel of antigens tested. For example, several studies of both human and animal sera in South Africa included only serological data for Spondweni virus (SPOV), the Flavivirus closest to ZIKV; positive samples were found (130, 131). Because of cross-reactions within the Flavivirus genus, positive reactions for SPOV could have been the consequence of cross-reactions with ZIKV or another Flavivirus.

Nevertheless, although the data should be interpreted with caution, serosurveys suggest that ZIKV is endemic to Africa (East, Central, West, and South) and several countries in Asia. These global data were further confirmed by isolation of ZIKV from vectors and vertebrate hosts in most of these countries. Detailed results of ZIKV serosurveys of humans are reported in Table 1. African, Asian, American, and Pacific countries in which ZIKV strains or ZIKV antibodies have been detected in humans, animals, or vectors are shown in Fig. 1 to 4, respectively.

TABLE 1.

Human ZIKV serosurvey

Yr Country and district No. of cases/total (%) Serology Reference(s)
1945, 1947, 1952 Uganda MPTa 417
    Bwamba Children, 15/80 (18.7); adults, 13/44 (29.5)
    Toro Children, 0/15 (0); adults, 1/46 (2.2)
    Central Children, 2/53 (3.3); adults, 0/12 (0)
    Malambigambo Forest Children, 0/3 (0); adults, 0/8 (0)
    Totals Children, 17/151 (11.3); adults, 14/110 (12.7); all, 31/261 (11.9)
1945, 1947, 1952 Tanganyika (Tanzania) Children, 2/15 (13.3); adults, 4/21 (19); all, 6/36 (16.7) MPT 417
1951, 1952 Nigeria NT 2
    Ilaro 74/163 (45.4)
    Kantagora 12/74 (16.2)
    Total 86/237 (36.3)
1951 Nigeria Children, 43/97 (44.3) MPT 418
Before 1952 Uganda Children, 2/28 (7.1); adults, 4/71 (5.6); all, 6/99 (6.1) NT 117
1952 Indiar 33/196 (16.8)e NT 419
1952 Nigeria 50/84 (59.5) MPT 2
1953 Philippines 19/153 (12.4) NT 420
1953, 1954 Malaya 75/100 (75) NT 421
1954 Thailand 8/50 (16) NT 421
1954 Indochina (Vietnam) 2/50 (4) NT 421
1954 Malaya and Borneo Malaya, 15/79 (19); Borneo, 9/50 (18) NT 422
1954 Egypt Children, 0/80 (0); adults, 1/100 (1); all, 1/180 (0.6) NT 423
1955 Nigeria 114/207 (55.1) MPT 418
1957 Mozambique Children, 2/107 (1.9); adults, 8/142 (5.6); all, 10/149 (4.7) NT 424
1960 Angola Children, 40/252 (15.9); adults, 93/240 (38.7); all, 133/492 (27) HI 120
1961, 1962 Central African Republic 106/217 (48.8) HAb 122
1961–1964 Ethiopia HI 425
    Area where YFV is endemic 37/533 (6.9)
    Area where YFV is not endemic 9/783 (1.1)
    Total 48/1,316 (3.6)
1962 Senegal 146/440 (33.2) HI 368
1963, 1964 Haute Volta (Burkina Faso) 1,005/1,896 (53) HI 110
1963, 1964 Central African Republic HI 426
    Bangui 24/391 (6.1)
    Obo 17/85 (20)
    Lobaye 15/239 (6.3)
    Pygmy population 7/193 (3.6)
    Total 63/908 (6.9)
1963–1965 Ivory Coast 373/864 (20) HI 427
1964, 1965 Portuguese Guinea (Guinea-Bissau) Coastal region, 47/569 (8.3); interior region, 74/534 (13.9); nonresident, 1/51 (10.6); all, 122/1,154 (10.6) HI 428
1964–1966 Togo 401/1,294 (31) HI 110
1964–1966 Cameroon 614/3,612 (17) HI 429
1964–1967 Mali 1,232/2,369 (52) HI 110
1965 Niger 55/308 (17.9) HI 110
1965, 1966 Nigeria 60/351 (17.1) HI 56
1965, 1966 Nigeria 15/131 (11.5) HI 430
1966 Somalia 3/242 (1.2)f HI 431
1966, 1967 Nigeria HI 110
    Swamp area 25/172 (14.5)
    Forest area 64/88 (72.7)
    Savanna area 120/248 (48.4)
    Total 209/508 (41.1)
1966, 1967 Nigeria Children, 0/311 (0); adults, 9/177 (5.1); all, 9/488 (1.8) HI 432
1966, 1967 Uganda HI 431
    Karamoja District 0/245 (0)
    Other districts 5/61 (8.2)g
    Total 5/306 (1.6)
1966 to 1968 Kenya HI 433
    Central 27/822 (3.3)
    Kitiu 14/1,042 (1.3)
    Malindi 434/834 (52)
    Total 475/2,698 (17.6)
1967 Dahomey (Benin) 108/244 (44.3) HI 110
1967 Gabon 50/717 (7) HI 110
1967 Liberia 19/388 (4.9) HI 110
1967 to 1969 Uganda Children, 15/828 (1.8); adults, 89/1,041 (8.5); all, 104/1,869 (5.6) HI 434
1968 Kenya Children, 4/169 (2.4); adults, 30/267 (11.2); all, 34/436 (7.8) HI 435
1968, 1969 Morocco Not available Not available C. Hannoun, personal communication; 110
1969–1971, 1972 Nigeria Children, 149/285 (52.3); adults, 330/463 (71.7); all, 479/748 (64.0)c NT 436
1970 Nigeria 18/147 (12.2) HI 430
1971, 1972 Angola 69/4,590 (1.5) HI 437
1971 to 1975 Nigeria 59/189 (31.2) HI 125
121/300 (40.3) NT
1972 Sierra Leone 62/899 (6.9) HI 438
1972 and 1975 Senegal 1,432/2,457 (58.3) HI 279
1975 Gabon 1,141h/1,276d HI 129
1979 Central African Republic Nonpygmy population, 93/353 (26.3); pygmy population, 17/62 (27.4) HI 439
1975 Nigeria 4/20 paired sera (20)i HI 440
1977, 1978 Indonesia 7/219 (3.2)j; 8/219 (3.7)k; 2/219 (0.9)l; total, 17/219 (7.8) HI 119
1979, 1980 Gabon 29/197 (14.7) HI 280
1979 Central African Republic 271/459 (59) HA 441
1980 Nigeria 150/267 (56.2) HI 442
1983 Pakistan 1/43(2.3) CF 121
1983 Indonesia 9/71 (12.7) HI 443
1984 Uganda 8/132 (6.1) HI 444
1988 Senegal 46/456 (10.1) IgM ELISA 5
1990 Senegal 11/396 (2.8) IgM ELISA 5
1996, 1997 Borneo 49/11 (44.1) NT 277
1999 Ivory Coast 13/24 (54.2),m 7/18 (38.9)n IgG ELISA 6
2007 Yap State (Federated States of Micronesia) 414/557 (74.3) IgM ELISA 16
2010 Cameroon 12/102 (11.7)o HI and CF 445
2011–2013 French Polynesia 5/593 (0.8)p IgG ELISA 123
2014 French Polynesia Inhabitants 7–86 yr old, 99/196 (50); children 6–16 yr old, 314/476 (66)q IgG ELISA 142
2014 Zambia 217/3,625 (6) IgG + IgM ELISA 446
a

MPT, mouse protection test.

b

HA, hemagglutination assay.

c

Study of DENV-2-immune serum samples.

d

Details are not available for ZIKV, but ZIKV antibodies were detected in the 21 areas where samples were collected.

e

Positive sera in 18/38 localities.

f

Reactive only for ZIKV; number broadly reactive not reported.

g

Monoreactive for ZIKV.

h

Group B arboviruses, including ZIKV.

i

Two of these seroconverted.

j

ZIKV antibodies.

k

ZIKV and DENV-2 antibodies.

l

ZIKV and two or more other antibodies.

m

Mosquito catchers.

n

Suspected cases of yellow fever.

o

Monoreactive for ZIKV.

p

Blood donors.

q

All serum samples collected after ZIKV outbreak.

r

Thirty-eight scattered localities.

FIG 1.

FIG 1

African countries in which ZIKV circulation has been reported up to January 2016. Abbreviations: MR, Morocco; CV, Cape Verde; SE, Senegal; GB, Gabon; SL, Sierra Leone; L, Liberia; IC, Ivory Coast; BF, Burkina Faso; ML, Mali; N, Nigeria; NG, Niger; TO, Togo; B, Benin; C, Cameroon; CAR, Central African Republic; G, Gabon; A, Angola; Z, Zaire; MZ, Mozambique; T, Tanzania; U, Uganda; K, Kenya; SO, Somalia; ET, Ethiopia; EG, Egypt.

FIG 4.

FIG 4

Pacific countries in which ZIKV circulation has been reported up to January 2016. Abbreviations: WP, West Papua; PNG, Papua New Guinea.

FIG 2.

FIG 2

Asian countries in which ZIKV circulation has been reported up to January 2016. Abbreviations: PA, Pakistan; I, India; T, Thailand; C, Cambodia; V, Vietnam; MA, Maldives; ME, Malaysia; PH, Philippines; IN, Indonesia.

FIG 3.

FIG 3

American countries in which ZIKV circulation has been reported up to January 2016. Abbreviations: ME, Mexico; DR, Domincan Republic; VI, Virgin Islands; SM, Saint Martin; GUAD, Guadeloupe; MA, Martinique; BA, Barbados; HA, Haiti; PR, Puerto Rico; HO, Honduras; GUAT, Guatemala; N, Nicaragua; ES, El Salvador; EC, Costa Rica; PN, Panama; V, Venezuela; GUY, Guyana; S, Suriname; FG, French Guiana; C, Colombia; BR, Brazil; BO, Bolivia; PAR, Paraguay.

Emergence of ZIKV in the Pacific

2007: Yap State.

Yap State is one of four states in the Federated States of Micronesia, located in the Western Pacific. The population of Yap State is about 7,500 (2000 census data). In April and May 2007, local physicians reported an outbreak of “dengue-like illness.” An outbreak of dengue fever was suspected, as this virus had previously occurred in Yap State in 1995 (132) and 2004 (133). Three patients tested positive for DENV with rapid commercial DENV immunoglobulin M (IgM) kits (134), but the physicians had the impression that the illness was different from dengue fever because, in addition to rash and arthralgia, which are common in dengue, some patients also reported only subjective fever and conjunctivitis (Secretariat of the Pacific Community, http://www.spc.int/phs/english/publications/informaction/IA27/Zika-outbreak-Yap-2.pdf). Acute-phase serum samples collected from 71 patients were sent to the Centers for Disease Control and Prevention (CDC) Arbovirus Diagnosis and Reference Laboratory in Fort Collins, CO, USA. ZIKV RNA was detected in 10 samples (14.1%). Laboratory investigations included ELISA for IgM antibodies to ZIKV, determination of neutralizing antibody titers, and RNA detection by a specific ZIKV reverse transcription (RT)-PCR assay of acute-phase samples (16, 135).

One hundred eighty-five cases of suspected Zika fever (symptoms of Zika fever without laboratory confirmation) were investigated; 49 (26.5%) were confirmed (suspected cases with laboratory confirmation), 59 (31.9%) were probable (suspected cases with equivocal laboratory results), and 72 (38.9%) remained suspected Zika fever. ZIKV RNA was detected in 15 (33.3%) of the 45 serum samples collected from patients before day 10 after the onset of illness. A serosurvey of 173 selected households was conducted; 414/557 (74.3%) persons had IgM antibodies to ZIKV, and 156 (37.7%) of them were symptomatic. However, 18.9% of the patients with no detectable IgM antibodies to ZIKV also reported symptoms compatible with Zika fever. ZIKV was not isolated from any of the patients.

An estimated 5,005 (72.6%) of the 6,892 residents over 3 years old were infected with ZIKV, and an estimated 919 or 18.4% (95% confidence interval [CI], 480 to 1,357) of the infected patients had a clinical illness that was probably attributable to ZIKV infection. The relative risk of males versus females was 1.1 (95% CI, 1.0 to 1.2). The clinical attack rate of Zika fever was higher among females and older persons, but the prevalence of specific IgM antibodies was higher in males (relative risk, 1.1) and did not vary significantly across age groups. No behavioral or environmental risks factors were associated with ZIKV infection. The duration of the outbreak was about 3 months. The origin of the ZIKV that caused the Yap State epidemic remains unknown, but introduction by a viremic person from the Philippines was suspected because of evidence of ZIKV infections in humans in that country and frequent travel exchange between Yap State and the Philippines. It is speculated that a new strain of ZIKV with greater fitness and epidemic potential emerged to cause this epidemic in the same manner that epidemic strains of DENV have emerged in recent decades (88, 91). This was the first detection of ZIKV outside Asia and Africa and the first large ZIKV outbreak ever reported. Before this outbreak, only 14 human infections had been reported (3). This outbreak underscored the potential of ZIKV as a newly emerging arbovirus.

2013: French Polynesia.

French Polynesia is a French overseas territory in the South Pacific. The population is about 270,000 (2012 census) living on 67 islands distributed among five archipelagoes. French Polynesia is tropical, with a dry season (May to October) and a rainy season (November to April). Until 2013, DENV was the only arbovirus detected in French Polynesia, causing multiple outbreaks since the 1960s (39, 136–138). However, a retrospective serosurvey of serum samples collected from 2011 to 2013 supported the existence of silent autochthonous circulation of Ross River virus (RRV) (139).

In October 2013, patients from the same family presented with a “dengue-like illness” with low fever (<38°C), asthenia, wrist and finger arthralgia, headache, and rash; two of them had conjunctivitis, and one had swollen ankles and aphthous ulcers. The patients tested negative for DENV, CHIKV, and WNV by specific RT-PCR. Because of past circulation of ZIKV in the Pacific, they were also tested for ZIKV, but the RT-PCR results were equivocal. Two weeks later (week 43), another patient reporting similar symptoms tested positive by a specific ZIKV RT-PCR (135); results were confirmed by RNA sequencing of the prM/E protein coding region (17). Concomitantly, the French Polynesia Ministry of Health reported an increase in patients visiting primary care physicians with dengue-like syndrome and rash. By week 51, an estimated 19,000 suspected cases were recorded; 294/584 were positive by a specific ZIKV RT-PCR test (17). The Institute Louis Malardé (Health and Research Institute of Tahiti, French Polynesia) tested 855 patients presenting symptoms of Zika fever (1,067 samples) for ZIKV RNA; 392 were positive (140). The duration of the outbreak was about 21 weeks, peaking on week 9 of 2014 with an estimate of 3,500 consultations for Zika fever (Direction de la Santé de la Polynésie Française, http://www.hygiene-publique.gov.pf/) (Fig. 5). All of the archipelagoes of French Polynesia were affected. At the end of the outbreak, the estimated number of cases of Zika fever was 30,000 (11.5% of the population) (18, 19, 141). The magnitude of the outbreak was likely due to the low level of preexisting immunity to ZIKV in the population and the high densities of competent mosquito vectors (123). However, the total number of infections remains unknown because most patients with mild Zika fever did not seek medical care and there were probably many asymptomatic patients. Severe neurological complications and non-vector-borne transmission were described in a small percentage of the cases. A serosurvey of all age groups conducted after the outbreak suggested an infection rate of 50 to 66% (142). The origin of the ZIKV in French Polynesia is unknown, although it was closely related to the strains isolated in Yap State in 2007 and in Cambodia in 2010 (17). During and after the French Polynesia outbreak, ZIKV spread rapidly to other Pacific islands (18) (Fig. 4).

FIG 5.

FIG 5

French Polynesian and New Caledonian outbreak profiles.

2014: New Caledonia, Cook Islands, and Easter Island.

New Caledonia, another French overseas territory in the South Pacific, only had DENV and CHIKV arbovirus transmission prior to the introduction of ZIKV. Three cases of Zika fever were reported in New Caledonia in patients returning from French Polynesia at the end of November 2013 (143, 144). By the middle of January 2014, 26 imported cases from French Polynesia had been confirmed and the first autochthonous transmission was documented (20, 144). A ZIKV outbreak was declared in February, and by the end of August, about 1,400 confirmed cases had been reported, including 35 imported cases (32 from French Polynesia, 2 from Vanuatu, and 1 from the Cook Islands) (141, 144, 145). ZIKV was still circulating in this country in 2015, with 137 confirmed cases reported through August (Direction des Affaires Sanitaire et Sociales de Nouvelle-Calédonie, http://www.dass.gouv.nc/portal/page/portal/dass/) (24). The duration of the outbreak was 29 weeks, with a peak at week 14. The clinical presentation of ZIKV in New Caledonia was similar to that observed in French Polynesia. Interestingly, two coinfections (DENV and ZIKV) were reported during the New Caledonia outbreak, and both patients recovered after a mild clinical course (144). A comparison of the French Polynesian (Direction de la Santé de la Polynésie Française, http://www.hygiene-publique.gov.pf/) and New Caledonian (Direction des Affaires Sanitaire et Sociales de Nouvelle-Calédonie, http://www.dass.gouv.nc/portal/page/portal/dass/) epidemic profiles is shown in Fig. 5. The number of confirmed cases of ZIKV infection in New Caledonia was 1,400 or about 0.8% of the population, compared to 11.5% of the population of French Polynesia. Several mechanisms can explain the difference in the epidemiological profiles: different populations (mainly Polynesian, European, and Chinese in French Polynesia and Melanesian and European in New Caledonia), different mosquitoes (Ae. aegypti and Aedes polynesiensis in French Polynesia and Ae. aegypti in New Caledonia), and different climates (lack of a cold season in French Polynesia, cold season in New Caledonia), different vector control strategies, and a change in the virus epidemic potential. The same difference was observed in the chikungunya outbreaks that occurred in New Caledonia in 2011 (33 autochthonous cases), 2013 (30 autochthonous cases), and 2014 (2 autochthonous and 27 imported cases) (25) and in French Polynesia in 2014 and 2015 (66,000 cases or about 25% of the population) (25). The outbreak profiles were related to neither population size (about 270,000 inhabitants for both countries) nor background immunity (both were naive to ZIKV). However, the possibility of microgenetic changes causing phenotypic changes, such as those that occur with dengue (88, 91), cannot be excluded, and microevolution of ZIKV during outbreaks has been reported (146).

A ZIKV outbreak was declared in March 2014 in the Cook Islands after laboratory confirmation of 18 cases by the Institute Louis Malardé, French Polynesia (Institut National de Veille Sanitaire Français, http://www.invs.sante.fr/Publications-et-outils/Bulletin-hebdomadaire-international). It was a small outbreak, with only 905 cases reported, 49 of which were confirmed as ZIKV infections (21, 147). The first case was that of a traveler returning from French Polynesia (147). In the Cook Islands, DENV is endemic (148).

The Chilean Ministry of Health confirmed the first autochthonous case of ZIKV infection on Easter Island on 28 January 2014 (National Travel Health Network and Centre, http://nathnac.net/). By early March, 40 suspected cases were reported (Institut National de Veille Sanitaire Français, http://www.invs.sante.fr/Publications-et-outils/Bulletin-hebdomadaire-international) (22, 147). Fifty cases were ultimately confirmed by the Public Health Institute of Chile (149). It was suggested that ZIKV was introduced to Easter Island during the annual Tapati Festival, which attracted people from other Pacific islands, especially French Polynesia, where a ZIKV outbreak was ongoing (22, 150). Dengue epidemics occurred on Easter Island in 2000 and 2002 (151, 152).

2015: Vanuatu, Solomon Islands, Samoa, and Fiji.

Very few data are available from Vanuatu (23, 24). An unspecified number of confirmed cases of ZIKV infection were reported by health officials and by the European Centre for Disease Prevention and Control (ECDC) in the weeks after tropical cyclone Pam passed through Vanuatu in March 2015 (24) (Auckland Regional Public Health Services, http://www.arphs.govt.nz/health-information/communicable-disease/dengue-fever-zika-chikungunya#.VeqEFv8Vipo). Circulation of ZIKV in Vanuatu was supported by the export of three cases from there, one to New Zealand (153) and two to New Caledonia (144). Zika fever was confirmed in the Solomon Islands in March, with 310 cases reported to date (Auckland Regional Public Health Services, http://www.arphs.govt.nz/health-information/communicable-disease/dengue-fever-zika-chikungunya#.VeqEFv8Vipo; Solomon Islands Broadcasting Corporation, http://www.sibconline.com.sb/health-authorities-declare-outbreak-of-new-virus-in-solomons/) (24). In Samoa (25) and Fiji (26), ZIKV circulation has been reported but the number of cases is not available. DENV is endemic to all of these countries (154).

Because the clinical symptoms of Zika fever overlap those of DENV and CHIKV infections, it is likely that ongoing and undetected ZIKV transmission in the Pacific islands will continue (18, 155).

Emergence of ZIKV in the Americas

ZIKV is a new threat to the Americas (156–168).

Clusters of “exanthematic diseases” have been reported retrospectively in Brazil since late 2014 (169), and since February 2015, an outbreak of “exanthematic disease” has affected thousands of patients in northeastern Brazil, mainly in Bahía, Maranhão, Pernambuco, Rio Grande do Norte, Sergipe, and Paraíba (24, 27, 28, 170). In March, serum samples obtained from patients with a presumptive diagnosis of acute viral illness at Santa Helena Hospital in Camaraçi, Bahía, Brazil, were analyzed at the Federal University of Bahía (27) and at the Molecular Virology Laboratory of the Carlos Chagas Institute, Oswaldo Cruz Institute, State of Panará, Brazil (28). Alerts were issued by the Brazilian Ministry of Health and the Pan American Health Organization (PAHO) (171), and on 15 May, the first autochthonous Zika fever was confirmed in a patient from Bahía (172). As of early December 2015, 18 states in Brazil have confirmed autochthonous virus transmission in the northern, northeastern, southeastern, central western, and southern regions (37): Alagoas (173–175), Bahía (27, 172, 176), Ceará (177), Maranhão (24), Mato Grosso (175, 178), Pará (173), Paraíba (179), Paraná (180, 181), Pernambuco (179), Piauí (182), Rio Grande do Norte (28), Rio de Janeiro (183), Roraima (184), São Paulo (185), Espírito Santo (37), Amazonas (37), Rondônia (37), and Tocantins (37). However, ZIKV was probably already circulating in other states but had not yet been detected. In late December 2015, the estimated number of suspected cases of ZIKV infection ranged from 440,000 to 1,300,000 (32).

Many arboviruses are endemic to Brazil. The four DENV serotypes circulate and affect all Brazilian regions (186, 187). Over 1 million cases of dengue were reported annually between 2009 and 2012, and 2.3 million cases were reported in 2013 (PAHO, http://www.paho.org/hq/index.php?option=com_topics). YFV, Saint Louis encephalitis virus, Mayaro virus, and Oropouche virus also circulate in some parts of Brazil (188). CHIKV strains belonging to the Asian (189) and East, Central, and South African (190) lineages have circulated in Brazil since September 2014.

The potential for ZIKV emergence in Brazil was great because Ae. aegypti and Ae. albopictus have a widespread distribution (164): Ae. aegypti is dispersed in Brazil, especially in the northern, northeastern, and central eastern regions (191, 192), but populations of Ae. albopictus are larger in subtropical areas, especially in southern Brazil (193). It was first suggested that ZIKV was introduced to Brazil during the World Cup soccer competition in 2014 (28, 172, 194), but teams from Pacific countries with ongoing circulation of ZIKV did not participate in that competition. In 2014, however, Brazil also hosted the World Spring Canoe championship in Rio de Janeiro with the participation of four Pacific Countries in which ZIKV was circulating (French Polynesia, New Caledonia, the Cook Islands, and Easter Island). Phylogenetic studies suggest that ZIKV may have been introduced to Brazil during that sporting event (150). Brazil will host the summer Olympic and Paralympic games in Rio de Janeiro in August 2016. With about 500,000 people expected to visit Brazil for that competition, there will be an increased risk of ZIKV spread around the world by those travelers.

In October 2015, ZIKV infections were confirmed in Colombia in the state of Bolivar (179, 195, 196) and subsequently spread to other states (30, 197–204), with an estimate of about 14,000 cases as of early January 2016 (31). In late 2015, autochthonous ZIKV circulation was reported in 12 other countries and territories of the Americas and the Caribbean: Suriname (29, 33), Venezuela (26), Guatemala (205), Honduras (206), Mexico (205), Paraguay (207), Panama (206, 208) French Guiana (206), El Salvador (37, 209), Haiti (210), Puerto Rico (210), and the French Caribbean (Martinique) (206). By January 2016, ZIKV was also detected in Bolivia (211), Nicaragua (209), Guyana, and Ecuador (209) in South America and in Barbados, the Dominican Republic, Guadeloupe, and the U.S. Virgins Islands in the Caribbean (209). ZIKV is probably already circulating in other American countries but has not been detected because of misdiagnosis as other arboviruses and a lack of laboratory facilities. This report covers the geographic spread of ZIKV only through late January 2016, but the spread is still ongoing.

Reemergence of ZIKV in Africa

Until 2015, only sporadic ZIKV infections were reported in Africa. In November 2015; however, the epidemic strain of ZIKV returned to the geographic origin of its discovery (Africa) when the Ministry of Health of Cape Verde reported a ZIKV outbreak. Seventeen of the 64 serum samples sent to the Pasteur Institute of Dakar, Senegal, tested positive for ZIKV and negative for CHIKV and DENV (33). About 5,000 suspected cases were reported from September to December 2015 (WHO, http://www.who.int/csr/don/21-december-2015-zika-cape-verde/en/#). Cape Verde is close to Senegal, where ZIKV is endemic (7), but it is likely that the Cape Verde outbreak is related to the tourist industry on that island, especially because many Brazilians regularly travel to Cape Verde for vacations. Of note is that the island is infested with Ae. aegypti and that a DENV outbreak occurred there in 2009, with more than 17,000 cases reported (212).

Imported Cases of Zika Fever and Risk of Dissemination in Areas with Competent Aedes Mosquitoes

Imported cases of Zika fever have been reported in travelers returning from areas with endemic/epidemic Zika fever (Fig. 1 to 4). These importations increase the risk of dissemination of ZIKV to areas where potential competent vectors are present, especially Ae. aegypti and Ae. albopictus.

Europe.

The first imported case of Zika fever in Europe was reported in a German traveler infected in Thailand in November 2013 (213). Other German cases were reportedly imported from Malaysian Borneo in September 2014 (214) and from Haiti in December 2015 (210). Ae. albopictus has a limited distribution in Germany (215), and Ae. aegypti is not present (ECDC, http://www.ecdc.europa.eu/en/healthtopics/vectors/).

Three ZIKV infections imported from French Polynesia have been reported in France, the first in November 2013 (216); data are not available for the other two cases (217). Ae. albopictus was first detected in France in 2004 (101); it is now well established in the southern part of the country, where it was responsible for local transmission of dengue (102, 218) and chikungunya (219). Ae. aegypti is not present in continental France (ECDC, http://www.ecdc.europa.eu/en/healthtopics/vectors/). As ZIKV is now endemic to the French Caribbean islands of Martinique, Guadeloupe, and Saint Martin and to French Guiana in South America, introductions are occurring (220) in continental France, with a risk of autochthonous transmission if introductions occur during the hot season (when Ae. albopictus circulates in France). However, large outbreaks are not expected.

Three imported ZIKV infections have been reported in Italy, two from French Polynesia in January 2014 (221) and one from Brazil (Bahía) in March 2015 (222). The potential for arbovirus outbreaks in Italy was demonstrated by the CHIKV outbreak in the province of Ravenna (region of Emilia Romagna) in 2007 (223–225). That region has also experienced WNV outbreaks (226, 227). Ae. albopictus was first detected in Italy in 1990 (228), and Italy is now the European country most heavily infested with this species (229).

ZIKV infection was reported in a Norwegian traveler infected during a 14-day trip to French Polynesia in December 2013 (230) and in Netherlands travelers returning from Suriname in 2015 (31), but both countries are free of Ae. aegypti and Ae. albopictus (230).

Other imported cases of ZIKV have been reported in Denmark, Finland, Austria, Switzerland, Israel, Spain, Ireland, Sweden, England, and Portugal (209, 220). The highest risk of local transmission is in Spain, which is infested with Ae. albopictus (231).

European overseas tropical and subtropical countries and territories infested with Ae. albopictus, Ae. aegypti, and/or other species of Aedes mosquitoes in the Mediterranean, the Atlantic Ocean, the Caribbean, South America, and the Indian Ocean are at high risk of ZIKV infection because DENV and/or CHIKV are already endemic to most of these areas (24).

Americas.

In 2007, a medical volunteer visited Yap State during the outbreak and developed symptoms of ZIKV infection and antibodies to ZIKV were detected after that person returned to the United States (16). Two American scientists developed Zika fever in Colorado a few days after being infected while performing a mosquito-sampling project in southeastern Senegal in August 2008 (232), a case imported from French Polynesia has been reported in Texas (233), and another has been reported in New York City (234); other imported cases have been reported in Arkansas, Florida, Hawaii, Illinois, New York, Texas, and Virginia (209, 235). The risk of secondary transmission is highest in states such as Texas and Florida, where both Ae. albopictus and Ae. aegypti are present (236), and autochthonous cases of dengue fever and/or chikungunya have occurred (CDC, http://www.cdc.gov/chikungunya/geo/united-states-2014.html) (237–239).

To our knowledge, Hawaii reported neither imported nor autochthonous ZIKV infections during the French Polynesian outbreak, despite probable ZIKV introduction because of weekly flights between Tahiti (French Polynesia) and Hawaii, where Ae. albopictus is present and caused a small outbreak of DENV in 2001 (240).

ZIKV infection was reported in a Canadian traveler returning from Thailand in February 2013 (241, 242). Ae. albopictus has been rarely detected on the West Coast of Canada (215, 243).

Chile reported no cases of ZIKV imported from Easter Island during the outbreak there in 2015, but one case was imported from Colombia in December 2015 (211).

Asia.

Zika fever was reported in a Japanese traveler returning from Thailand in August 2014 (244, 245), although the diagnosis was based on serology only, suggesting a possible cross-reaction with DENV (246). Two other cases, both confirmed by RT-PCR, were reported after travel to French Polynesia in December 2013 and January 2014 (247). Japan experienced dengue outbreaks during World War II, but any introduction now will likely remain focal (248), as was the recent outbreak of dengue in Tokyo that was caused by Ae. albopictus (249). ZIKV is endemic to many countries in Asia, and they are at risk of ZIKV outbreaks.

Pacific.

Forty-five ZIKV infections were reported in 2014 in New Zealand (250, 251), 43 of which involved a history of travel to the Cook Islands, where a ZIKV outbreak was ongoing; one case was imported from Vanuatu (153). Autochthonous arbovirus infections have never been reported in humans in New Zealand (153). Ae. albopictus and Ae. aegypti are not endemic to that country (Ministry of Heath, Wellington, New Zealand, http://www.moh.govt.nz/notebook/nbbooks.nsf/0/E3EB410791DF9F974C2565D7000E22AE/$file/mosq2.pdf), although imported Ae. albopictus has been detected in the Port of Auckland (252). It has been suggested that Aedes notoscriptus, which is a competent vector of CHIKV (253) and a vector of RRV (Alphavirus) in Australia (254), could be a potential vector of ZIKV in New Zealand (255). This mosquito is present in Province Wellington (256). Ae. notoscriptus is also a competent experimental vector of DENV and Japanese encephalitis virus (JEV) (153).

In 2007, two cases of Zika fever imported from Yap State were reported in Guam (Western Pacific); those cases were not confirmed (257). The last reported DENV outbreak in Guam occurred in 1944, before Ae. aegypti was eliminated. In April 1995, an entomological survey found no Ae. aegypti mosquitoes on the island, but Ae. albopictus mosquitoes were abundant (258).

ZIKV infections have been reported in Australia in travelers returning from Jakarta and Bali (Indonesia) in 2013 and 2015 (259, 260), respectively, and the Cook Islands in 2014 (261) and 2015 (262). The Bali patient developed confirmed Zika fever 7 days after a monkey bite, but the mode of contamination was not confirmed because he had been exposed to mosquitoes. A total of 12 imported cases were reported as of June 2014 (153). The risk of ZIKV emergence in Australia depends on the region. Seven of the 12 imported cases were recorded in Queensland, where Ae. aegypti is found (Queensland and Torres Strait) and regular DENV outbreaks are reported (263). There is concern that Ae. albopictus, which is already present in the Torres Strait (264), may become established in Australia's mainland (153).

The Disease Burden of ZIKV Infections

A number of factors can contribute to underestimation of the disease burden of Zika fever. Virologic confirmation by isolation of ZIKV or its RNA from humans, vectors, or hosts is limited to countries with access to cell culture and/or molecular technologies. Many of the countries at risk for ZIKV infection lack adequate laboratory facilities to perform ZIKV detection. When laboratory tools are not locally available, samples should be sent to a reference laboratory but shipment of frozen samples in dry ice from remote areas is often difficult. Even if molecular tools are available, ZIKV is not on the list of arboviruses routinely tested for. ZIKV generally causes mild disease or asymptomatic infections, and patients may not seek medical care. In addition, the disease occurs in countries where people have no or poor access to medical facilities or in which medical facilities are lacking. Only recently, seven cases of acute ZIKV infection in residents of different provinces of Thailand were confirmed by molecular testing or serology, suggesting that ZIKV is widespread throughout Thailand (265). Before that report, only imported cases in travelers returning from Thailand were reported (213, 241, 244). In June 2015, a case of Zika fever imported from the Maldives was reported in Finland, suggesting that ZIKV has circulated silently in that tourist country (266).

The incidence of Zika fever can also be overestimated. False-positive molecular test and serology results can occur. Cross-reactions with other flaviviruses can overestimate the prevalence of ZIKV infections in areas where flaviviruses are endemic.

Globally, however, the real incidence, prevalence, and geographic distribution of ZIKV are likely underestimated (267). In the Pacific, some countries report cases of “acute fever and rash” (250) but these infections are not investigated and the pathogens are not identified. In Brazil, health authorities initially reported an outbreak of 6,000 cases of “exanthematic disease,” but ZIKV was detected in only a few patients, so the number of actual infections is unknown. In June 2015, the government reported 40,000 cases of infection with 24,000 suspected cases of Zika fever but in the absence of routine laboratory testing, the true number of infections is unknown (176). Like dengue in both the Pacific and the Americas, it is thought that ZIKV circulates silently in some areas without being detected (267). The situation is certainly the same in countries in Asia and Africa.

CLASSIFICATION AND PHYLOGENY OF ZIKV

ZIKV is placed in the clade X mosquito-borne Flavivirus cluster, along with SPOV (47). These results, based on partial sequencing of the gene for nonstructural protein 5 (NS5), were confirmed by sequencing the complete coding region of the NS5-encoding gene (135). The full genome of ZIKV (the ZIKV MR 766 prototype strain) was entirely sequenced for the first time in 2007 (268). The full sequences of other ZIKV strains from Brazil, Cambodia, the Central African Republic, French Polynesia, Guatemala, Malaysia, Nigeria, Puerto Rico, Senegal, Thailand, and Yap State are available in GenBank (http://www.ncbi.nlm.nih.gov/GenBank/) (12, 135, 146, 269).

The genome structures of the ZIKV MR 766 prototype strain and the French Polynesian H/PF/2013 strain are detailed in Table 2. ZIKV, like other flaviviruses, is a single-stranded, positive-sense RNA virus with a genome of 10,794 kb (268, 270) with two flanking noncoding regions (5′ NCR and 3′ NCR). The open reading frame (ORF) encodes a polyprotein with three structural proteins, i.e., capsid (C), premembrane/membrane (PrM), and envelope (E), and seven nonstructural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 (3, 216, 268).

TABLE 2.

Genome structures of ZIKV strains

Gene or genomic region Length
African MR 766 prototype straina French Polynesia H/PF/2013b
5′ NCR 106 ntc 107 nt
Capsid 122 aad 105 aa
PrM 178 aa 187 aa
Envelope 500 aa 505 aa
NS1 342 aa 352 aa
NS2A 226 aa 217 aa
NS2B 130 aa 139 aa
NS3 617 aa 619 aa
NS4A 127 aa 127 aa
NS4B 252 aa 255 aa
NS5 902 aa 904 aa
3′ NCR 428 nt 428 nt
Complete genome 10,794 nt 10,617 nt
a

Data are from reference 268.

b

Data are from reference 216.

c

nt, nucleotides.

d

aa, amino acids.

The 2007 Yap strain, the French Polynesian H/PF/2013 epidemic strain, and three strains of ZIKV from Senegal had a glycosylation motif at position 154 of the envelope (135, 216). This glycoprotein motif has been described in several flaviviruses but not in the ZIKV MR 766 prototype strain. This glycosylation site has been associated with an increase in virulence (135, 216). It has been suggested, but not proven, that the ZIKV MR 766 prototype strain lost this glycosylation motif during extensive mouse brain passages. Evidence of passage-associated changes in potential glycosylation sites was obtained by sequencing ZIKV MR 766 prototype strains with different passage histories (271). The loss of this glycosylation motif by WNV (272) or Kunjin virus (273) after several passages has also been reported.

The first phylogenetic study of ZIKV was conducted by Lanciotti et al. after the Yap State outbreak (135). Sequencing of the complete coding region of the NS5-encoding gene revealed three different ZIKV lineages or subclades: East African (prototype Uganda strain), West African (Senegal strains), and Asian (ZIKV 2007 Yap strain). The Asian lineage diverged from a common ancestor that moved in Southeast Asia and the Pacific (135).

On the basis of the full genome sequences of the ORFs, Haddow et al. described two major ZIKV lineages, African (Nigeria, Senegal, and Uganda strains) and Asian (Malaysia 1966, Yap State 2007, and Cambodia 2010), suggesting that ZIKV was introduced into Yap State from Southeast Asia (271) and that ZIKV has circulated in Southeast Asia since at least the 1960s.

Faye et al. sequenced the E- and NS5-encoding genes of 43 ZIKV strains isolated from 1947 to 2007 in Africa, Asia, and Oceania (3). This phylogenetic study suggested that African strains were arranged into two groups, the ZIKV MR 766 prototype strain Uganda cluster and the Nigeria cluster; the ZIKV 2007 Micronesian and Malaysian strains constituted the Asian clade. Viruses isolated in Ivory Coast and Senegal were found in both of the African clusters, suggesting that strains belonging to both clusters cocirculated in West Africa. The authors suggested that ZIKV emerged in Uganda (East Africa) around 1920 and moved to West Africa. Two independent introductions from East Africa to West Africa occurred, the first one from Uganda to Ivory Coast and Senegal around 1935 to 1940 related to the MR 766 prototype strain cluster and the second one from Uganda to Nigeria and Central Africa around 1935 with subsequent dispersion to Senegal. The Ivory Coast and Burkina Faso viruses were related to the Nigerian cluster. ZIKV probably moved to Asia in the 1940s and then spread throughout the region, forming the Asian lineage (3). The results corroborated the existence of the Asian and African lineages. This was confirmed by Grard et al., who sequenced the E- and NS3-encoding genes (14).

Faye et al. suggested that ZIKV potentially experienced several recombination events in nature (3). However, recombination in members of the Flavivirus genus has not been demonstrated in nature or experimentally; recombinations were detected only by utilizing computationally demanding phylogenetic analyses. The most convincing evidence of Flavivirus recombination was described in a DENV serotype 1 (DENV-1)-infected patient in New Caledonia (274). These data should be interpreted with caution and confirmed with further studies.

The percent identity of the entire coding region of the ZIKV 2007 Yap strain with that of the prototype ZIKV MR 766 prototype strain was 88.9% (96.5% at the amino acid level) (135). According to partial sequencing of the M/E-encoding gene, the French Polynesian strain was closer to the strain isolated in Cambodia in 2010 than to the ZIKV 2007 Yap strain (17), both of which are in the Asian lineage (275). Ion torrent sequencing analyses of two isolates collected during the French Polynesian outbreak evidenced genomic microevolution during the epidemic (146).

In the Americas, ZIKV sequences were available from Brazil (27, 28, 276) Colombia (196), Puerto Rico (269), and Guatemala (269). All of them showed more than 99% nucleotide identity with the French Polynesian strains (269). These American strains can constitute a “Western Hemisphere group” within the Asian genotype (269). The NS5-encoding gene of the strain isolated on Easter Island also showed 99.8% identity at the nucleotide level with the French Polynesian strain (149).

Collectively, epidemiologic and sequence data support the hypothesis that the epidemic strains of ZIKV emerged via genetic change in the Asian lineage virus. Most likely, two such events occurred, one in Yap State and the other in French Polynesia. The latter strain had greater virulence and was introduced to Brazil in 2015 and from Brazil to other American countries. An alternate hypothesis is that the emergence of severe disease associated with ZIKV was a function of incidence. Low-frequency events such as GBS and microcephaly might only be recognized during an epidemic with large numbers of cases, such as those seen in French Polynesia (>30,000 cases) and Brazil (>1,000,000 cases). Thus, with only 14 human cases recognized prior to the Yap State epidemic, the possibility cannot be excluded that the ancestral strains of ZIKV were capable of causing severe complications that went unrecognized because the number of human cases was too small.

Interestingly, the partial sequence of the NS5-encoding gene of the strain isolated from a traveler returning from the Maldives in June 2015 was identical to those of the strains from French Polynesia, Brazil, and Easter Island (266), suggesting a probable introduction from the Pacific or Brazil. Phylogenetic data are not yet available for the strain that emerged in Cape Verde in late 2015. A phylogenetic tree based on the partial sequence of the E-encoding genes of ZIKV and other flaviviruses is shown in Fig. 6.

FIG 6.

FIG 6

Phylogenetic tree of ZIKV showing the African and Asian lineages, including the strains that recently emerged in the Pacific and Brazil.

ECOLOGY

Host/Reservoir

Nonhuman primates.

ZIKV antibodies have been detected in different monkey species in Africa and Asia (Table 3). Wolfe et al. (277) and Kilbourn et al. (278) tested human and monkey serum samples; as ZIKV seroprevalence was higher in humans (44.1%) than in orangutans (8.5%), they concluded that orangutans may have been infected with ZIKV from a human reservoir or from recently established sylvatic cycles (277, 278) and that nonhuman primates may be reservoir hosts of ZIKV in Asia. Epizootics of ZIKV in monkeys were reported in Uganda in the Entebbe Peninsula in 1947, 1948, 1956, 1962, 1963, 1969, and 1970 (13, 126). Another epizootic of ZIKV was reported in the Kedougou region of Senegal in 1973, with Aedes luteocephalus and Aedes furcifer-taylori as the main vectors (279). However, animal serosurvey results must be interpreted with caution because of cross-reactivity (126); animal and human studies were often conducted at the same time with the same methods and reagents (280).

TABLE 3.

Animal studies on antibody detection and isolation of ZIKV

Yr Country Animal species No. (%) of cases Diagnosis Reference(s)
1947 Uganda Rhesus monkeys (Macaca mulatta) 1d MIa 1
1947, 1948 Uganda Grivets (Cercopithecus aethiops) 1/13 (7.7) NT 117
Rhesus monkeys 2/15 (13.3)
Redtail monkeys (Cercopithecus ascanius) 0/2
    All 3/30 (10)
1961, 1962 Central African Republic Grivets 1/25 (4) HAc 122
1962–1964 Ethiopia Abyssinian colobus (Colobus guereza) 20/37 (54.1) HI 281
Baboons (Papio cynocephalus) 3/7 (42.9)
Bats 2/140 (1.4)
1967, 1968 Uganda Monkeys 139/204(68.1) HI 447
1967, 1968 Senegal Wild mammals 1/100 (2.4) HI 110
1969 Ugandab Redtail monkeys 27/73 (37) HI 13
Mangabeys (Cercocebus) 2/4 (50)
Mona monkeys (Cercopithecus mona) 0/1 (0)
Colobus monkeys 5/11 (45.5)
Other monkeys 7/16 (43.7)
    All 41/105 (39)
1969 Nigeria Monkeys 20/24 (83.3) HI 448
1969–1972 Nigeria Monkeys immune to DENV-2 62/92 (67.4) NT 436
1972 Uganda Vervets 2/3 (66.7) HI 126
Redtail monkeys 7/18 (38.9)
    All 9/21 (42.9)
1979, 1980 Gabon Monkeys 9/34 (26.5) HI 280
1983 Pakistan Rodents 6/157(3.8) CF 121
Domestic animals 2/172 (1.2)
1996, 1997 Borneo Orangutans (Pongo) 1/31 (3.22) NT 277, 278
    Semicaptive 5/40(12.5)
    Free ranging 6/71(8.5)
    All 12/142 (8.5)
a

MI, mouse inoculation.

b

Kisubi and Bwamba.

c

HA, hemagglutination assay.

d

ZIKV MR prototype strain.

Other species.

Serosurvey studies detected antibodies to ZIKV in bats (281), goats (121), rodents (Tatera indica, Meriones hurrianae, and Bandicota bengalensis) (121), and sheep (121). These data may indicate cross-reactivity with other flaviviruses but suggest that there is no clear association between ZIKV and a particular animal species. However, ZIKV has never been isolated from nonprimates, so it is not clear whether other species can act as reservoir hosts (282).

In Africa, ZIKV is probably maintained in a sylvatic cycle involving nonhuman primates and mosquitoes, with cyclic epizootics in monkeys. In areas without nonhuman primates, such as Yap State and French Polynesia (271), ZIKV is probably maintained in a human-mosquito-human cycle, suggesting that the virus has adapted to humans as a reservoir host. Since animal studies have not been conducted in these islands, however, the occurrence of another reservoir host cannot be excluded. Animal ZIKV serosurey results are presented in Table 3.

Vectors and Vector-Borne Transmission

ZIKV was first isolated from Ae. africanus in 1948 (1). Subsequent isolates of ZIKV from this species included 2 strains from the Lunyo Forest (9) and 12 strains from the Zika Forest of Uganda (10). Other arboviruses (Ntaya virus, YFV, Rift Valley fever virus, and CHIKV) have also been isolated from Ae. africanus (11). This mosquito prefers monkeys to humans (283) but also feeds on rodent, avian, and reptilian species (10).

The first isolate of ZIKV in Asia was obtained from Ae. aegypti in Malaysia in 1966; it was the first isolate of ZIKV from a mosquito other than Ae. africanus (4). ZIKV was isolated from a male Aedes furcifer mosquito (7), suggesting possible vertical transmission, which could be an important mechanism of ZIKV maintenance in nature. The seasonal distribution of the ZIKV infection rate in mosquitoes in Senegal showed two peaks of amplification, in June and between September and December; 31 strains of ZIKV were isolated from mosquitoes (7). ZIKV mosquito isolates are presented in Table 4.

TABLE 4.

Mosquito ZIKV isolates

Yr Country Species (no. of strains) Reference
1948 Uganda Ae. africanus (1)a 1
1956 Uganda Ae. africanus (2) 9
1969, 1970 Uganda Ae. africanus (14), Ae. apicoargenteus (1) 13
1962, 1963 Uganda Ae. africanusb 127
1964 Uganda Ae. africanus (12) 10
1968 Senegal Ae. luteocephalus (1) 7
1969 Senegal Ae. luteocephalus, Ae. furcifer-taylori, Ae. gambiae 7
1969 Nigeria Ae. luteocephalus (2) 449
1969 Malaysia Ae. aegypti (1) 4
1972–1977 Senegal Ae. furcifer-taylori (21), Ae. luteocephalus (13), Ae. dalzieli (1), Ae. vitatus (1), Mansonia uniformis (1) 15
1975 Malaysia Ae. aegypti 450
1976–1980 Central African Republic Ae. africanus (2), Ae. opok (1) 12
1988 to 1991 Senegal Ae. furcifer (25), Ae. taylori (10), Ae. luteocephalus (9), Ae. aegypti (1), Ae. neoafricanus (1), Ae. dalzieli (6), Ae. fowleri (5), Ae. minutus (1), Ae. vittatus (4) 5
1999 Ivory Cost Ae. aegypti (1), Ae. vittatus (1), Ae. furcifer (1) 6
2007 Gabon Ae. albopictus (2) 14
2011 Senegal Ae. furcifer (5), Ae. luteocephalus (5), Ae. africanus (5), Ae. vittatus (3), Ae. taylori (2), Ae. dalzieli (2), Ae. hirsutus (2), Ae. metallicus (2), Ae. aegypti (1), Ae. unileaetus (1), M. uniformis (1), Culex perfuscus (1), Ae. coustani (1) 7
2011 Southern Senegal Aedes, Mansonia (31)c 8
Not available Not available Ae. flavicollis, Ae. grahamii, Ae. jamoti, Ae. taeniarosistris, Ae. tarsalis, Eretmapodites inornatus, Eretmapodites quiquevittatus Pasteur Institute CRORA database
a

E/1 strain.

b

Several, number not reported.

c

Details not available.

The isolation of a virus from a mosquito is not evidence that it is a vector of the virus. To demonstrate that a mosquito is a vector, it must be shown to be capable of transmission (108). The first ZIKV vector competence study was conducted in 1956 with Ae. aegypti (284). Transmission of ZIKV by Ae. aegypti using a mouse skin membrane and heparin-treated blood to infect mosquitoes was successful. The ZIKV loads in the mosquitoes were measured by determining the mouse 50% lethal doses (LD50) by the method of Reed and Muench (285). ZIKV was not detectable on days 5 and 10, but by days 15 and 20, the ZIKV load had increased to 103.4 and 105.6 mouse LD50, respectively. It remained constant at approximately 105.0 mouse LD50 from day 25 to day 60, suggesting that Ae. aegypti is capable of transmitting ZIKV to a susceptible host for 10 weeks. A rhesus monkey was successfully infected by the bite of three infected Ae. aegypti mosquitoes. The extrinsic incubation period of ZIKV (the time between infection of the vector and when it becomes able to transmit the virus) was about 15 days. In a comparison of YFV and ZIKV vector competence, the extrinsic incubation period was shorter and transmission was more efficient with ZIKV (286). The authors suggested that these data could explain, in part, the lower frequency of YFV epizootics observed in eastern Senegal.

The geographic variation in the oral susceptibility of mosquitoes of the same species to different viruses is well documented (287–289). The susceptibility of an Asian strain (Singapore) of Ae. aegypti to the MR 766 prototype strain of ZIKV was investigated under conditions that mimicked the local climate (290). Mosquitoes were infected orally. ZIKV was detected in salivary glands from day 5 in 62% of the infected mosquitoes and in all of the infected mosquitoes on days 10 and 14, demonstrating that Singapore's Ae. aegypti was highly capable of transmitting ZIKV. The decrease in the midgut viral titer observed at day 14 was consistent with studies conducted with DENV and WNV. The ZIKV infection level was found to be higher in saliva than in the midgut, suggesting that viral dissemination and amplification within the salivary glands or other organs and tissues are more important than dissemination from the midgut. However, Ae. aegypti strains from Kedougou and Dakar (Senegal) were susceptible to oral infection but not competent to transmit ZIKV (291), showing that the competence of Ae. aegypti to transmit ZIKV, like DENV, depends on the mosquito strain (288). However, Ae. aegypti, with poor competence but high density, has been shown to be a vector of arbovirus outbreaks (292).

Ae. albopictus has been shown to experimentally transmit 27 arboviruses, including ZIKV (293, 294). A Singapore strain infected orally with the ZIKV MR 766 prototype strain had ZIKV in its salivary glands by day 7 and thus was potentially infectious (294). Ae. luteocephalus and Aedes vittatus were susceptible to ZIKV infection, but only a small proportion of them were able to transmit the virus (291).

An entomological study conducted in Yap State identified 12 mosquito species belonging to four genera. The predominant species were Ae. hensilii (41.2%) and Culex quinquefasciatus (28.1%); no virus was found in any field-collected mosquitoes (16, 295). Because of its abundance in Yap State and the fact that it was the likely vector of DENV there (132), Ae. hensilii was the most plausible vector of ZIKV in Yap State (16). Experimental studies were conducted with Ae. hensilii collected in Yap State with the ZIKV MR 766 prototype strain (295). Up to 86.1% of the mosquitoes receiving a high-level dose of ZIKV (5.9 log10 PFU/ml) became infected, but only 22.6% of them developed a disseminated infection. Those mosquitoes feeding on the lowest-level dose (4.9 log10 PFU/ml) of ZIKV were resistant to infection (7.1% infection). Ae. hensilii has a limited distribution in the Pacific islands, i.e., Yap, Palau, and Chuuk (Federated States of Micronesia). Ae. hensilii is not present in the other Pacific islands where ZIKV has spread since 2013.

Two potential vectors of ZIKV are present in French Polynesia: Ae. aegypti, the main vector of DENV (296, 297), and Aedes polynesiensis, the main vector of lymphatic filariasis in this country (298, 299); Ae. hensilii and Ae. albopictus are not present. During the French Polynesian outbreak, 238 female Ae. polynesiensis, 286 female C. quinquefasciatus, and 2,039 female Ae. aegypti mosquitoes were collected and tested for ZIKV infection by RT-PCR. ZIKV RNA was detected in only one Ae. aegypti mosquito pool (V. Richard, Institut Louis Malardé, Tahiti, French Polynesia, personal communication). However, experimental studies showed the French Polynesian strain of Ae. aegypti to be able to replicate the French Polynesian ZIKV strain. By day 9 postinfection, 75% of the infected mosquitoes showed viral dissemination, although salivary gland infection remained low (8%) (300).

In New Caledonia, ZIKV was probably transmitted by Ae. aegypti, which is the vector of CHIKV (301) and DENV (302); Ae. polynesiensis, Ae. albopictus, and Ae. hensilii are not present.

Experience with ZIKV in the Pacific confirmed that ZIKV can be transmitted by different vectors during outbreaks, i.e., by Ae. hensilii in Yap State, Ae. aegypti in New Caledonia, and Ae. aegypti and/or Ae. polynesiensis in French Polynesia. In Gabon, Ae. albopictus, introduced into an environment where the Ae. aegypti level was low, was the vector of ZIKV (14). Together, these data indicate that, as for the lack of a clear pattern of preference for animal species, there is a lack of clear preference of ZIKV for mosquito vector species (3). The competence of American strains of Ae. aegypti and Ae. albopictus to transmit ZIKV is unknown, but epidemiological and experimental studies have shown that both species are well adapted to transmit DENV and CHIKV (191).

Non-Vector-Borne Transmission

Laboratory contamination.

A laboratory staff member developed a febrile illness after yellow fever vaccination (17D vaccine), but ZIKV was isolated from blood taken the first day of illness. The infection was believed to be laboratory acquired (303).

Sexual transmission.

Four reports suggest the possible sexual transmission of ZIKV. In 2008, an American scientist conducting mosquito field work in Senegal became ill with common symptoms of ZIKV infection after returning to the United States. He also had prostatitis and hematospermia. His wife, who had no history of travel outside the United States since 2007, had sexual intercourse with her husband the day after he returned home. She subsequently developed a Zika fever-like illness, suggesting transmission by sexual intercourse. Both patients were confirmed as ZIKV infection by serological testing (HI, plaque reduction neutralization test [PRNT], and CF) (232). Also, in December 2013, during the French Polynesian outbreak, a 44-year-old man sought medical care for hematospermia. The patient presented no signs of urinary tract infection, prostatitis, urethritis, or cystitis, and he reported no recent close contact with persons with acute ZIKV infections. Blood and semen samples were collected; ZIKV RNA was detected by RT-PCR, and ZIKV was isolated by inoculation of semen samples onto Vero cells. A second set of samples was collected; ZIKV was detected in semen and urine but not in blood. The detection of ZIKV in semen while it was not detected in blood collected at the same time suggested viral replication in the genital tract. Also, ZIKV was recently isolated from the convalescent-phase semen of a patient, but his serum and urine were negative (480) and a case of Zika fever transmitted by sexual contact has been reported in Texas (235, 304). These results confirmed that ZIKV can be transmitted by sexual intercourse (305) and is a potentially sexually transmitted virus (306). The ECDC recommends deferral of semen donation for 28 days after returning from areas where ZIKV is endemic (31). Although the main mode of transmission of Zika fever is thought to be via mosquito bite, the low viremia observed in patients and the rapid spread within and among countries in a region like the Americas suggest other modes of transmission. The evidence of sexual transmission suggests a mode of interhuman transmission that could contribute to its rapid spread.

Maternofetal transmission.

Perinatal transmission has already been reported for other flaviviruses such as DENV (66, 67) and WNV (70, 71), as well as alphaviruses such as CHIKV (68, 69), so it should not be surprising if it occurs with ZIKV.

Two cases of perinatal transmission of ZIKV were reported during the French Polynesian outbreak (307). ZIKV RNA was detected in serum samples from both mothers and infants and in both mothers' milk. One of the infants remained asymptomatic, while the other had a maculopapular rash with thrombocytopenia. Both the mothers and the infants recovered uneventfully. Even though no infective ZIKV particles were detected in breast milk, the possibility of ZIKV transmission by breastfeeding must be considered. Given the severe neonatal complications reported after CHIKV (69) and DENV (66, 67) infections, authors recommended close monitoring of perinatal ZIKV infections even before the description of severe complications in Brazil. Maternofetal transmission was confirmed in Brazil in pregnant women who gave birth to neonates with severe malformations; ZIKV RNA was detected in amniotic fluid and blood and tissue samples from microcephalic newborns (31, 31, 37, 276, 308). The French Polynesian data suggested perinatal transmission; the Brazilian cases suggest that it can also occur transplacentally during pregnancy, causing severe malformations.

Transfusion-transmitted infections.

Arbovirus transmission by transfusion of blood products has been documented for DENV (75, 76), WNV (77, 309), and RRV (78). Given its epidemiology, the possibility of ZIKV transmission via transfusion should be considered as well (310, 311). To prevent potential ZIKV transmission by transfusion, a specific nucleic acid testing protocol was implemented during the French Polynesian ZIKV outbreak (312). From November 2013 to February 2014, 42 (2.8%) of 1,505 blood donors tested were confirmed positive for ZIKV RNA; all of them were asymptomatic at the time of blood donation. Eleven of the 42 blood donors developed a “Zika fever-like syndrome” within 3 to 10 days after blood donation (313). No transfusion-transmitted Zika fevers were documented during this outbreak, but the possibility that asymptomatic posttransfusion infection occurred cannot be ruled out. Unfortunately, blood samples collected within the first week after transfusion were not available. These results suggested that ZIKV can be transmitted by blood transfusion and that ZIKV nucleic acid testing can prevent the transmission of ZIKV by blood transfusion. In areas with vectors competent for ZIKV transmission, epidemic preparedness plans should include sustainability of the blood supply (141).

In addition to nucleic acid testing of blood donors, prevention of posttransfusion Zika fever can be performed by pathogen inactivation in blood products (314). Pathogen inactivation was of particular interest in the context of the cocirculation of several arboviruses during the ZIKV outbreak in French Polynesia and can be of great interest in the Americas (315). Arboviruses in blood products, including CHIKV, WNV, and DENV, can be inactivated by treatment with amotosalen and UVA illumination (316). The efficacy of this blood component treatment was demonstrated for ZIKV; amotosalen combined with UVA light inactivated ZIKV in fresh frozen plasma (6.57 log10 by infectivity assay and 10.25 log10 by RT-PCR assay) (317). The ECDC recommends deferral of blood donation by people returning from areas with active ZIKV circulation (for 14 days, the same as for dengue), deferral for 28 days after cessation of symptoms for blood donors with confirmed ZIKV infection, and implementation of pathogen inactivation in platelets and fresh frozen plasma in infected areas (26). They also recommend transfusion of blood products to pregnant women only after the products test negative for ZIKV. However, this requires a laboratory with the capacity to perform molecular screening of blood donors. The first case of ZIKV transmission by blood transfusion was reported in Brazil in December 2015 (206).

PATHOPHYSIOLOGY OF ZIKV INFECTIONS

Mechanisms of Infection

Data on the pathogenesis of ZIKV are scarce. Human dermal fibroblasts, epidermal keratinocytes, and immature dendritic cells were found to be permissive to ZIKV infection (318). The DC-SIGN, AXL, Tyro, and TIM-1 entry/adhesion factors permit the entry of ZIKV. ZIKV replication activates an antiviral immune response and the production of type I interferon in infected cells. The formation of autophagosomes is associated with enhanced viral replication, and the induced expression of antiviral antigen clusters (RIG-1, MDA-5, and TLR3) that are able to detect the presence of pathogen-associated molecular patterns was observed after infection of skin fibroblasts. ZIKV infection induced an autophagous program confirmed by the presence of characteristic autophagosome-like vesicles in the infected fibroblasts (318). T cells are activated during the acute phase of Zika fever (Th1, Th2, Th9, and Th17) (319).

Replicative Cycle

The replicative cycle has been poorly studied. The detection of virus-specific antigens by indirect immunofluorescence in the nuclei of infected Vero cells was reported (320). Before that study, the replication cycle of arboviruses was thought to be exclusively cytoplasmic (44).

Animal Studies

In the initial rhesus monkey experiments (1), only monkey 766 developed slight pyrexia and circulating virus was demonstrated in its serum on day 3 of fever. Rhesus monkeys inoculated subcutaneously developed no signs of pyrexia but developed antibodies within 2 to 3 weeks after infection (117).

In mice inoculated intracerebrally, the only organ that contains demonstrable quantities of virus at the onset of illness was the brain (117). Cotton rats, guinea pigs, and rabbits also inoculated intracerebrally show no signs of infection, but rabbits develop antibodies to ZIKV by 21 days postinfection. The changes described by Dick (117) in mice sacrificed on the first day of signs of infection were confined to the central nervous system. Other lesions that have been demonstrated in mice are skeletal myositis, myocarditis, and lung edema in those with marked myocarditis (9). Histopathologic examination of infected mouse brains showed neuronal degeneration, cellular infiltration of the cords, and inclusion bodies of Cowdry type A in damaged nerve cells. Neuronal degeneration was most intense in the hippocampus region (9). Other lesions in Ammon's horn were reported in mice inoculated intracerebrally (321). Neurotropism of ZIKV in mice was demonstrated after intracerebral inoculation, but it was not demonstrated that other modes of transmission can lead to central nervous system damage. The marked neurotropism of ZIKV in mice was in contrast to its lack of neurotropism in monkeys, cotton rats, guinea pigs, and rabbits (117). Experimental animal infections can be performed by the intracerebral, intraperitoneal, and subcutaneous routes; adult mice can also be infected by intranasal inoculation (117).

Cross Protection from ZIKV and Other Arboviruses

Several publications have shown that animals experimentally infected with an immunologically related arbovirus are protected to some degree against fatal infection (322–324). Vervet monkeys immunized with ZIKV had detectable viremia when challenged with YFV, but none of them died and the viremia titer was lower than in naive monkeys (325). ZIKV immunization of rhesus monkeys altered the severity of hepatic lesions due to YFV and prolonged survival, while no sparing effect was noted in other organ systems (326). Of the monkeys collected during the YFV epizootic in the Zika Forest in 1971, 40% were immune to YFV but had no antibodies to ZIKV, suggesting that the two viruses may not coexist in the same ecosystem (327). The hypothesis that ZIKV interferes with subsequent YFV viremia and immunity (325) was not supported by the intensive YFV epizootic that occurred 18 months after a ZIKV epizootic in the Zika Forest of Uganda in 1970 (13).

The prevalence of antibodies to at least one DENV serotype was 80.3% in donor blood collected from 2011 to 2013 in French Polynesia before the ZIKV outbreak, demonstrating that high DENV seroprevalence does not protect against large ZIKV epidemics such as that which occurred in Yap State (132, 133) and in French Polynesia (137, 138). Moreover, coinfections with other arboviruses were reported, i.e., DENV-ZIKV during the French Polynesian (Musso, unpublished data, 2014) and New Caledonian (144) ZIKV outbreaks and DENV-CHIKV-ZIKV in Colombia (328). These data show that DENV infection does not protect against ZIKV infection.

LABORATORY DIAGNOSIS OF ZIKA FEVER

Laboratory Safety

Depending on the country, ZIKV may be classified as a level 2 or 3 pathogen. The United Kingdom has classified ZIKV as a level 3 pathogen requiring a biosafety level 3 laboratory according to the MIS208-HSE approved list of biological agents (Health and Safety Executive, http://www.hse.gov.uk/pubns/misc208.pdf); while the CDC and the National Institutes of Health in the United States (329) and the World Health Organization (330) have classified it as a level 2 pathogen requiring only a biosafety level 2 laboratory. ZIKV is killed by potassium permanganate at 0.5%, 24 h of contact with ether, and temperatures above 60°C but is not inactivated by 10% ethanol (117).

Clinical Laboratory Testing

Several blood disorders, such as leucopenia (28, 144, 145, 217, 221, 230, 247, 259), the presence of activated lymphocytes (144, 145, 221, 259), thrombocytopenia (144, 145, 221, 222, 241, 242, 247, 307), albuminemia (2), the presence of bile pigment in urine (2), and increased transaminase levels (144, 217), have been reported, but their incidence is unknown and they are common in many viral infections. Nevertheless, a standard complete blood count is recommended for all suspected cases of Zika fever for differential diagnosis.

Virus Detection

Antigen detection.

Immunohistochemistry analysis with monoclonal antibodies (320) and PCR analysis (318) can be used to detect ZIKV antigen in autopsy tissues. Acute-phase diagnosis of dengue can be performed by the detection of NS1 in blood (331, 332), but this test is not yet available for ZIKV.

Culture.

Isolation of ZIKV from monkey serum samples and Ae. africanus mosquitoes was first performed by mouse brain inoculation (1). Subsequent isolation methods used include inoculation of chicken embryo yolk sacs, allantoic sacs, and chorioallantoic membrane, as well as cell cultures (333–335). ZIKV was titrated in parallel in suckling mice, in adult mice, and with 11 cell culture systems. Vero, rhesus monkey kidney (LLC-MK2), and pig kidney (PS-C1) cells were more sensitive than suckling and adult mice (334, 335). ZIKV was successfully cultured by intrathoracic inoculation of Toxorhynchites speldens and C6/C36 mosquito cells (336). ZIKV has been successfully cultured from human blood (17), semen (305), and urine (241). While it has not been isolated from breast milk, it has been detected by RT-PCR (307). Isolation of viruses is of particular importance to determine the phenotypic characters of the virus (337). If infectious viruses are not available, it is not possible to perform some serological tests such as cross neutralization assays or vector competence tests.

Molecular detection.

(i) Molecular detection of ZIKV RNA.

As flaviviruses are RNA viruses, their amplification requires two steps, RT of genomic RNA in single-stranded DNA (cDNA), followed by conversion to double-stranded DNA and amplification of the DNA; these two steps can be performed in the same reaction (338). Real-time PCR has revolutionized PCR amplification. It combines PCR amplification with a fluorescent probe and detection of the amplified product in the same reaction. This method is faster than a conventional PCR (339).

Two strategies can be used for molecular detection of ZIKV, i.e., detection of Flavivirus RNA, which requires additional testing in order to identify which Flavivirus has been amplified, and detection of specific ZIKV RNA. Molecular detection of Flavivirus RNA uses “consensus primers” designed in regions of the Flavivirus genome that possess a high degree of sequence conservation. RT-PCR assays with “consensus primers” allows the detection of new flaviviruses or variants of known flaviviruses, but they sometimes lack sensitivity. For example, Flavivirus RT-PCR failed to amplify ZIKV RNA from the serum of an infected patient, while ZIKV RNA was detected with primers specific for ZIKV (230). Most protocols target the terminal portion of the NS5-encoding gene or the 3′ NCR of the Flavivirus genome because of highly conserved regions in this part of the genome (340). ZIKV was successfully detected with Flavivirus RT-PCR assays targeting the E-encoding gene (341), the NS1-encoding gene (342), the NS3-encoding gene (343), and the NS5-encoding gene (47, 344–347). After detection of Flavivirus RNA, identification to the species level requires additional testing. Several methods can be used, i.e., RT-PCR with species-specific primers (but specific primer-probe sets and positive controls are required for all suspected flaviviruses); cDNA amplification, followed by restriction enzyme digestion (341); ELISA to detect amplified, digoxigenin-modified DNA (348); hybridization (345); and nucleic acid sequencing. Sequencing is now the method of choice for identification to the species level because it is available in routine practice in most molecular laboratories. In Yap State (135) and in Canadian (241) and Australian (259, 260) travelers returning from areas where ZIKV is endemic and for detection of autochthonous infections in Cambodia (349), a Flavivirus sequence was amplified by RT-PCR from the blood of patients, and ZIKV was identified by sequencing the Flavivirus sequence initially amplified. RT-PCR protocols using specific ZIKV primers and probes have been developed that target the E-encoding gene (350), the membrane-envelope junction (M/E-encoding gene), the partial envelope (pE)-encoding gene (135), and the NS5-encoding gene (8, 351). The protocol developed by Lanciotti et al. was designed to detect the ZIKV 2007 Yap strain. Even though RT-PCR is very sensitive, false-negative results compared to those of culture have been reported (8). Moreover, ZIKV RT-PCRs do not cover the genetic diversity and geographic distribution of all ZIKV strains (8). As available primers and probes have been designed on the basis of only a few full ZIKV genome sequences, new available ZIKV sequences should be rapidly deposited to ensure that the protocol can detect the circulating strain. Commercial kits for ZIKV RT-PCR are now available, but for research only; an evaluation of these tests for diagnosis has not yet been published. Primers and probes designed for ZIKV detection are presented in Table 5.

TABLE 5.

Primers and probes used for ZIKV detection by RT-PCR

RT-PCR target and primer Sequence Gene product Position Amplicon size (bp) Reference
Flavivirus
    Uni for TGGGGNAAYSRNTGYGGNYTNTTYGG E Va 341
    Uni rev CCNCCHRNNGANCCRAARTCCCA
    DJS GACATGGGGTATTGGAT NS1 V 342
    DJA TCCATCCCATACCTGCA
    DV1 GGRACKTCAGGWTCTCC NS3 V 343
    DV3 AARTGIGCYTCRTCCAT
    cFD2 GTGTCCCAGCCGGCGGTGTCATCAGC NS5 V 47
    MA CATGATGGGRAARAGRGARRAG
    FG1 TCAAGGAACTCCACACATGAGATGTACT NS5 V 344
    FG2 TGTATGCTGATGACACAGCAGGATGGGACAC
    Flav100F AAYTCIACICAIGARATGTAY NS5 V 346
    Flav200F CCIARCCACATRWACCA
    VD8 GGGTCTCCTCTAACCTCTAG NS5 V 345
    EMF1 TGGATGACACGAGAATG
    MAMD AACATGATGGGRAARAGRGARAA NS5 V 347
    cFD2 GTGTCCCAGCCGGCGGTGTCATCAGC
ZIKV
    ZIKV835 TTGGTCATGATACTGCTGATTGC M/E 835-857 76 135
    ZIKV911c CCTTCCACAAAGTCCCTATTGC 911-890
    ZIKV860FAM CGGCATACAGCATCAGGTGCATAGGAG 860-886
    ZIKV1086 CCGCTGCCCAACACAAG pE 1086-1102 76 135
    ZIKV1162c CCACTAACGTTCTTTTGCAGACAT 1162-1139
    ZIKV1107FAM AGCCTACCTTGACAAGCAGTCAGACACTCAA 1107-1137
    ZIKVENVF GCTGGDGCRGACACHGGRACT E 1538-1558 364 350
    ZIKVENVR RTCYACYGCCATYTGGRCTG 1902-1883
    ZIKVF9027a CCTTGGATTCTTGAACGAGGA NS5 9121-9141 192 351
    ZIKVR9197ca AGAGCTTCATTCTCCAGATCAA 9312-9290
    Forward AARTACACATACCARAACAAAGTGGT NS5 9271-9297 102 8
    Reverse TCCRCTCCCYCTYTGGTCTTG 9352-9373
    ProbeFAM CTYAGACCAGCTGAAR 9304-9320
a

V, variable in the different flaviviruses.

(ii) Detection of ZIKV in different body fluids.

Diagnosis of Zika fever usually relies on the detection of ZIKV RNA in blood during the first few days after symptom onset. Among the 748 serum samples collected during the French Polynesian outbreak (140), the mean time from symptom onset to a positive blood test was 3 days, but some patients tested positive until day 10 (Musso, unpublished), and during the Yap State outbreak, a patient tested positive on day 11. Patients can be viremic until day 10 before symptom onset, as reported in a study of asymptomatic blood donors (312). Blood ZIKV RNA loads ranged from 7.28 × 106 to 9.3 × 108 copies/ml in symptomatic patients (135, 230, 307) and from 2.5 × 103 to 8 × 106 (mean, 7.2 × 105) copies/ml in asymptomatic blood donors (317).

DENV (352), WNV (353), and ZIKV RNAs can be detected in urine. As reported in New Caledonia (145) and French Polynesia (305, 307) and in Japanese (247) and Finnish (266) travelers, ZIKV can be isolated from urine after viremia has waned to an undetectable level. These observations suggest that molecular diagnosis of ZIKV, like that of DENV and WNV, can possibly be performed with urine collected after virus clearance from blood, thus enlarging the window for ZIKV RNA detection. ZIKV RNA loads in urine ranged from 3.8 × 103 to 2.2 × 108 copies/ml (145, 305, 307).

During the French Polynesian outbreak, blood and saliva samples were collected concomitantly from patients (140). Of 182 patients, 35 (19.2%) were positive by saliva testing but negative by blood testing, while 16 (8.8%) were positive by blood testing and negative by saliva testing; the difference in the median time after symptom onset (3 days) and the frequency of symptoms of Zika fever in patients positive only by saliva or blood testing was not significant (140). The use of a saliva sample increased the rate of molecular detection of ZIKV during the acute phase of the disease but did not enlarge the window for ZIKV RNA detection and was not related to the clinical presentation of the patients. Saliva was of particular interest when blood was difficult to collect, especially from children and neonates.

In semen, ZIKV RNA loads ranged from 1.1 × 107 to 2.9 × 107 copies/ml (305) and in breast milk, they ranged from 2.9 × 104 to 2 × 106 copies/ml (307).

(iii) ZIKV RNA detection on filter paper.

If molecular diagnosis is not locally available, case confirmation may require shipment of frozen samples to a reference laboratory, which is expensive and most of the time impossible in remote areas. Filter papers spotted with dried blood are not subject to dangerous goods regulations (354), and this can facilitate sample storage and shipment because they can be shipped at ambient temperature (355). The use of filter papers was implemented in remote Pacific countries to improve the surveillance of dengue fever (356). This protocol is now routinely used by the Institut Louis Malardé, French Polynesia, in collaboration with the WHO to confirm arbovirus outbreaks (DENV, CHIKV, and ZIKV) (21) and leptospirosis (357, 358) in the Pacific (Solomon Islands Broadcasting Corporation). Using this protocol, ZIKV RNA was detected in 49 samples collected in the Cook Islands (21) and 1 sample collected in the Solomon Islands (Auckland Regional Public Health Services, http://www.arphs.govt.nz/health-information/communicable-disease/dengue-fever-zika-chikungunya#.VeqEFv8Vipo), leading to the identification of arbovirus outbreaks in these countries.

Serological Diagnosis

ZIKV serology is usually performed by ELISA with confirmation testing by PRNT according to standard protocols (359–363). To date, there is no validated commercial serology kit for ZIKV, but kits will be available soon. ELISA is available in many laboratories. PRNT is the “gold standard” for anti-Flavivirus antibody differentiation (361) because it is relatively specific in primary Flavivirus infections (no previous infection with another Flavivirus) (364). PRNT, however, is done only in highly specialized laboratories, is expensive, and may require regulated laboratories because of the manipulation of live viruses. New protocols using recombinant viruses (365) or reporter virus particles (363) have been developed but are not yet available for ZIKV. The arboviral serosurveys conducted in French Polynesia were done by indirect ELISA with recombinant antigens (123, 142).

The largest experience of diagnosis of ZIKV infections by serology was the testing of serum samples collected during the ZIKV outbreak in Yap State (135). Serological analysis from primary or secondary (previous infection with another Flavivirus) infected patients was performed with IgG and IgM ZIKV ELISA. Confirmation was performed by determining the reciprocal of the serum dilution reducing the number of plaques >90% (PRNT90) for ZIKV, DENVs, YFV, JEV, Murray Valley encephalitis virus, WNV, and St. Louis encephalitis virus (135). ELISA for IgM antibody against ZIKV cross-reacted with other flaviviruses but was not believed to cross-react with alphaviruses such as RRV or CHIKV (16). In primary Flavivirus infections, the IgM antibody response was specific for ZIKV, even though a limited degree of cross-reactivity with other flaviviruses was observed, and PRNT90 was highly specific. In contrast, in secondary Flavivirus-infected patients, a high degree of serologic cross-reactivity with other flaviviruses was observed with both IgM ELISA and PRNT90 (135). Serological criteria to confirm ZIKV infection during the Yap State outbreak included a positive IgM ZIKV ELISA, ZIKV PRNT90 titers of ≥20, and a ZIKV PRNT90/DENV PRNT90 ratio of ≥4 (16).

If Zika fever is suspected in a population where other flaviviruses are endemic, serological diagnosis of ZIKV is difficult to interpret because the high degree of cross-reactions in the IgM and IgG assays could lead to false-positive results. During the French Polynesian outbreak, serological diagnosis of Zika fever was not implemented because DENV-1 and DENV-3 were cocirculating and >80% of the adult population had antibodies to at least one DENV serotype (123, 142). If the risk of cross-reactions with other flaviviruses is high in adult populations with probable prior Flavivirus infection, the risk may be low for new immigrants from areas where ZIKV is not endemic, for tourists, and for young children. All serological results should be interpreted with regard to the status of the patient. Of note, Theiler and Casals demonstrated that a secondary Flavivirus infection resulted in an increase in heterologous antibodies to other viruses of the same group (366). Moreover, a voluntary human ZIKV infection produced antibodies to ZIKV and YFV (367), but immunization with yellow fever vaccine did not produce antibodies to ZIKV (368). These results highlight the need for the confirmation of at least some cases during outbreaks by molecular and/or viral isolation.

Diagnosis of Zika Fever in Countries Where It Is Endemic

In countries with limited laboratory capacities, molecular diagnosis is not available and arbovirus diagnosis is often performed by serologic testing by IgM ELISA or rapid tests. If local laboratories use rapid tests for dengue, it is recommended to use a combined NS1 antigen and IgM antibody test to increase the sensitivity and specificity of dengue fever diagnosis (369) because NS1 antigen detection is not believed to cross-react with ZIKV. If several patients are negative by a DENV NS1 test within the first week of a “dengue like disease,” Zika fever or other arboviruses should be suspected. In this setting, the shipment of filter papers spotted with blood to reference laboratories is of great value for diagnostic confirmation. In countries with advanced laboratory capacities, an RT-PCR assay should be the first-line test. Patients presenting in the acute phase of infection with a “dengue- or chikungunya-like syndrome” or with “fever and rash” and found to be negative by specific DENV and CHIKV RT-PCR assays should be tested with a specific ZIKV RT-PCR assay. In all areas where ZIKV is known to be endemic, other arboviruses are also endemic, making serodiagnosis difficult, especially for patients with a prior Flavivirus infection.

Diagnosis of Travelers

For patients returning from areas with known ZIKV transmission, the challenge is to confirm ZIKV versus other endemic pathogens. In this setting, all diagnoses of “atypical dengue” in travelers returning from areas where ZIKV is endemic should be carefully investigated, especially if a dengue fever diagnosis relies only on serological results. If Zika fever is suspected, a specific ZIKV RT-PCR assay of acute-phase serum samples should be performed (saliva can also be tested); urine can be tested after the acute phase of the disease. Another approach is to perform a pan-Flavivirus RT-PCR assay with sequencing of the PCR product if it is positive. When molecular testing is negative, serology can be considered, but because of the cross-reactivity noted above, results should be interpreted with caution (179). Collection of paired serum samples with a 4-week interval is recommended. As a positive ZIKV IgM result is not conclusive of ZIKV infection, PRNT should be performed for confirmation. If the patient had a previous Flavivirus infection or is living in a country where flaviviruses are endemic, molecular testing or isolation is recommended as a first-line test; if serology is performed, the result should be confirmed by PRNT. A schematic flow diagram for Zika fever diagnosis derived from the recommendations of the PAHO (37, 330) and the Haut Conseil de la Santé Publique de France (http://www.hcsp.fr/explore.cgi/avisrapportsdomaine) is presented in Fig. 7. Other specific recommendations for the diagnosis of Zika fever in pregnant women and infants have been recently issued (370, 371) and will be developed in an upcoming issue of Clinical Microbiology Reviews.

FIG 7.

FIG 7

Schematic flow diagram for Zika fever diagnosis. ZIKV RT-PCR is performed on blood (or on saliva if a blood sample is impossible to collect). If Flavivirus RT-PCR results are positive, sequencing is performed. ZIKV IgM serology consists of detection by ELISA or immunofluorescence, with confirmation by PRNT if the results are positive or equivocal.

CLINICAL FEATURES OF ZIKA FEVER

In tropical Africa, the Asia-Pacific region, and the Americas, infection with more than one pathogen is common and care must be exercised in ascribing a clinical diagnosis (2). In a recent study conducted in Senegal, about 50% of the patients infected with arboviruses also had malaria; three patients were coinfected with ZIKV and malaria parasites (372). The first clinical description of a patient suffering only from Zika fever was reported in 1956; it was based on a ZIKV infection experimentally induced in a human volunteer (367). The patient was a 34-year-old European male infected subcutaneously with the strain isolated in Nigeria in 1954. The first symptoms were fever and a slight headache 82 h (3.5 days) after inoculation. The headache lasted about 2 days. A rash was not recorded, and the blood count was normal. ZIKV was isolated from the blood of the patient on days 4 and 6 after infection. By HI and intracerebral mouse protection test, an increase in antibodies to both ZIKV and YFV was demonstrated from day 8 after inoculation. The patient was exposed to female Ae. aegypti mosquitoes during the acute stage of illness, but ZIKV was not recovered from them, most likely because of the low viremia titer.

During the Yap State and French Polynesian outbreaks, the most common clinical symptoms reported were fever, rash, arthritis and/or arthralgia and/or myalgia, conjunctivitis, and fatigue (Fig. 8). Zika fever symptoms are described in Table 6. No hemorrhagic complications or hospitalizations were reported during the acute phase of illness in these outbreaks (16) (Direction de la Santé de la Polynésie Française, http://www.hygiene-publique.gov.pf/spip.php?article126). Dating the onset of symptoms is difficult in Zika fever because there is no abrupt clinical onset (140, 145), as opposed to dengue fever (331) and chikungunya (373). In French Polynesia, most of the patients sought medical care for a rash probably after the viremic stage. Negative ZIKV RT-PCR results do not rule out a Zika fever diagnosis because the viremic stage is short. The incubation period ranged from 3.5 days for the human volunteer (367) to 6 to 10 days for returning travelers and blood donors (232, 247, 312). Evolution can be biphasic; in French Polynesia, some patients sought medical care for a second episode of “Zika-like symptoms,” as was reported for the patients with ZIKV isolated from semen (275, 305). The duration of the illness is about 1 week.

FIG 8.

FIG 8

Conjunctivitis and rash in Zika fever. Top left photo courtesy of H. P. Mallet, Department of Health of French Polynesia; top right, bottom left, and bottom right photos by V. M. Cao-Lormeau and E. Grange, Institut Louis Malardé.

TABLE 6.

Clinical symptoms of Zika fever

Clinical symptom(s) Main characteristic(s) (reference) Location(s), % (mean duration [days]) of symptomsb References
Maculopapular rash/pruritis Diffuse maculopapular rash on palms and soles (Fig. 8); can be pruriginous or lacking (119) YS, 80-90 (6); FP, 93 (5.2) 14, 17, 27, 28, 127, 144, 145, 206, 211, 213, 214, 216, 217, 222, 230, 232–234, 241, 242, 247, 259-261, 265, 266, 307, 452, 453, 480
Fatigue/lethargy/asthenia FP, 78 14, 144, 232, 234, 241, 242, 259, 261, 453, 480
Fever Usually mild and mostly self-reportedd; abrupt onset of high fever very uncommon; high fever (around 39°C) reported in 2 Brazilian (28), 7 Indonesian (119), and 1 Colombian (451) patients YS, 65-70; FP, 72 (2.9) 2, 14, 17, 27, 28, 119, 125, 127, 144, 145, 206, 213, 214, 216, 217, 221, 222, 230, 234, 241, 242, 247, 260, 265, 266, 303, 307, 336, 336, 349, 367, 450-452, 480
Arthritis/arthralgia/myalgia Mainly involves hands, feet, and knees; edema of extremities can be associated YS, 60-65 (3-5); FP, 65 (6.8)e 14, 17, 27, 28, 119, 125, 144, 145, 206, 211, 214, 216, 217, 221, 230, 232–234, 247, 259, 260, 265, 303, 307, 336, 452, 453
Conjunctivitis Limited to a bilateral conjunctiva hyperemia (Fig. 8) YS, 55-65; FP, 63 (3.5) 17, 28, 119, 145, 211, 214, 221, 222, 230, 233, 234, 247, 259, 260, 265, 336, 452, 453
Headache YS, 40-45; FP, 46 2, 14, 17, 27, 28, 125, 127, 144, 145, 232, 242, 247, 259, 265, 303, 307, 336, 349, 367
Malaise 28, 119, 127, 213, 221, 234, 259, 367
Jaundice 2
Chills 119, 213, 232, 242, 303
Dizziness YS, 10 119
Joint pain/swelling/edema YS, 19-20; FP, 47 2, 17, 28, 145, 213, 214, 221, 222, 230, 232, 261, 452
Burning sensation in extremities 214
Retro-orbital pain YS, 30-39; FP, 16 7, 28, 145, 247, 266, 303
Anorexia 119, 336
Photophobia 232
Gastrointestinal disorders YS, 8-10; FP, 28 14, 28, 119, 144, 241, 261, 336
Sore throat FP, 23 214, 265, 336, 349
Cough 2, 259, 349
Rhinorrhea 265
Aphthous ulcer FP, 4 17, 232, 241, 242
Hypotension 119
Hematuria 119
Prostatitis 232
Back pain 127, 234, 242, 303
Hearing difficulties 214
Hematospermia 232
Lymphadenopathy FP, 15 28, 119, 145, 211, 221, 230, 303
Sweating 303
Laboratory abnormalities
    Albuminemia 2
    Increased transaminases 144, 217, 453
    Increased lactate dehydrogenase 452
    Bile pigment in urine 2
    Thrombocytopenia Normal-to-low-normal platelet countc YS, FP 144, 145, 221, 222, 241, 242, 247, 307
    Leukopenia Normal-to-low-normal leukocyte countc YS, FP 28, 144, 145, 206, 217, 221, 230, 247, 259
    Reactive lymphocytes 144, 145, 206, 221, 259, 452
    C-reactive protein Normal to slightly increasedc FP 27, 211, 222
b

FP, French Polynesia. Data are from reference 377 and http://www.hygiene-publique.gov.pf/spip.php?article126.

c

Personal communication.

e

Hands, 30%; feet, 17%; knees, 16%; fingers, 10%; wrists, 10%.

The PAHO (37, 179) proposed a provisional case definition of ZIKV infection based on the definition used during the French Polynesian outbreak (Direction de la Santé de la Polynésie Française, http://www.hygiene-publique.gov.pf/). A suspected case is a patient with a rash or an elevated body temperature (>37.2°C) and one or more of the following symptoms (not explained by other medical conditions): (i) arthralgia or myalgia, (ii) nonpurulent conjunctivitis or conjunctival hyperemia, (iii) headache or malaise. A confirmed case: is a suspected case with a positive laboratory result for the specific detection of ZIKV.

Before the French Polynesian outbreak, the seroprevalence of IgG for ZIKV was <1% in adults (123) but increased to 50% in a cohort of children 6 to 16 years old and 66% in a cohort of people 7 to 86 years old after the outbreak (142). Compared to the estimate of 11.5% of symptomatic cases in the population (18, 141), the ratio of symptomatic to asymptomatic patients was about 1:5 to 1:6. These results cannot be compared with those of the serosurvey conducted in Yap State, which detected IgM antibodies (16). However, this ratio is similar to the estimates of DENV (75, 374) and WNV infections (375). During the ZIKV outbreak, 2.8% of the blood donors tested were positive for ZIKV (312), which suggests that about 2.8% of the asymptomatic adults were viremic during the outbreak. It should be noted, however, that the ratio of asymptomatic to symptomatic DENV, and probably ZIKV, infections can vary greatly, depending on the virus strain and background immunity.

Complications

Before the French Polynesian outbreak, Zika fever was described as a mild, self-limiting, febrile illness without severe complications and a low hospitalization rate (40, 141). This description was based on a limited number of cases and one outbreak investigation, but the experience in French Polynesia changed that perception, with the description of severe neurological complications (18). With the emergence of ZIKV in Brazil, severe neonatal complications have now been reported (36).

Neurological complication in adults.

During the French Polynesian outbreak, an unexpectedly high number of GBS cases was observed. The established incidence of GBS is about 1 to 3 cases per 100,000 inhabitants per year (376). In French Polynesia, the annual number of reported cases was 5, 10, 3, and 3 in 2009 to 2012, respectively (141). In December 2013, the first patient with GBS was hospitalized 7 days after presenting with a “Zika-like syndrome” (low-grade fever, myalgia, rash, and conjunctivitis) (34). During the epidemic, 42 GBS cases were reported or approximately a 20-fold higher incidence than expected (Direction de la Santé de la Polynésie Française, http://www.hygiene-publique.gov.pf/). All GBS patients developed neurological symptoms following a “Zika-like syndrome” episode; 74% of them were male, the median age was 42 (range, 20 to 74) years, all were natives of French Polynesia, 15 were admitted to the intensive care unit, and 9 underwent mechanical ventilation, but no deaths were reported (377). The temporal and spatial association between the French Polynesian ZIKV outbreak and the highly unusual number of GBS cases (Fig. 9) suggested that ZIKV was the cause of GBS (18). GBS has been reported as a complication of other arbovirus infections, including Flavivirus (DENV [378] and WNV [379, 380]) and Alphavirus (CHIKV [381, 382]) infections.

FIG 9.

FIG 9

Temporal association between cases of Zika fever (blue columns) and GBS (red line) during the French Polynesian outbreak.

In the Americas, an increase in GBS has been reported in three countries (31). From January to July 205, Brazil reported 121 cases in northeastern states; 62% of the patients had symptoms consistent with Zika fever preceding GBS. In El Salvador, of 22 cases investigated in December 2015, 54% also had symptoms consistent with Zika fever preceding GBS. In Venezuela, an increase of 2- to 3-fold from the national baseline has been recorded. Finally, a first case of GBS possibly associated to ZIKV infection has been reported by the French Ministry of Health on Martinique (31). Collectively, these epidemiological data reinforce the hypothesis of a relationship between ZIKV and GBS. Ocular complications in adults have been reported (383).

Neurological complications in neonates.

From 2010 to 2014, the annual number of reported cases of microcephaly in Brazil ranged from 150 to 200 (384). A relationship between ZIKV and microcephaly was first suspected in Brazil in late October 2015, with an increase in cases reported in Pernambuco State, northeastern Brazil (308, 384, 385). The Brazilian Ministry of Health declared a national public health emergency on 11 November (http://paraiba.pb.gov.br/saude-discute-notificacao-de-casos-de-microcefalia-na-paraiba-nesta-sexta-feira/), and three other alerts were issued by the PAHO on 17 November (36), by the ECDC on 24 November (35), and again by the PAHO on 1 December (37). A task force was established to investigate the link between ZIKV infections during pregnancy and microcephaly (38). In the middle of December, 1,761 cases were reported in 13 states (208). As of late January 2016, Brazil has reported 3,893 cases of microcephaly since October 2015 (209). Cases were reported in 21 states and 724 municipalities (31). In early February 2016, the WHO declared a global health emergency (386).

After retrospective investigations, the French Polynesian health authorities reported 17 central nervous system malformations (including microcephaly) in newborns coinciding with the ZIKV outbreak in French Polynesia. The annual average number of central nervous system malformations in this country is about one (31, 35, 37).

An etiologic relationship between ZIKV and microcephaly has not yet been firmly demonstrated (387), but new virologic and epidemiologic data favor the hypothesis of cause and effect. ZIKV RNA was detected in the amniotic fluid of pregnant women who gave birth to microcephalic newborns and in the brains of microcephalic newborns (31, 37, 276, 308, 388). These data confirm that, like TORCH viruses (toxoplasmosis, other [syphilis, varicella-zoster, parvovirus B19], rubella, cytomegalovirus, and herpesvirus) (389, 390), ZIKV is associated with severe neurological damage in newborns. However, several etiologies of microcephaly have been identified (35) and the number of microcephaly cases directly associated with ZIKV is unknown (370, 391).

The possibility cannot be excluded that microcephaly is only the tip of the iceberg and that other complications, less severe or affecting not only the brain but other organs, might occur. Other neurological, ophthalmologic, and auditory complications are now reported in neonates (38, 209, 276, 308, 371, 392). These reports will be reviewed in an upcoming issue of Clinical Microbiology Reviews.

ZIKV-related death.

In addition to microcephalic neonates who died in the 24 h after death (31), three ZIKV-related deaths were reported in late November in Brazil (two adults with neurological disorders and one newborn) (37, 393). A ZIKV-infected 15-year-old female suffering from sickle cell disease died despite management in a pediatric intensive care unit (394).

Differential Diagnosis

The clinical presentation of Zika fever is not specific and can mimic diseases responsible for fever, rash, and arthralgia, especially dengue and chikungunya (271, 395). Sporadic cases of Zika fever in areas where dengue and/or chikungunya are endemic can be difficult to diagnose clinically, highlighting the importance of laboratory investigation of patients presenting with “dengue-like syndromes” and testing negative for dengue. Algorithms comparing clinical symptoms of Zika fever, dengue, and chikungunya (396) have been proposed but should be used with caution, especially when several arboviruses are cocirculating.

Treatment

There is no specific treatment or antiviral drug for ZIKV infection (179). The current treatment guidance is based on a limited body of evidence. Recommendations are the treatment of symptoms based on acetaminophen for fever and pain, an antihistaminic for pruritic rash, and drinking of fluids. Treatment with acetylsalicylic acid and nonsteroidal anti-inflammatory drugs is discouraged because of the reported increased risk of hemorrhagic syndrome with other flaviviruses (Secretariat of the Pacific Community, http://www.spc.int/phs/english/publications/informaction/IA27/Zika-outbreak-Yap-2.pdf). In the first days after symptom onset (viremic phase), patient isolation to avoid mosquito bites is recommended to prevent the infection of other persons (179).

PREVENTION OF ZIKA FEVER

There is no vaccine for ZIKV, although several are in the development phase with dengue vaccine technology. Prevention measures are therefore the same as for all Ae. aegypti-borne diseases for which there are no vaccines, including individual protection from mosquito bites and vector control. The literature on DENV prevention and control is voluminous and will not be reviewed here. See the previously published reviews on public health strategies (397–400) and mosquito bite prevention guidelines (51). The epidemiological alert for ZIKV prepared by the PAHO recommended integrated vector management and personal prevention measures (171). The spread of ZIKV highlights the need to develop new vector control strategies (401).

Specific recommendations have been issued to prevent congenital complications of ZIKV infections (37, 370, 402, 403); these recommendations will be developed in an upcoming issue of Clinical Microbiology Reviews.

SURVEILLANCE OF ZIKA FEVER

All countries at risk for ZIKV infection, e.g., those infested with Ae. aegypti, should develop basic virologic and serologic laboratory capabilities to diagnose ZIKV. In countries without autochthonous ZIKV transmission, the PAHO recommends strengthening event-based surveillance to detect the first case (37, 171, 179). This would require including ZIKV testing of all patients presenting with dengue-like illness who test negative for DENV in countries with competent mosquito vectors. In countries with autochthonous transmission of ZIKV, the PAHO recommends monitoring of the trend and geographic spread of the virus within and to new countries and monitoring of genetic lineages of ZIKV (37, 171). The impact on public health should be monitored by enhancing surveillance for potential neurological and autoimmune complications, following up pregnant women and congenital malformations, and identifying risk factors associated with ZIKV infection.

THE POTENTIAL FOR ZIKV EMERGENCE

In the last 4 decades, the emergence/resurgence of epidemic arboviruses has been dramatic, affecting both humans and animals (57). There has been an increased frequency of epidemic dengue in all tropical regions of the world, and dengue hemorrhagic fever has emerged in Asia, tropical America, and the Pacific (400). Dengue is now endemic to all of the tropical areas of the world (82, 104). In the last 2 decades, WNV has emerged as a major epidemic disease of birds, horses, and humans in the Mediterranean region, Europe, and the Americas, with severe and fatal disease occurring in all of these areas (404–408). In the past decade, the status of chikungunya changed from a relatively uncommon and poorly documented disease to an emerging epidemic disease that is now a global public health concern (25, 373). There are many factors responsible for this emergence and changing epidemiology, but the principal drivers have been global population growth, urbanization, globalization, and a lack of effective vector control (57, 104).

The emergence of these arboviruses was associated with the description of new clinical patterns (ZIKV, CHIKV, and WNV) (18, 26, 34, 37, 404, 407, 409–412) and new modes of transmission (ZIKV, CHIKV, and WNV) (68–71, 307, 312, 409, 413). There is good evidence that genetic changes in DENV, CHIKV, and WNV have been responsible for phenotypic changes influencing virulence and epidemic potential (84, 85, 88–94); to date, this has been suspected but not demonstrated for ZIKV (31), but it is the most likely explanation for its dramatic emergence in the past few years. The potential impact of climatic change on the spread of ZIKV in unknown (414).

ZIKV (40), like DENVs and CHIKV, has probably adapted from an ancestral forest cycle involving nonhuman primates as a vertebrate reservoir and canopy-dwelling mosquitoes as vectors to a new urban/periurban cycle involving humans and Ae. aegypti and/or Ae. albopictus mosquitoes as vectors. Experiments are under way to confirm this adaptation of ZIKV. As widely distributed Ae. aegypti and Ae. albopictus mosquitoes are competent ZIKV vectors, the potential for the emergence of ZIKV to overlap the geographic distribution of those mosquitoes is great (Fig. 10) (ECDC, http://www.ecdc.europa.eu/en/healthtopics/vectors/) (40, 373, 415, 416). The recent coemergence of arboviruses in Pacific island countries and territories is a good example (18, 39, 40, 481). Until 2007, DENV was the predominant arbovirus in the Pacific, usually with the circulation of a predominant serotype. The epidemiologic situation has since changed (39), with the cocirculation of several DENV serotypes (137) and the emergence of ZIKV in 2007 (18) and CHIKV in 2011 (25). The situation is similar in Brazil, where CHIKV emerged in 2014 (373) and ZIKV emerged in 2015 (27) in addition to numerous already endemic arboviruses, e.g., DENV and YFV (186). The epidemic in Brazil poses a high global risk, with about 10 million travelers that depart annually for international destinations; this risk will increase in August 2016, when Brazil will host the Summer Olympic Games (162).

FIG 10.

FIG 10

Global distribution of Ae. aegypti and Ae. albopictus.

The experience of the recent emergence of arboviruses and the facts that ZIKV has essentially the same epidemiology and mosquito vectors in urban areas as DENV and CHIKV, that it uses humans as the principal vertebrate host in urban/periurban areas, and that this human connection greatly increases the risk of global spread via infected humans to areas where mosquito control has failed (104) suggest that ZIKV will likely follow in the path of DENV and CHIKV and become a global public health problem (40). Features common to ZIKV, CHIKV, WNV, and DENV are shown in Table 7.

TABLE 7.

Common features of ZIKV and other arboviruses

Parameter ZIKV CHIKV WNV DENV
Family Flaviviridae (45)a Togaviridae (454) Flaviviridae (45) Flaviviridae (45)
Genus Flavivirus (45) Alphavirus (454) Flavivirus (45) Flavivirus (45)
Place and/or time of discovery Uganda, 1947 (1) Tanzania, 1952 (455)b Uganda, 1937 (111) During World War II (458)c
Recent emergence Pacific, 2007 (16), 2013 (18); Americas, 2015 (27, 28, 30, 33, 195) Kenya, 2004 (460); Indian Ocean islands, 2005 (409, 463); India, 2005/2006 (466); Europe, 2007 (223–225); Southeast Asia, 2008 (467); Pacific, 2011 (25); Caribbean, 2013 (468–470) Romania, 1996 (404); Russia, 1999 (461); Italy, 2008 (226, 462); New York, 1999 (407); North and South America, 1999 (408, 464, 465) Global (104)
Geographic distribution (autochthonous human infections) Africa (33); Americas (30); Asia (119); Oceania (18) Africa (95); Americas (95); Asia (95); Europe (95); Oceania (95) Africa (406); Americas (406); Asia (406); Europe (406) Africa (104); Americas (104); Asia (104); Europe (104); Oceania (104)
Cocirculation of ZIKV with DENV, CHIKV, and WNV Africa (33); Americas (33); Asia (119) Africa (95); Americas (95); Asia (95) Africa (406); Americas (406); Asia (406) Africa (104); Americas (104); Asia (104)
Ratio of symptomatic/asymptomatic infections 1/5–1/6 (123, 142) 8.5/10 (373) 1/4 (375) 1/4–1/9 (75, 374)
Main presentation Asymptomatic or mild disease (16, 396) Mild disease (373) with persistent and relapsing arthralgia in up to 50% of patients Asymptomatic or mild disease (471) Asymptomatic or mild disease, hemorrhagic fever (82)
Main complications Neurological complications in adults in French Polynesia and Brazil, 2013–2015 (18, 31, 34) and in neonates in French Polynesia and Brazil (26, 31, 35–37, 384) Neurological complications on Reunion Island, 2005–2006 (409–411) Neurological complications in Romania, Russia, Italy, United States (226, 404, 407, 412, 462) Dengue hemorrhagic fever and dengue shock syndrome (82, 331)
When no longer considered to cause mild disease, location 2013, French Polynesia (18, 34) 2005, Reunion Island (472) 1996, Romania (404) Never considered to cause mild disease
Expanding lineage or serotype Asian (17, 271) East/Central/South African (ECSA) (373); Asian (473) Lineage 1 (474) Circulation and emergence of all 4 dengue serotypes (104)
New mosquito vector(s) recent adapted to Ae. hensilii (Yap State) (16, 295), Ae. albopictus (Gabon) (14) Ae. albopictus (Reunion, Mauritius …) (475) Not reported Most Aedes species of subgenus Stegomyiaf (476)
Adaptation from zoonotic cycle in Africa to urban cycle Pacific islands (40) Reported (83, 373, 477–479) Not reported Reported (82, 400)
Non-vector-borne transmission modes Maternofetal (307), transfusiond (312) Maternofetal (68, 69) (409), transfusiond (413) Maternofetal (70, 71), transfusione (77, 309) Maternofetal (66, 67), transfusion (75, 76)
a

Reference numbers are in parentheses.

b

But chikungunya is probably an older disease known as ki denga pepo (456, 457).

c

But dengue-like illness has been described for at least 250 years (459).

d

Potential risk.

e

Public health problem in North America.

f

In the version of this article published on 30 March 2016, “Stegomyia” was incorrectly spelled “Stemomyia.” This was changed in the version published on 9 May 2016.

CONCLUSION

The first ZIKV outbreak in Yap State was unexpected and demonstrated the potential for ZIKV emergence. The second outbreak in French Polynesia was also unexpected and was associated for the first time with severe neurologic disease. From French Polynesia, ZIKV spread in the Pacific and imported cases were reported on several continents. In 2015, ZIKV emerged in the Americas and, as in French Polynesia, appears to be associated with severe neurologic disease. An outbreak has also been reported in the Cape Verde Islands (Africa). The emergence of ZIKV in areas with cocirculation of other flaviviruses will make diagnosis based on clinical and epidemiological grounds difficult and unreliable. The emergence of ZIKV in the Pacific, the Americas, and Africa underscores the potential for ZIKV to spread globally as DENV and CHIKV have done. The future of ZIKV is unpredictable, but its recent spread confirms that ZIKV is following in the path of CHIKV and DENV (40). The severe disease associated with ZIKV in French Polynesia and Brazil, however, suggests that this virus will become a very serious global public health problem.

ACKNOWLEDGMENTS

We thank all of the technicians and researchers working in the medical diagnosis laboratory and in the unit of emerging infectious disease of the Institut Louis Malardé. We thank M. Solignac of the Institut Louis Malardé for creating the figures. We thank all of the public and private health care and personal care workers who managed the French Polynesian Zika fever outbreak in 2013 and 2014. We thank the reviewers; their criticism greatly improved the manuscript.

Biographies

graphic file with name zcm0031625520012.jpg

Didier Musso is a medical doctor who graduated from the Faculty of Medicine of Aix Marseille University, Marseille, France. He has been the director of the Diagnosis Medical Laboratory and of the Unit of Emerging Infectious Diseases of the Institut Louis Malardé, Papeete, Tahiti, French Polynesia, since 2012. His research interests focus on endemic French Polynesian infectious diseases, especially arboviroses, leptospirosis, tuberculosis, and lymphatic filariasis. During the French Polynesian Zika fever outbreak, his laboratories were in charge of identification, diagnosis, surveillance, and research programs on ZIKV. These laboratories also received samples from collaborative countries in the Pacific area for arbovirus diagnosis and surveillance.

graphic file with name zcm0031625520011.jpg

Duane J. Gubler has degrees in zoology/entomology (B.S.), parasitology/entomology (M.S.), and pathobiology/tropical disease ecology (Sc.D.), the latter from the Johns Hopkins University School of Public Health in Baltimore, MD. He is currently professor and Founding Director of the Signature Research Program in Emerging Infectious Diseases, Duke-NUS Medical School, Singapore, and Chairman, Partnership for Dengue Control, Lyon, France. He served as Chair, Department of Tropical Medicine, Medical Microbiology and Pharmacology, University of Hawaii School of Medicine in Honolulu, and was the Founding Chief of the CDC Dengue Branch in Puerto Rico and Director of the CDC Division of Vector-Borne Infectious Diseases in Fort Collins. His research interests have focused on the epidemiology, prevention, and control of vector-borne infectious diseases, with an emphasis on dengue.

Footnotes

Changes made 9 May 2016

REFERENCES

  • 1.Dick GW, Kitchen SF, Haddow AJ. 1952. Zika virus. I. Isolations and serological specificity. Trans R Soc Trop Med Hyg 46:509–520. [DOI] [PubMed] [Google Scholar]
  • 2.Macnamara FN. 1954. Zika virus: a report on three cases of human infection during an epidemic of jaundice in Nigeria. Trans R Soc Trop Med Hyg 48:139–145. doi: 10.1016/0035-9203(54)90006-1. [DOI] [PubMed] [Google Scholar]
  • 3.Faye O, Freire CC, Iamarino A, Faye O, de Oliveira JV, Diallo M, Zanotto PM, Sall AA. 2014. Molecular evolution of Zika virus during its emergence in the 20th century. PLoS Negl Trop Dis 8:e2636. doi: 10.1371/journal.pntd.0002636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Marchette NJ, Garcia R, Rudnick A. 1969. Isolation of Zika virus from Aedes aegypti mosquitoes in Malaysia. Am J Trop Med Hyg 18:411–415. [DOI] [PubMed] [Google Scholar]
  • 5.Monlun E, Zeller H, Le Guenno B, Traoré-Lamizana M, Hervy JP, Adam F, Ferrara L, Fontenille D, Sylla R, Mondo M, Digoutte JP. 1993. Arbovirus affecting humans in southeast Senegal: surveillance in humans and mosquitoes (1988–1991). Bull Soc Pathol Exot 86:21–28. (In French.) [PubMed] [Google Scholar]
  • 6.Akoua-Koffi C, Diarrassouba S, Bénié VB, Ngbichi JM, Bozoua T, Bosson A, Akran V, Carnevale P, Ehouman A. 2001. Investigations surrouding a fatal case of yellow fever in Côte d'Ivoire in 1999. Bull Soc Pathol Exot 94:227–230. (In French.) [PubMed] [Google Scholar]
  • 7.Diallo D, Sall AA, Diagne CT, Faye O, Faye O, Ba Y, Hanley KA, Buenemann M, Weaver SC, Diallo M. 2014. Zika virus emergence in mosquitoes in southeastern Senegal, 2011. PLoS One 9:e109442. doi: 10.1371/journal.pone.0109442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Faye O, Faye O, Diallo D, Diallo M, Weidmann M, Sall AA. 2013. Quantitative real-time PCR detection of Zika virus and evaluation with field-caught mosquitoes. Virol J 10:311. doi: 10.1186/1743-422X-10-311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Weinbren MP, Williams MC. 1958. Zika virus: further isolations in the Zika area, and some studies on the strains isolated. Trans R Soc Trop Med Hyg 52:263–268. doi: 10.1016/0035-9203(58)90085-3. [DOI] [PubMed] [Google Scholar]
  • 10.Haddow AJ, Williams MC, Woodall JP, Simpson DI, Goma LK. 1964. Twelve isolations of Zika virus from Aedes (Stegomyia) africanus (Theobald) taken in and above a Uganda forest. Bull World Health Organ 31:57–69. [PMC free article] [PubMed] [Google Scholar]
  • 11.Haddow AJ. 1961. Studies on the biting habits and medical importance of East African mosquitoes of the genus Aedes. II. Subgenera Mucida, Diceromyia, Finlaya and Stegomyia. Bull Entomol Res 52:317–351. doi: 10.1017/S0007485300055449. [DOI] [Google Scholar]
  • 12.Berthet N, Nakouné E, Kamgang B, Selekon B, Descorps-Declère S, Gessain A, Manuguerra JC, Kazanji M. 2014. Molecular characterization of three Zika flaviviruses obtained from sylvatic mosquitoes in the Central African Republic. Vector Borne Zoonotic Dis 14:862–865. doi: 10.1089/vbz.2014.1607. [DOI] [PubMed] [Google Scholar]
  • 13.McCrae AWR, Kirya BG. 1982. Yellow fever and Zika virus epizootics and enzootics in Uganda. Trans R Soc Trop Med Hyg 76:552–562. doi: 10.1016/0035-9203(82)90161-4. [DOI] [PubMed] [Google Scholar]
  • 14.Grard G, Caron M, Mombo IM, Nkoghe D, Ondo SM, Jiolle D, Fontenille D, Paupy C, Leroy EM. 2014. Zika virus in Gabon (Central Africa)—2007: a new threat from Aedes albopictus? PLoS Negl Trop Dis 8:e2681. doi: 10.1371/journal.pntd.0002681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cornet M, Robin Y, Chateau R, Hème G, Adam C, Valade M, Le Gonidec G, Jan C, Renaudet J, Dieng PL, Bangoura JF, Lorand A. 1979. Isolation of arboviruses from mosquitoes in Senegal Oriental. Notes on epidemiology. Cah Orstsom Ser Entomol Med Parasitol 17:149–163. (In French.) [Google Scholar]
  • 16.Duffy MR, Chen TH, Hancock WT, Powers AM, Kool JL, Lanciotti RS, Pretrick M, Marfel M, Holzbauer S, Dubray C, Guillaumot L, Griggs A, Bel M, Lambert AJ, Laven J, Kosoy O, Panella A, Biggerstaff BJ, Fischer M, Hayes EB. 2009. Zika virus outbreak on Yap Island, Federated States of Micronesia. N Engl J Med 360:2536–2543. doi: 10.1056/NEJMoa0805715. [DOI] [PubMed] [Google Scholar]
  • 17.Cao-Lormeau VM, Roche C, Teissier A, Robin E, Berry AL, Mallet HP, Sall AA, Musso D. 2014. Zika virus, French Polynesia, South Pacific, 2013. Emerg Infect Dis 20:1085–1086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Musso D, Nilles EJ, Cao-Lormeau VM. 2014. Rapid spread of emerging Zika virus in the Pacific area. Clin Microbiol Infect 20:O595–O596. doi: 10.1111/1469-0691.12707. [DOI] [PubMed] [Google Scholar]
  • 19.Mallet HP, Vial AL, Musso D. 2015. Bilan de l'épidémie à virus Zika en Polynésie française, 2013–2014. French Polynesia outbreak of Zika in French Polynesia, 2013–2014. Bull Inform Sanit Epidemiol 13:1–5. (In French.) [Google Scholar]
  • 20.ProMED-mail. 22 January 2014. Zika virus—Pacific (03): New Caledonia. ProMED-mail archive no. 20140122.2224823. http://www.promedmail.org Accessed 12 September 2015.
  • 21.World Health Organization. 2014. Pacific syndromic surveillance report. Week 13, ending 30th March, 2014 World Health Organization Western Pacific Region, Manila, Philippines. [Google Scholar]
  • 22.ProMED-mail. 9 March 2014. Zika virus—Pacific (07): Chile (Easter Island), French Polynesia. ProMED-mail archive no. 20140309.2322907. http://www.promedmail.org Accessed 12 September 2015.
  • 23.ProMED-mail. 1 May 2015. Zika virus—Pacific Vanuatu. ProMED-mail archive no. 20150501.3334549. http://www.promedmail.org Accessed 12 September 2015.
  • 24.European Centre for Disease Prevention and Control. 2015. Rapid risk assessment: Zika virus infection outbreak, Brazil and the Pacific region. European Centre for Disease Prevention and Control, Stockholm, Sweden: http://ecdc.europa.eu/en/publications/Publications/rapid-risk-assessment-Zika%20virus-south-america-Brazil-2015.pdf. [Google Scholar]
  • 25.Nhan TX, Musso D. 2015. The burden of chikungunya in the Pacific. Clin Microbiol Infect 21:e47–e48. doi: 10.1016/j.cmi.2015.02.018. [DOI] [PubMed] [Google Scholar]
  • 26.European Centre for Disease Prevention and Control. 2015. Zika virus epidemic in the Americas: potential association with microcephaly and Guillain-Barré syndrome. 10 December 2015 European Centre for Disease Prevention and Control, Stockholm, Sweden. [Google Scholar]
  • 27.Campos GS, Bandeira AC, Sardi SI. 2015. Zika virus outbreak, Bahia, Brazil. Emerg Infect Dis 21:1885–1886. doi: 10.3201/eid2110.150847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zanluca C, Melo VC, Mosimann AL, Santos GI, Santos CN, Luz K. 2015. First report of autochthonous transmission of Zika virus in Brazil. Mem Inst Oswaldo Cruz 110:569–572. doi: 10.1590/0074-02760150192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Enfissi A, Codrington J, Roosblad J, Kazanji M, Rousset D. 2016. Zika virus genome from the Americas. Lancet 387:227–228. doi: 10.1016/S0140-6736(16)00003-9. [DOI] [PubMed] [Google Scholar]
  • 30.World Health Organization. 2015. Zika virus outbreaks in the Americas. Wkly Epidemiol Rec 90:609–616. http://www.who.int/wer/2015/wer9045.pdf?ua=1. [PubMed] [Google Scholar]
  • 31.European Center for Disease Prevention and Control. 2016. Zika virus disease epidemic: potential association with microcephaly and Guillain-Barré syndrome (first update). European Centre for Disease Prevention and Control, Stockholm, Sweden: http://ecdc.europa.eu/en/publications/Publications/rapid-risk-assessment-zika-virus-first-update-jan-2016.pdf. [Google Scholar]
  • 32.Hennessey M, Fischer M, Staples JE. 2016. Zika virus spreads to new areas—region of the Americas, May 2015–January 2016. MMWR Morb Mortal Wkly Rep 65:55–58. doi: 10.15585/mmwr.mm6503e1. [DOI] [PubMed] [Google Scholar]
  • 33.ProMED-mail. 6 November 2015. Zika virus—Suriname, Cape Verde. ProMED-mail archive no. 20151106.3770696. http://www.promedmail.org Accessed 10 November 2015.
  • 34.Oehler E, Watrin L, Larre P, Leparc-Goffart I, Lastere S, Valour F, Baudouin L, Mallet HP, Musso D, Ghawche F. 2014. Zika virus infection complicated by Guillain-Barre syndrome—case report, French Polynesia, December 2013. Euro Surveill 19:20720. doi: 10.2807/1560-7917.ES2014.19.9.20720. [DOI] [PubMed] [Google Scholar]
  • 35.European Centre for Disease Prevention and Control. 2015. Rapid risk assessment. Microcephaly in Brazil potentially linked to the Zika virus epidemic. European Centre for Disease Prevention and Control, Stockholm, Sweden: http://ecdc.europa.eu/en/publications/Publications/zika-microcephaly-Brazil-rapid-risk-assessment-Nov-2015.pdf. [Google Scholar]
  • 36.Pan American Health Organization. 2015. Epidemiological alerts. Increase of microcephaly in the northeast of Brazil. Pan American Health Organization, Washington, DC. [Google Scholar]
  • 37.Pan American Health Organization. 2015. Epidemiological alert. Neurological syndrome, congenital malformations, and Zika virus infections. Implications for public health in the Americas. Pan American Health Organization, Washington, DC. [Google Scholar]
  • 38.Schuler-Faccini L, Ribeiro EM, Feitosa IML, Horovitz DD, Cavalcanti DP, Pessoa A, Doriqui MJ, Neri JI, Neto JM, Wanderley HY, Cernach M, El-Husny AS, Pone MV, Serao CL, Sanseverino MT, Brazilian Medical Genetics Society-Zika Embryopathy Task Force. 2016. Possible association between Zika virus infection and microcephaly—Brazil, 2015. MMWR Morb Mortal Wkly Rep 65:59–62. doi: 10.15585/mmwr.mm6503e2. [DOI] [PubMed] [Google Scholar]
  • 39.Cao-Lormeau VM, Musso D. 2014. Emerging arboviruses in the Pacific. Lancet 384:1571–1572. doi: 10.1016/S0140-6736(14)61977-2. [DOI] [PubMed] [Google Scholar]
  • 40.Musso D, Cao-Lormeau VM, Gubler DJ. 2015. Zika virus: following the path of dengue and chikungunya? Lancet 386:243–244. doi: 10.1016/S0140-6736(15)61273-9. [DOI] [PubMed] [Google Scholar]
  • 41.World Health Organization. 1967. Arboviruses and human disease. WHO Tech Rep Ser 369:1–84. [PubMed] [Google Scholar]
  • 42.Calisher CH, Shope RE, Brandt W, Casals J, Karabatsos N, Murphy FA, Tesh RB, Wiebe ME. 1980. Proposed antigenic classification of registered arboviruses I. Togaviridae, Alphavirus. Intervirology 14:229–232. doi: 10.1159/000149190. [DOI] [PubMed] [Google Scholar]
  • 43.Porterfield JS, Casals J, Chumakov MP, Gaidamovich SY, Hannoun C, Holmes IH, Horzinek MC, Mussgay M, Oker-Blom N, Russell PK, Trent DW. 1978. Togaviridae. Intervirology 9:129–148. doi: 10.1159/000148930. [DOI] [PubMed] [Google Scholar]
  • 44.Westaway EG, Brinton MA, Gaidamovich SYA, Horzinek MC, Igarashi A, Kääriäinen L, Lvov DK, Porterfield JS, Russell PK, Trent DW. 1985. Flaviviridae. Intervirology 24:183–192. doi: 10.1159/000149642. [DOI] [PubMed] [Google Scholar]
  • 45.Gubler DJ, Kuno G, Markoff L. 2007. Flaviviruses, p 1155–1227. In Knipe DM, Howley PM (ed), Fields virology, 5th ed Lippincott Williams and Wilkins, Philadelphia, PA. [Google Scholar]
  • 46.Gaunt MW, Sall AA, de Lamballerie X, Falconar AK, Dzhivanian TI, Gould EA. 2001. Phylogenetic relationships of flaviviruses correlate with their epidemiology, disease association and biogeography. J Gen Virol 82:1867–1876. doi: 10.1099/0022-1317-82-8-1867. [DOI] [PubMed] [Google Scholar]
  • 47.Kuno G, Chang GJ, Tsuchiya KR, Karabatsos N, Cropp CB. 1998. Phylogeny of the genus Flavivirus. J Virol 72:73–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zanotto PM, Gould EA, Gao GF, Harvey PH, Holmes EC. 1996. Population dynamics of flaviviruses revealed by molecular phylogenies. Proc Natl Acad Sci U S A 93:548–553. doi: 10.1073/pnas.93.2.548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Simmonds P, Becher P, Collet MS, Gould EA, Heinz FX, Meyers G, Monath T, Pletnev A, Rice CM, Stiasny K, Thiel HJ, Weiner A, Bukh J. 2011. Flaviviridae, p 1003–1020. In King AMQ, Adams MJ, Cartens EB, Lefkowitz EJ (ed), Ninth report of the international committe on taxonomy of viruses. Academic Press Elsevier, San Diego, CA. [Google Scholar]
  • 50.Lasala PR, Holbrook M. 2010. Tick-borne flaviviruses. Clin Lab Med 30:221–235. doi: 10.1016/j.cll.2010.01.002. [DOI] [PubMed] [Google Scholar]
  • 51.Vasilakis V, Gubler DJ. 2016. Arboviruses: molecular biology, evolution and control. Caister Academic Press, Poole, United Kingdom. [Google Scholar]
  • 52.Calisher CH, Gould EA. 2003. Taxonomy of the virus family Flaviviridae. Adv Virus Res 59:1–19. doi: 10.1016/S0065-3527(03)59001-7. [DOI] [PubMed] [Google Scholar]
  • 53.Casals J. 1979. Rapid diagnosis of arboviral and related infections, p 303–319. In Kurstak E. (ed), Arctic and tropical arboviruses. Academic Press, New York, NY. [Google Scholar]
  • 54.Hanley KA, Weaver SC. 2008. Arbovirus evolution, p 351–391. In Domingo E, Parrish CR, Holland JJ (ed), Origin and evolution of viruses, 2nd ed Academic Press, New York, NY. [Google Scholar]
  • 55.Casals J. 1971. Arboviruses: incorporation in general system of virus classification, p 307–333. In Maramorosh K, Kurstak E (ed), Comparative virology. Academic Press, New York, NY. [Google Scholar]
  • 56.Casals J. 1966. 9th International Congress for Microbiology, Moscow, 1966, p 441–452. Pergamon, Oxford, United Kingdom. [Google Scholar]
  • 57.Gubler DJ. 2002. The global emergence/resurgence of arboviral diseases as public health problems. Arch Med Res 33:330–342. doi: 10.1016/S0188-4409(02)00378-8. [DOI] [PubMed] [Google Scholar]
  • 58.Novella IS, Presloid JB, Smith SD, Wilke CO. 2011. Specific and nonspecific host adaptation during arboviral experimental evolution. J Mol Microbiol Biotechnol 21:71–81. doi: 10.1159/000332752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Kenney JL, Brault AC. 2014. The role of environmental, virological and vector interactions in dictating biological transmission of arthropod-borne viruses by mosquitoes. Adv Virus Res 89:39–83. doi: 10.1016/B978-0-12-800172-1.00002-1. [DOI] [PubMed] [Google Scholar]
  • 60.Vasilakis N, Shell EJ, Fokam EB, Mason PW, Hanley KA, Estes DM, Weaver SC. 2007. Potential of ancestral sylvatic dengue-2 viruses to re-emerge. Virology 58:402–412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Vasilakis N, Holmes EC, Fokam EB, Faye O, Diallo M, Sall AA, Weaver SC. 2007. Evolutionary processes among sylvatic dengue type 2 viruses. J Virol 81:9591–9595. doi: 10.1128/JVI.02776-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Diallo M, Sall AA, Moncayo AC, Ba Y, Fernandez Z, Ortiz D, Coffey LL, Mathiot C, Tesh RB, Weaver SC. 2005. Potential role of sylvatic and domestic African mosquito species in dengue emergence. Am J Trop Med Hyg 73:445–449. [PubMed] [Google Scholar]
  • 63.World Health Organization. 1961. Arthropod-borne viruses. World Health Organ Tech Rep Ser 219:1–68. [Google Scholar]
  • 64.Kuno G. 2001. Transmission of arboviruses without involvement of arthropod vectors. Acta Virol 45:139–150. [PubMed] [Google Scholar]
  • 65.Kuno G, Chang GJ. 2005. Biological transmission of arboviruses: reexamination of and new insights into components, mechanisms, and unique traits as well as their evolutionary trends. Clin Microbiol Rev 18:608–637. doi: 10.1128/CMR.18.4.608-637.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Basurko C, Carles G, Youssef M, Guindi WE. 2009. Maternal and foetal consequences of dengue fever during pregnancy. Eur J Obstet Gynecol Reprod Biol 147:29–32. doi: 10.1016/j.ejogrb.2009.06.028. [DOI] [PubMed] [Google Scholar]
  • 67.Tan PC, Rajasingam G, Devi S, Omar SZ. 2008. Dengue infection in pregnancy: prevalence, vertical transmission, and pregnancy outcome. Obstet Gynecol 111:1111–1117. doi: 10.1097/AOG.0b013e31816a49fc. [DOI] [PubMed] [Google Scholar]
  • 68.Fritel X, Rollot O, Gerardin P, Gauzere BA, Bideault J, Lagarde L, Dhuime B, Orvain E, Cuillier F, Ramful D, Samperiz S, Jaffar-Bandjee MC, Michault A, Cotte L, Kaminski M, Fourmaintraux A, Chikungunya-Mere-Enfant Team. 2010. Chikungunya virus infection during pregnancy, Reunion, France, 2006. Emerg Infect Dis 16:418–425. doi: 10.3201/eid1604.091403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Gérardin P, Barau G, Michault A, Bintner M, Randrianaivo H, Choker G, Lenglet Y, Touret Y, Bouveret A, Grivard P, Le Roux K, Blanc S, Schuffenecker I, Couderc T, Arenzana-Seisdedos F, Lecuit M, Robillard PY. 2008. Multidisciplinary prospective study of mother-to-child chikungunya virus infections on the Island of La Réunion. PLoS Med 5:e60. doi: 10.1371/journal.pmed.0050060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Stewart RD, Bryant SN, Sheffield JS. 2013. West Nile virus infection in pregnancy. Case Rep Infect Dis 2013:351872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Centers for Disease Control and Prevention (CDC). 2002. Possible West Nile virus transmission to an infant through breast-feeding—Michigan, 2002. MMWR Morb Mortal Wkly Rep 51:877–878. [PubMed] [Google Scholar]
  • 72.Wagner D, de With K, Huzly D, Hufert F, Weidmann M, Breisinger S, Eppinger S, Kern WV, Bauer TM. 2004. Nosocomial acquisition of dengue. Emerg Infect Dis 10:1872–1873. doi: 10.3201/eid1010.031037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Clark BM, Molton JS, Habib T, Williams DT, Weston EL, Smith DW. 2012. Dengue virus infection in Australia following occupational exposure: a reflection of increasing numbers of imported cases. J Clin Virol 54:376–377. doi: 10.1016/j.jcv.2012.04.012. [DOI] [PubMed] [Google Scholar]
  • 74.Nemes Z, Kiss G, Madarassi EP, Peterfi Z, Ferenczi E, Bakonyi T, Ternak G. 2004. Nosocomial transmission of dengue. Emerg Infect Dis 10:1880–1881. doi: 10.3201/eid1010.040464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Tomashek KM, Margolis HS. 2011. Dengue: a potential transfusion-transmitted disease. Transfusion 51:1654–1660. doi: 10.1111/j.1537-2995.2011.03269.x. [DOI] [PubMed] [Google Scholar]
  • 76.Tambyah PA, Koay ESC, Poon ML, Lin RV, Ong BK, Transfusion-Transmitted Dengue Infection Study Group. 2008. Dengue hemorrhagic fever transmitted by blood transfusion. N Engl J Med 359:1526–1527. doi: 10.1056/NEJMc0708673. [DOI] [PubMed] [Google Scholar]
  • 77.Stramer SL, Fang CT, Foster GA, Wagner AG, Brodsky JP, Dodd RY. 2005. West Nile virus among blood donors in the United States, 2003 and 2004. N Engl J Med 353:451–459. doi: 10.1056/NEJMoa044333. [DOI] [PubMed] [Google Scholar]
  • 78.Hoad VC, Speers DJ, Keller AJ, Dowse GK, Seed CR, Lindsay MD, Faddy HM, Pink J. 2015. First reported case of transfusion-transmitted Ross River virus infection. Med J Aust 202:267–269. doi: 10.5694/mja14.01522. [DOI] [PubMed] [Google Scholar]
  • 79.Rigau-Pérez JG, Vorndam AV, Clark GG. 2001. The dengue and dengue hemorrhagic fever epidemic in Puerto Rico, 1994–1995. Am J Trop Med Hyg 64:67–74. [DOI] [PubMed] [Google Scholar]
  • 80.Tan FL, Loh DL, Prabhakaran K, Tambyah PA, Yap HK. 2005. Dengue haemorrhagic fever after living donor renal transplantation. Nephrol Dial Transplant 20:447–448. doi: 10.1093/ndt/gfh601. [DOI] [PubMed] [Google Scholar]
  • 81.Oster AM, Brooks JT, Stryker JE, Kachur RE, Mead P, Pesik NT, Petersen LR. 2016. Interim guidelines for prevention of sexual transmission of Zika virus—United States, 2016. MMWR Morb Mortal Wkly Rep 65:120–121. doi: 10.15585/mmwr.mm6505e1. [DOI] [PubMed] [Google Scholar]
  • 82.Gubler DJ. 1998. Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 11:480–496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Powers AM. 2009. Overview of emerging arboviruses. Future Virol 4:391–401. doi: 10.2217/fvl.09.19. [DOI] [Google Scholar]
  • 84.Tsetsarkin KA, Vanlandingham DL, McGee CE, Higgs S. 2007. A single mutation in chikungunya virus affects vector specificity and epidemic potential. PLoS Pathog 3:e201. doi: 10.1371/journal.ppat.0030201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Vazeille M, Moutailler S, Coudrier D, Rousseaux C, Khun H, Huerre M, Thiria J, Dehecq J-S, Fontenille D, Schuffenecker I, Despres P, Failloux AB. 2007. Two chikungunya isolates from the outbreak of La Reunion (Indian Ocean) exhibit different patterns of infection in the mosquito, Aedes albopictus. PLoS One 2:e1168. doi: 10.1371/journal.pone.0001168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Tsetsarkin KA, Weaver SC. 2011. Sequential adaptive mutations enhance efficient vector switching by chikungunya virus and its epidemic emergence. PLoS Pathog 7:e1002412. doi: 10.1371/journal.ppat.1002412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Tsetsarkin KA, Chen R, Yun R, Rossi SL, Plante KS, Guerbois M, Forrester N, Perng GC, Sreekumar E, Leal G, Huang J, Mukhopadhyay S, Weaver SC. 2014. Multi-peaked adaptive landscape for chikungunya virus evolution predicts continued fitness optimization in Aedes albopictus mosquitoes. Nat Commun 5:4084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Bennett SN, Holmes EC, Chirivella M, Rodriguez DM, Beltran M, Vorndam V, Gubler DJ, McMillan WO. 2003. Selection-driven evolution of emergent dengue virus. Mol Biol Evol 20:1650–1658. doi: 10.1093/molbev/msg182. [DOI] [PubMed] [Google Scholar]
  • 89.Messer WB, Gubler DJ, Harris E, Sivananthan K, de Silva AM. 2003. Emergence and global spread of a dengue serotype 3, subtype III virus. Emerg Infect Dis 9:800–809. doi: 10.3201/eid0907.030038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Bennett SN, Drummond AJ, Kapan DD, Suchard MA, Muñoz-Jordán JL, Pybus OG, Holmes EC, Gubler DJ. 2010. Epidemic dynamics revealed in dengue evolution. Mol Biol Evol 27:811–818. doi: 10.1093/molbev/msp285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Steel A, Gubler DJ, Bennett SN. 2010. Natural attenuation of dengue virus type-2 after a series of island outbreaks: a retrospective phylogenetic study of events in the South Pacific three decades ago. Virology 405:505–512. doi: 10.1016/j.virol.2010.05.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Moudy RM, Meola MA, Morin LL, Ebel GD, Kramer LD. 2007. A newly emergent genotype of West Nile virus is transmitted earlier and more efficiently by Culex mosquitoes. Am J Trop Med Hyg 77:365–370. [PubMed] [Google Scholar]
  • 93.Malkinson M, Banet C, Weisman Y, Pokamunski S, King R, Drouet MT, Deubel V. 2002. Introduction of West Nile virus in the Middle East by migrating white storks. Emerg Infect Dis 8:392–397. doi: 10.3201/eid0804.010217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Brault AC, Huang CY, Langevin SA, Kinney RM, Bowen RA, Ramey WN, Panella NA, Holmes EC, Powers AM, Miller BR. 2007. A single positively selected West Nile viral mutation confers increased virogenesis in American crows. Nat Genet 39:1162–1166. doi: 10.1038/ng2097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Weaver SC, Reisen WK. 2010. Present and future arboviral threats. Antiviral Res 85:328–345. doi: 10.1016/j.antiviral.2009.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Linthicum KJ, Anyamba A, Tucker CJ, Kelley PW, Myers MF, Peters CJ. 1999. Climate and satellite indicators to forecast Rift Valley fever epidemics in Kenya. Science 285:397–400. doi: 10.1126/science.285.5426.397. [DOI] [PubMed] [Google Scholar]
  • 97.Gould EA, Higgs S. 2009. Impact of climate change and other factors on emerging arbovirus diseases. Trans R Soc Trop Med Hyg 103:109–121. doi: 10.1016/j.trstmh.2008.07.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Gubler DJ. 1988. Resurgent vector-borne diseases as a global health problem. Emerg Infect Dis 4:442–450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Himeidan YE, Kweka EJ, Mahgoub MM, El Rayah EA, Ouma JO. 2014. Recent outbreaks of rift valley fever in East Africa and the Middle East. Front Public Health 2:169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Erlanger TE, Weiss S, Keiser J, Utzinger J, Wiedenmayer K. 2009. Past, present, and future of Japanese encephalitis. Emerg Infect Dis 15:1–7. doi: 10.3201/eid1501.080311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Delaunay P, Jeannin C, Schaffner F, Marty P. 2009. News on the presence of the tiger mosquito Aedes albopictus in metropolitan France. Arch Pediatr 16(Suppl 2):S66–S71. (In French.) doi: 10.1016/S0929-693X(09)75304-7. [DOI] [PubMed] [Google Scholar]
  • 102.La Ruche G, Souarès Y, Armengaud A, Peloux-Petiot F, Delaunay P, Desprès P, Lenglet A, Jourdain F, Leparc-Goffart I, Charlet F, Ollier L, Mantey K, Mollet T, Fournier JP, Torrents R, Leitmeyer K, Hilairet P, Zeller H, Van Bortel W, Dejour-Salamanca D, Grandadam M, Gastellu-Etchegorry M. 2010. First two autochthonous dengue virus infections in metropolitan France, September 2010. Euro Surveill 15:19676. [PubMed] [Google Scholar]
  • 103.Weaver SC. 2005. Host range, amplification and arboviral disease emergence. Arch Virol Suppl 19:33–44. [DOI] [PubMed] [Google Scholar]
  • 104.Gubler DJ. 2011. Dengue, urbanization and globalization: the unholy trinity of the 21st century. Trop Med Health 39:3–11. doi: 10.2149/tmh.2010-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Kilpatrick AM, Randolph SE. 2012. Drivers, dynamics, and control of emerging vector-borne zoonotic diseases. Lancet 380:1946–1955. doi: 10.1016/S0140-6736(12)61151-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 106.Weaver SC, Vasilakis N. 2009. Molecular evolution of dengue viruses: contributions of phylogenetics to understanding the history and epidemiology of the preeminent arboviral disease. Infect Genet Evol 9:523–540. doi: 10.1016/j.meegid.2009.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Vasilakis N, Cardosa J, Hanley KA, Holmes EC, Weaver SC. 2011. Fever from the forest: prospects for the continued emergence of sylvatic dengue virus and its impact on public health. Nat Rev Microbiol 9:532–541. doi: 10.1038/nrmicro2595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 108.Dick GW. 1953. Epidemiological notes on some viruses isolated in Uganda (yellow fever, Rift Valley fever, Bwamba fever, West Nile, Mengo, Semliki Forest, Bunyamwera, Ntaya, Uganda S and Zika viruses). Trans R Soc Trop Med Hyg 47:13–48. doi: 10.1016/0035-9203(53)90021-2. [DOI] [PubMed] [Google Scholar]
  • 109.Smithburn K, Haddow AJ, Lumsden WH. 1949. An outbreak of sylvan yellow fever in Uganda with Aedes (Stegomyia) africanus Theobald as principal vector and insect host of the virus. Ann Trop Med Parasitol 43:74–89. [DOI] [PubMed] [Google Scholar]
  • 110.Brès P. 1970. Recent data from serological surveys on the prevalence of arbovirus infections in Africa, with special reference to yellow fever. Bull World Health Organ 43:223–267. (In French.) [PMC free article] [PubMed] [Google Scholar]
  • 111.Smithburg KC, Hughes TP, Burke AW, Paul JH. 1940. A neurotropic virus isolated from the blood of a native of Uganda. Am J Trop Med Hyg 20:471–472. [Google Scholar]
  • 112.Smithburn KC, Mahaffy AF, Paul JH. 1941. Bwamba fever and its causative virus. Am J Trop Med Hyg 21:75–90. [Google Scholar]
  • 113.Smithburn KC, Haddow AJ. 1944. Semliki Forest virus. I. Isolation and pathogenic properties. J Immunol 49:141–157. [Google Scholar]
  • 114.Smithburn KC, Haddow AJ, Mahaffy AF. 1946. A neurotropic virus isolated from Aedes mosquitoes caught in the Semliki Forest. Am J Trop Med Hyg 26:189–208. [DOI] [PubMed] [Google Scholar]
  • 115.Smithburn KC, Haddow AJ. 1951. Ntaya virus; a hitherto unknown agent isolated from mosquitoes collected in Uganda. Proc Soc Exp Biol Med 77:130–133. doi: 10.3181/00379727-77-18700. [DOI] [PubMed] [Google Scholar]
  • 116.Dick GW, Haddow AJ. 1952. Uganda S virus; a hitherto unrecorded virus isolated from mosquitoes in Uganda. I. Isolation and pathogenicity. Trans R Soc Trop Med Hyg 46:600–618. doi: 10.1016/0035-9203(52)90021-7. [DOI] [PubMed] [Google Scholar]
  • 117.Dick GW. 1952. Zika virus. II. Pathogenicity and physical properties Trans R Soc Trop Med Hyg 46:521–534. [DOI] [PubMed] [Google Scholar]
  • 118.Kerr JA. 1952. Studies on certain viruses isolated in the tropics of Africa and South America; immunological reactions as determined by cross complement-fixation tests. J Immunol 68:461–472. [PubMed] [Google Scholar]
  • 119.Olson JG, Ksiazek TG, Suhandiman, Triwibowo. 1981. Zika virus, a cause of fever in central Java, Indonesia. Trans R Soc Trop Med Hyg 75:389–393. doi: 10.1016/0035-9203(81)90100-0. [DOI] [PubMed] [Google Scholar]
  • 120.Kokernot RH, Casaca VM, Weinbren MP, McIntosh BM. 1965. Survey for antibodies against arthropod-borne viruses in the sera of indigenous residents of Angola. Trans R Soc Trop Med Hyg 59:563–570. doi: 10.1016/0035-9203(65)90159-8. [DOI] [PubMed] [Google Scholar]
  • 121.Darwish MA, Hoogstraal H, Roberts TJ, Ahmed IP, Omar F. 1983. A sero-epidemiological survey for certain arboviruses (Togaviridae) in Pakistan. Trans R Soc Trop Med Hyg 77:442–445. doi: 10.1016/0035-9203(83)90106-2. [DOI] [PubMed] [Google Scholar]
  • 122.Chippaux-Hyppolite C, Chippaux A, Hannoun C. 1965. Immunologic investigation on the frequency of arbovirus in man in the Central African Republic. Preliminary note. Bull Soc Pathol Exot Filiales 58:812–820. (In French.) [PubMed] [Google Scholar]
  • 123.Aubry M, Finke J, Teissier A, Roche C, Broult J, Paulous S, Desprès P, Cao-Lormeau VM, Musso D. 2015. Seroprevalence of arboviruses among blood donors in French Polynesia, 2011–2013. Int J Infect Dis 41:11–12. doi: 10.1016/j.ijid.2015.10.005. [DOI] [PubMed] [Google Scholar]
  • 124.Clarke DH, Casals J. 1958. Techniques for hemagglutination and hemagglutination-inhibition with arthropod-borne viruses. Am J Trop Med Hyg 7:561–573. [DOI] [PubMed] [Google Scholar]
  • 125.Fagbami AH. 1979. Zika virus infections in Nigeria: virological and seroepidemiological investigations in Oyo State. J Hyg (Lond) 83:213–219. doi: 10.1017/S0022172400025997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 126.Kirya BG, Okia NO. 1977. A yellow fever epozootic in Zika Forest, Uganda, during 1972: part 2: monkey serology. Trans R Soc Trop Med Hyg 71:300–303. doi: 10.1016/0035-9203(77)90104-3. [DOI] [PubMed] [Google Scholar]
  • 127.Simpson DI. 1964. Zika virus infection in man. Trans R Soc Trop Med Hyg 58:335–338. doi: 10.1016/0035-9203(64)90200-7. [DOI] [PubMed] [Google Scholar]
  • 128.Mettler NE, Clarke DH, Casals J. 1971. Hemagglutination inhibition with arboviruses: relationship between titers and source of erythrocytes. Appl Microbiol 22:377–379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 129.Jan C, Languillat G, Renaudet J, Robin Y. 1978. A serological survey of arboviruses in Gabon. Bull Soc Pathol Exot Filiales 71:140–146. (In French.) [PubMed] [Google Scholar]
  • 130.Smithburn KC, Kokernot RH, Heymann CS, Weinbren MP, Zentkowsky D. 1959. Neutralizing antibodies for certain viruses in the sera of human beings residing in northern Natal. S Afr Med J 33:555–561. [PubMed] [Google Scholar]
  • 131.Dickinson DB, McGillivray GM, McIntosh BM, Winter PA. 1965. Antibodies against certain arboviruses in sera from human beings and domestic animals from the south-western and north-western regions of the Cape Province of South Africa. S Afr J Med Sci 30:11–18. [PubMed] [Google Scholar]
  • 132.Savage HM, Fritz CL, Rutstein D, Yolwa A, Vorndam V, Gubler DJ. 1998. Epidemic of dengue-4 virus in Yap State, Federated States of Micronesia, and implication of Aedes hensilli as an epidemic vector. Am J Trop Med Hyg 58:519–524. [DOI] [PubMed] [Google Scholar]
  • 133.Durand MA, Bel M, Ruwey I, Marfel M, Yug L, Ngaden V. 2005. An outbreak of dengue fever in Yap State. Pac Health Dialog 12:99–102. [PubMed] [Google Scholar]
  • 134.ProMED-mail. 2 July 2007. Zika virus outbreak—Micronesia (Yap) (02): confirmed. ProMED-mail archive no. 20070702.2108. http://www.promedmail.org Accessed 12 September 2015.
  • 135.Lanciotti RS, Kosoy OL, Laven JJ, Velez JO, Lambert AJ, Johnson AJ, Stanfield SM, Duffy MR. 2008. Genetic and serologic properties of Zika virus associated with an epidemic, Yap State, Micronesia, 2007. Emerg Infect Dis 14:1232–1239. doi: 10.3201/eid1408.080287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 136.Laigret J, Rosen L, Scholammer G. 1964. On an epidemic of dengue occurring in Tahiti in 1964. Relations to the “hemorrhagic fevers” of Southeast Asia. Bull Soc Pathol Exot Filiales 60:339–353. (In French.) [PubMed] [Google Scholar]
  • 137.Cao-Lormeau VM, Roche C, Musso D, Mallet HP, Dalipande T, Dofai A, Nogareda F, Niles EJ, Aaskov J. 2014. Dengue virus type-3, South Pacific islands, 2013. Emerg Infect Dis 20:1034–1036. doi: 10.3201/eid2006.131413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 138.Cao-Lormeau V-M, Roche C, Aubry M, Teissier A, Lastere S, Daudens E, Mallet H-P, Musso D, Aaskov J. 2011. Recent emergence of dengue virus serotype 4 in French Polynesia results from multiple introductions from other South Pacific islands. PLoS One 6:e29555. doi: 10.1371/journal.pone.0029555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 139.Aubry M, Finke J, Teissier A, Roche C, Broult J, Paulous S, Desprès P, Cao-Lormeau VM, Musso D. 2015. Silent circulation of Ross River virus in French Polynesia. Int J Infect Dis 37:19–24. doi: 10.1016/j.ijid.2015.06.005. [DOI] [PubMed] [Google Scholar]
  • 140.Musso D, Roche C, Nhan TX, Robin E, Teissier A, Cao-Lormeau VM. 2015. Detection of Zika virus in saliva. J Clin Virol 68:53–55. doi: 10.1016/j.jcv.2015.04.021. [DOI] [PubMed] [Google Scholar]
  • 141.European Centre for Disease Prevention and Control. 2014. Zika virus infection outbreak, French Polynesia. European Centre for Disease Prevention and Control, Stockholm, Sweden: http://ecdc.europa.eu/en/publications/Publications/Zika-virus-French-Polynesia-rapid-risk-assessment.pdf. [Google Scholar]
  • 142.Aubry A, Teissier A, Roche C, Teururai S, Paulous S, Desprès P, Musso D, Mallet HP, Merceron S, Huart M, Sicard S, Deparis X, Cao-Lormeau VM. 2015. Serosurvey of dengue, Zika and other mosquito-borne viruses in French Polynesia, abstr 765 64th Annual Meeting of the American Society of Tropical Medicine and Hygiene, Philadelphia, PA, 25 to 29 October 2015. [Google Scholar]
  • 143.ProMED-mail. 3 December 2013. Zika virus—New Caledonia (02) ex French Polynesia. ProMED-mail archive no. 20131203.2089681. http://www.promedmail.org Accessed 12 September 2015.
  • 144.Dupont-Rouzeyrol M, O'Connor O, Calvez E, Daurès M, John M, Grangeon JP, Gourinat AC. 2015. Co-infection with Zika and dengue viruses in 2 patients, New Caledonia, 2014. Emerg Infect Dis 21:381–382. doi: 10.3201/eid2102.141553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 145.Gourinat AC, O'Connor O, Calvez E, Goarant C, Dupont-Rouzeyrol M. 2015. Detection of Zika virus in urine. Emerg Infect Dis 21:84–86. doi: 10.3201/eid2101.140894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 146.Vandenbogaert M, Cao-Lormeau V-M, Diancourt L, Thiberge J-M, Sall A, Kwasiborski A, Musso D, Desprès P, Manuguerra J-C, Caro V. 2014. Full-length genome sequencing and analysis of 3 ZIKV strains on an Ion Torrent PGM sequencer, abstr 22.133. 63rd Am Soc Trop Med Hyg (ASTMH) Meet, New Orleans, LA, 2 to 6 November 2014. [Google Scholar]
  • 147.European Centre for Disease Prevention and Control. 2014. Monitoring current threats: ECDC Communicable Disease Threats Report (CTDR), week 11/2014. European Centre for Disease Prevention and Control, Stockholm, Sweden. [Google Scholar]
  • 148.World Health Organization. 2014. Dengue Pacific situation update 26 February 2014. World Health Organization Western Pacific Region, Manila, Philippines: http://www.wpro.who.int/emerging_diseases/Dengue.26Feb2014.pdf?ua=1. [Google Scholar]
  • 149.Tognarelli J, Ulloa S, Villagra E, Lagos J, Aguayo C, Fasce R, Parra B, Mora J, Becerra N, Lagos N, Vera L, Olivares B, Vilches M, Fernández J. 2016. A report on the outbreak of Zika virus on Easter Island, South Pacific, 2014. Arch Virol 161:665–668. doi: 10.1007/s00705-015-2695-5. [DOI] [PubMed] [Google Scholar]
  • 150.Musso D. 2015. Zika virus transmission from French Polynesia to Brazil. Emerg Infect Dis 21:1887. doi: 10.3201/eid2110.151125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 151.Canals M, González C, Canals A, Figueroa D. 2012. Epidemiological dynamics of dengue on Easter Island. Rev Chilena Infectol 29:388–394. (In Spanish.) doi: 10.4067/S0716-10182012000400004. [DOI] [PubMed] [Google Scholar]
  • 152.Perret C, Abarca K, Ovalle J, Ferrer P, Godoy P, Olea A, Aguilera X, Ferrés M. 2003. Dengue-1 virus isolation during first dengue fever outbreak on Easter Island, Chile. Emerg Infect Dis 9:1465–1467. doi: 10.3201/eid0911.020788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 153.Derraik JG, Slaney D. 2015. Notes on Zika virus—an emerging pathogen now present in the South Pacific. Aust N Z J Public Health 39:5–7. doi: 10.1111/1753-6405.12302. [DOI] [PubMed] [Google Scholar]
  • 154.Roth A, Mercier A, Lepers C, Hoy D, Duituturaga S, Benyon E, Guillaumot L, Souares Y. 2014. Concurrent outbreaks of dengue, chikungunya and Zika virus infections—an unprecedented epidemic wave of mosquito-borne viruses in the Pacific 2012–2014. Euro Surveill 19:20929 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20929. [DOI] [PubMed] [Google Scholar]
  • 155.Nhan TX, Musso D. 2015. Emergence du virus Zika. Virologie 19:225–235. (In French.) [DOI] [PubMed] [Google Scholar]
  • 156.Rodriguez-Morales AJ. 2015. Zika: the new arbovirus threat for Latin America. J Infect Dev Ctries 9:684–685. doi: 10.3855/jidc.7230. [DOI] [PubMed] [Google Scholar]
  • 157.Martinez-Pulgarin DF, Acevedo-Mendoza WF, Cardona-Ospina JA, Rodríguez-Morales AJ, Paniz-Mondolfi AE. 2016. A bibliometric analysis of global Zika research. Travel Med Infect Dis 14:55–57. doi: 10.1016/j.tmaid.2015.07.005. [DOI] [PubMed] [Google Scholar]
  • 158.Brown C. 2016. Zika virus outbreaks in Asia and South America. CMAJ 188:E34. doi: 10.1503/cmaj.109-5212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 159.Dyer O. 2015. Zika virus spreads across Americas as concerns mount over birth defects. BMJ 351:h6983. doi: 10.1136/bmj.h6983. [DOI] [PubMed] [Google Scholar]
  • 160.Gautret P, Simon F. 2016. Dengue, chikungunya and Zika and mass gatherings: what happened in Brazil, 2014. Travel Med Infect Dis 14:7–8. doi: 10.1016/j.tmaid.2015.12.004. [DOI] [PubMed] [Google Scholar]
  • 161.Attar N. 2016. Zika virus circulates in new regions. Nat Rev Microbiol 14:62. doi: 10.1038/nrmicro.2015.28.26751510 [DOI] [Google Scholar]
  • 162.Bogoch II, Brady OJ, Kraemer MUG, German M, Creatore MI, Kulkarni MA, Brownstein JS, Mekaru SR, Hay SI, Groot E, Watts A, Khan K. 2016. Anticipating the international spread of Zika virus from Brazil. Lancet 387:335–336. doi: 10.1016/S0140-6736(16)00080-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 163.Gatherer D, Kohl A. 2016. Zika virus: a previously slow pandemic spreads rapidly through the Americas. J Gen Virol 97:269–273. doi: 10.1099/jgv.0.000381. [DOI] [PubMed] [Google Scholar]
  • 164.Marcondes CB, Ximenes M de FF de M. 22 December 2015. Zika virus in Brazil and the danger of infestation by Aedes (Stegomyia) mosquitoes. Rev Soc Bras Med Trop doi: 10.1590/0037-8682-0220-2015. [DOI] [PubMed] [Google Scholar]
  • 165.Chen LH, Hamer DH. 2 February 2016. Zika virus: rapid spread in the Western Hemisphere. Ann Intern Med doi: 10.7326/M16-0150. [DOI] [PubMed] [Google Scholar]
  • 166.Samarasekera U, Triunfol M. 2016. Concern over Zika virus grips the world. Lancet 387:521–524. doi: 10.1016/S0140-6736(16)00257-9. [DOI] [PubMed] [Google Scholar]
  • 167.Fauci AS, Morens DM. 2016. Zika virus in the Americas—yet another arbovirus threat. N Engl J Med 374:601–604. doi: 10.1056/NEJMp1600297. [DOI] [PubMed] [Google Scholar]
  • 168.Triunfol M. 2016. A new mosquito-borne threat to pregnant women in Brazil. Lancet Infect Dis 16:156–157. doi: 10.1016/S1473-3099(15)00548-4. [DOI] [PubMed] [Google Scholar]
  • 169.Cardoso CW, Paploski IA, Kikuti M, Rodrigues MS, Silva MM, Campos GS, Sardi SI, Kitron U, Reis MG, Ribeiro GS. 2015. Outbreak of exanthematous illness associated with Zika, chikungunya, and dengue viruses, Salvador, Brazil. Emerg Infect Dis 21:2274–2276. doi: 10.3201/eid2112.151167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 170.ProMED-mail. 1 May 2015. Undiagnosed illness—Brazil (northeast, Rio de Jeineiro): Zika virus suspected, request for information. ProMED-mail archive no. 20150501.3334749. http://www.promedmail.org Accessed 10 November 2015.
  • 171.Pan American Health Organization. 2015. Epidemiological alert. Zika virus infection. 7 May 2015 Pan American Health Organization, Washington, DC: http://www.paho.org/hq/index.php?option=com_docman&task=doc_view&Itemid=270&gid=30075. [Google Scholar]
  • 172.ProMED-mail. 15 May 2015. Undiagnosed illness—Brazil (02): Zika virus confirmed. ProMED-mail archive no. 20150515.3364149. http://www.promedmail.org Accessed 10 November 2015.
  • 173.ProMED-mail. 12 June 2015. Zika virus—Brazil (05). ProMED-mail archive no. 20150612.3431148. http://www.promedmail.org Accessed 12 September 2015.
  • 174.ProMED-mail. 3 September 2015. Zika virus—Brazil (11) (Alagoas). ProMED-mail archive no. 20150903.3621836. http://www.promedmail.org Accessed 12 September 2015.
  • 175.ProMED-mail. 14 October 2015. Zika virus—Brazil (13) (Mato Grosso, Alagoas). ProMED-mail archive no. 20151014.3714950. http://www.promedmail.org Accessed 24 October 2015.
  • 176.ProMED-mail. 19 June 2015. Zika virus—Brazil (06) (Bahia). ProMED-mail archive no. 20150619.3449500. http://www.promedmail.org Accessed 1 February 2016.
  • 177.ProMED-mail. 30 June 2015. Zika virus—Brazil (07). ProMED-mail archive no. 20150630.3473420. http://www.promedmail.org Accessed 12 September 2015.
  • 178.ProMED-mail. 21 September 2015. Zika virus Brazil (12) (Mato Grosso). ProMED-mail archive no. 20150921.3660532. http://www.promedmail.org Accessed 24 October 2015.
  • 179.Pan American Health Organization. 2015. Epidemiological update. Zika virus infection. 16 October 2015 Pan American Health Organization, Washington, DC: http://www.paho.org/hq/index.php?option=com_docman&task=doc_view&Itemid=270&gid=32021&lang=en. [Google Scholar]
  • 180.ProMED-mail. 16 July 2015. Zika virus—Brazil (08). ProMED-mail archive no. 20150716.3513770. http://www.promedmail.org Accessed 24 October 2015.
  • 181.ProMED-mail. 30 August 2015. Zika virus—Brazil (10) (Parana). ProMED-mail archive no. 20150830.3611318. http://www.promedmail.org Accessed 12 September 2015.
  • 182.ProMED-mail. 23 July 2015. Zika virus—Brazil (09): confirmed, Guatemala suspected. ProMED-mail archive no. 20150723.3531482. http://www.promedmail.org Accessed 12 September 2015.
  • 183.ProMED-mail. 8 June 2015. Zika virus—Brazil (04) (Rio de Janeiro). ProMED-mail archive no. 20150608.3420363. http://www.promedmail.org Accessed 12 September 2015.
  • 184.ProMED-mail. 4 June 2015. Zika virus—Brazil (03) (Roraima). ProMED-mail archive no. 20150604.3408349. http://www.promedmail.org Accessed 12 September 2015.
  • 185.ProMED-mail. 24 May 2015. Zika virus—Brazil (02) (Sao Paulo). ProMED-mail archive no. 20150524.3382529. http://www.promedmail.org Accessed 12 September 2015.
  • 186.Nogueira RM, de Araújo JM, Schatzmayr HG. 2007. Dengue viruses in Brazil, 1986–2006. Rev Panam Salud Publica 22:358–363. doi: 10.1590/S1020-49892007001000009. [DOI] [PubMed] [Google Scholar]
  • 187.Villabona-Arenas CJ, de Oliveira JL, Capra Cde S, Balarini K, Loureiro M, Fonseca CR, Passos SD, Zanotto PM. 2014. Detection of four dengue serotypes suggests rise in hyperendemicity in urban centers of Brazil. PLoS Negl Trop Dis 8:e2620. doi: 10.1371/journal.pntd.0002620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 188.Mourão MP, Bastos MDS, Figueiredo RM, Gimaque JB, Alves VDC, Saraiva MD, Figueiredo ML, Ramasawmy R, Nogueira ML, Figueiredo LT. 2015. Arboviral diseases in the western Brazilian Amazon: a perspective and analysis from a tertiary health & research center in Manaus, State of Amazonas. Rev Soc Bras Med Trop 48(Suppl 1):S20–S26. doi: 10.1590/0037-8682-0133-2013. [DOI] [PubMed] [Google Scholar]
  • 189.Nunes MR, Faria NR, de Vasconcelos JM, Golding N, Kraemer MU, de Oliveira LF, Azevedo Rdo S, da Silva DE, da Silva EV, da Silva EP, Carvalho VL, Coelho GE, Cruz AC, Rodrigues SG, Vianez JL Jr, Nunes BT, Cardoso JF, Tesh RB, Hay SI, Pybus OG, Vasconcelos PF. 2015. Emergence and potential for spread of chikungunya virus in Brazil. BMC Med 13:102. doi: 10.1186/s12916-015-0348-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 190.Teixeira MG, Andrade AM, Costa Mda C, Castro JN, Oliveira FL, Goes CB, Maia M, Santana EB, Nunes BT, Vasconcelos PF. 2015. East/Central/South African genotype chikungunya virus, Brazil, 2014. Emerg Infect Dis J 21:906–907. doi: 10.3201/eid2105.141727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 191.Vega-Rúa A, Zouache K, Girod R, Failloux AB, Lourenço-de-Oliveira R. 2014. High level of vector competence of Aedes aegypti and Aedes albopictus from ten American countries as a crucial factor in the spread of chikungunya virus. J Virol 88:6294–6306. doi: 10.1128/JVI.00370-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 192.Coelho GE. 2012. Challenges in the control of Aedes aegypti. Rev Inst Med Trop Sao Paulo 54(Suppl 1):S13–S14. [DOI] [PubMed] [Google Scholar]
  • 193.Carvalho RG, Lourenço-de-Oliveira R, Braga IA. 2014. Updating the geographical distribution and frequency of Aedes albopictus in Brazil with remarks regarding its range in the Americas. Mem Inst Oswaldo Cruz 109:787–796. doi: 10.1590/0074-0276140304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 194.Salvador FS, Fujita DM. 2016. Entry routes for Zika virus in Brazil after 2014 World Cup: new possibilities. Travel Med Infect Dis 14:49–51. doi: 10.1016/j.tmaid.2015.10.004. [DOI] [PubMed] [Google Scholar]
  • 195.ProMED-mail. 18 October 2015. Zika virus—Colombia. ProMED-mail archive no. 20151018.3723954. http://www.promedmail.org Accessed 10 November 2015.
  • 196.Camacho E, Paternina-Gomez M, Blanco PJ, Osorio PE, Aliota MT. 2 February 2016. Detection of autochthonous Zika virus transmission in Sincelejo, Colombia. Emerg Infect Dis (Letter.) doi: 10.3201/eid2205.160023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 197.ProMED-mail. 2 November 2015. Zika virus—Colombia (03). ProMED-mail archive no. 20151102.3760111. http://www.promedmail.org Accessed 1 February 2016.
  • 198.ProMED-mail. 30 October 2015. Zika virus—Colombia (02). ProMED-mail archive no. 20151030.3756619. http://www.promedmail.org Accessed 30 November 2015.
  • 199.ProMED-mail. 8 November 2015. Zika virus—Colombia (04) (Atlantico) suspected. ProMED-mail archive no. 20151108.3775023. http://www.promedmail.org Accessed 1 February 2016.
  • 200.ProMED-mail. 11 November 2015. Zika virus—Colombia (05). ProMED-mail archive no. 20151108.3775023. http://www.promedmail.org Accessed 1 February 2016.
  • 201.ProMED-mail. 13 November 2015. Zika virus—Colombia (06). ProMED-mail archive no. 20151113.3788787. http://www.promedmail.org Accessed 1 February 2016.
  • 202.ProMED-mail. 20 November 2015. Zika virus—Colombia (07). ProMED-mail archive no. 20151120.3807205. http://www.promedmail.org Accessed 1 February 2016.
  • 203.ProMED-mail. 21 November 2015. Zika virus—Colombia (08). ProMED-mail archive no. 20151121.3808431. http://www.promedmail.org Accessed 1 February 2016.
  • 204.Sabogal-Roman JA, Murillo-García DR, Yepes-Echeverri MC, Restrepo-Mejia JD, Granados-Álvarez S, Paniz-Mondolfi AE, Villamil-Gómez WE, Zapata-Cerpa DC, Barreto-Rodriguez K, Rodríguez-Morales AJ. 2016. Healthcare students and workers' knowledge about transmission, epidemiology and symptoms of Zika fever in four cities of Colombia. Travel Med Infect Dis 14:52–54. doi: 10.1016/j.tmaid.2015.12.003. [DOI] [PubMed] [Google Scholar]
  • 205.ProMED-mail. 25 November 2015. Zika virus update: Guatemala, Mexico ex Colombia. ProMED-mail archive no. 20151125.3818813. http://www.promedmail.org Accessed 1 February 2016.
  • 206.ProMED-mail. 23 December 2015. Zika virus—Americas, Atlantic Ocean. ProMED-mail archive no. 20151223.3886435. http://www.promedmail.org Accessed 1 February 2016.
  • 207.ProMED-mail. 27 November 2015. ZIka virus—Americas (02). ProMED-mail archive no. 20151127.3824009. http://www.promedmail.org Archive Number: 20151127.3824009.
  • 208.ProMED-mail. 11 December 2015. Zika virus—Americas (04). ProMED-mail archive no. 20151211.3855107. http://www.promedmail.org Accessed 1 February 2016.
  • 209.ProMED-mail. 28 January 2016. Zika virus—America, Asia. ProMED-mail archive no. 20160128.3974426. http://www.promedmail.org Accessed 1 February 2016.
  • 210.ProMED-mail. 31 December 2015. Zika virus America (05). ProMED-mail archive no. 20151231.3902686. http://www.promedmail.org Accessed 1 February 2016.
  • 211.ProMED-mail. 8 January 2016. Zika virus—Americas. ProMED-mail archive no. 20160108.3921447. http://www.promedmail.org Accessed 1 February 2016.
  • 212.Franco L, Di Caro A, Carletti F, Vapalahti O, Renaudat C, Zeller H, Tenorio A. 2010. Recent expansion of dengue virus serotype 3 in West Africa. Euro Surveill 15:19490 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19490. [PubMed] [Google Scholar]
  • 213.Tappe D, Rissland J, Gabriel M, Emmerich P, Günther S, Held G, Smola S, Schmidt-Chanasit J. 2014. First case of laboratory-confirmed Zika virus infection imported into Europe. Euro Surveill 19:20685 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20685. [DOI] [PubMed] [Google Scholar]
  • 214.Tappe D, Nachtigall S, Kapaun A, Schnitzler P, Günther S, Schmidt-Chanasit J. 2015. Acute Zika virus infection after travel to Malaysian Borneo, September 2014. Emerg Infect Dis 21:911–913. doi: 10.3201/eid2105.141960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 215.Bonizzoni M, Gasperi G, Chen X, James AA. 2013. The invasive mosquito species Aedes albopictus: current knowledge and future perspectives. Trends Parasitol 29:460–468. doi: 10.1016/j.pt.2013.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 216.Baronti C, Piorkowski G, Charrel RN, Boubis L, Leparc-Goffart I, de Lamballerie X. 2014. Complete coding sequence of Zika virus from a French Polynesia outbreak in 2013. Genome Announc 2:e00500-14. doi: 10.1128/genomeA.00500-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 217.Ameline M, Nicolas X, Hérault M, Dupuy Fonclare AL, Le Guen P, Leparc-Goffart I, Schoenlaub P. 2014. Dermatologic manifestations of Zika fever, about 2 cases. Ann Dermatol Vénérol 141:S447 (In French.) [Google Scholar]
  • 218.Marchand E, Prat C, Jeannin C, Lafont E, Bergmann T, Flusin O, Rizzi J, Roux N, Busso V, Deniau J, Noel H, Vaillant V, Leparc-Goffart I, Six C, Paty MC. 2013. Autochthonous case of dengue in France, October 2013. Euro Surveill 18:20661 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20661. [DOI] [PubMed] [Google Scholar]
  • 219.Grandadam M, Caro V, Plumet S, Thiberge JM, Souarès Y, Failloux AB, Tolou HJ, Budelot M, Cosserat D, Leparc-Goffart I, Desprès P. 2011. Chikungunya virus, southeastern France. Emerg Infect Dis 17:910–913. doi: 10.3201/eid1705.101873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 220.European Centre for Disease Prevention and Control. 2016. Rapid risk assessment: Zika virus disease epidemic: potential association with microcephaly and Guillain-Barré syndrome. Second update, 8 February 2016 European Centre for Disease Prevention and Control, Stockholm, Sweden: http://ecdc.europa.eu/en/publications/Publications/zika-virus-rapid-risk-assessment-8-february-2016.pdf. [Google Scholar]
  • 221.Zammarchi L, Stella G, Mantella A, Bartolozzi D, Tappe D, Günther S, Oestereich L, Cadar D, Muñoz-Fontela C, Bartoloni A, Schmidt-Chanasit J. 2015. Zika virus infections imported to Italy: clinical, immunological and virological findings, and public health implications. J Clin Virol 63:32–35. doi: 10.1016/j.jcv.2014.12.005. [DOI] [PubMed] [Google Scholar]
  • 222.Zammarchi L, Tappe D, Fortuna C, Remoli ME, Gunther S, Venturi G, Bartoloni A, Schmidt-Chanasit J. 2015. Zika virus infection in a traveller returning to Europe from Brazil, March 2015. Euro Surveill 20:21153 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=21153. [DOI] [PubMed] [Google Scholar]
  • 223.Sambri V, Cavrini F, Rossini G, Pierro A, Landini MP. 2008. The 2007 epidemic outbreak of chikungunya virus infection in the Romagna region of Italy: a new perspective for the possible diffusion of tropical diseases in temperate areas? New Microbiol 31:303–304. [PubMed] [Google Scholar]
  • 224.Rezza G, Nicoletti L, Angelini R, Romi R, Finarelli A, Panning M, Cordioli P, Fortuna C, Boros S, Magurano F, Silvi G, Angelini P, Dottori M, Ciufolini M, Majori G, Cassone A, CHIKV Study Group. 2007. Infection with chikungunya virus in Italy: an outbreak in a temperate region. Lancet 370:1840–1846. doi: 10.1016/S0140-6736(07)61779-6. [DOI] [PubMed] [Google Scholar]
  • 225.Angelini R, Finarelli AC, Angelini P, Po C, Petropulacos K, Macini P, Fiorentini C, Fortuna C, Venturi G, Romi R, Majori G, Nicoletti L, Rezza G, Cassone A. 2007. An outbreak of chikungunya fever in the Province of Ravenna, Italy. Euro Surveill 12:E070906.1 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=3260. [DOI] [PubMed] [Google Scholar]
  • 226.Delbue S, Ferrante P, Mariotto S, Zanusso G, Pavone A, Chinaglia M, L'Erario R, Monaco S, Ferrari S. 2014. Review of West Nile virus epidemiology in Italy and report of a case of West Nile virus encephalitis. J Neurovirol 20:437–441. doi: 10.1007/s13365-014-0276-0. [DOI] [PubMed] [Google Scholar]
  • 227.Di Sabatino D, Bruno R, Sauro F, Danzetta ML, Cito F, Iannetti S, Narcisi V, De Massis F, Calistri P. 2014. Epidemiology of West Nile disease in Europe and in the Mediterranean Basin from 2009 to 2013. Biomed.Res Int 2014:907852. doi: 10.1155/2014/907852. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 228.Knudsen AB, Romi R, Majori G. 1996. Occurrence and spread in Italy of Aedes albopictus, with implications for its introduction into other parts of Europe. J Am Mosq Control Assoc 12:177–183. [PubMed] [Google Scholar]
  • 229.Medlock JM, Hansford KM, Schaffner F, Versteirt V, Hendrickx G, Zeller H, Van Bortel W. 2012. A review of the invasive mosquitoes in Europe: ecology, public health risks, and control options. Vector Borne Zoonotic Dis 12:435–447. doi: 10.1089/vbz.2011.0814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 230.Wæhre T, Maagard A, Tappe D, Cadar D, Schmidt-Chanasit J. 2014. Zika virus infection after travel to Tahiti, December 2013. Emerg Infect Dis 20:1412–1414. doi: 10.3201/eid2008.140302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 231.Collantes F, Delacour S, Alarcón-Elbal PM, Ruiz-Arrondo I, Delgado JA, Torrell-Sorio A, Bengoa M, Eritja R, Miranda MÁ, Molina R, Lucientes J. 2015. Review of ten-years presence of Aedes albopictus in Spain 2004–2014: known distribution and public health concerns. Parasit Vectors 8:655. doi: 10.1186/s13071-015-1262-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 232.Foy BD, Kobylinski KC, Chilson Foy JL, Blitvich BJ, Travassos da Rosa A, Haddow AD, Lanciotti RS, Tesh RB. 2011. Probable non-vector-borne transmission of Zika virus, Colorado, USA. Emerg Infect Dis 17:880–882. doi: 10.3201/eid1705.101939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 233.Brust KB, Prince WS, Fader RC. 2014. Trouble in paradise. IDCases 1:95–96. doi: 10.1016/j.idcr.2014.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 234.Summers DJ, Acosta RW, Acosta AM. 2015. Zika virus in an American recreational traveler. J Travel Med 5:338–340. doi: 10.1111/jtm.12208. [DOI] [PubMed] [Google Scholar]
  • 235.McCarthy M. 2016. First US case of Zika virus infection is identified in Texas. BMJ 352:i212. doi: 10.1136/bmj.i212. [DOI] [PubMed] [Google Scholar]
  • 236.Champion SR, Vitek CJ. 2014. Aedes aegypti and Aedes albopictus habitat preferences in South Texas, USA. Environ Health Insights 8:35–42. doi: 10.4137/EHI.S16004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 237.Murray KO, Rodriguez LF, Herrington E, Kharat V, Vasilakis N, Walker C, Turner C, Khuwaja S, Arafat R, Weaver SC, Martinez D, Kilborn C, Bueno R, Reyna M. 2013. Identification of dengue fever cases in Houston, Texas, with evidence of autochthonous transmission between 2003 and 2005. Vector Borne Zoonotic Dis 13:835–845. doi: 10.1089/vbz.2013.1413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 238.Moore CG, Mitchell CJ. 1997. Aedes albopictus in the United States: ten-year presence and public health implications. Emerg Infect Dis 3:329–334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 239.Radke EG, Gregory CJ, Kintziger KW, Sauber-Schatz EK, Hunsperger EA, Gallagher GR, Barber JM, Biggerstaff BJ, Stanek DR, Tomashek KM, Blackmore CG. 2012. Dengue outbreak in Key West, Florida, USA, 2009. Emerg Infect Dis 18:135–137. doi: 10.3201/eid1801.110130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 240.Effler PV, Pang L, Kitsutani P, Vorndam V, Nakata M, Ayers T, Elm J, Tom T, Reiter P, Rigau-Perez JG, Hayes JM, Mills K, Napier M, Clark GG, Gubler DJ, Hawaii Dengue Outbreak Investigation Team. 2005. Dengue fever, Hawaii, 2001–2002. Emerg Infect Dis 11:742–729. doi: 10.3201/eid1105.041063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 241.Fonseca K, Meatherall B, Zarra D, Drebot M, MacDonald J, Pabbaraju K, Wong S, Webster P, Lindsay R, Tellier R. 2014. First case of Zika virus infection in a returning Canadian traveler. Am J Trop Med Hyg 91:1035–1038. doi: 10.4269/ajtmh.14-0151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 242.ProMED-mail. 29 May 2013. Zika virus—Canada ex Thailand. ProMED-mail archive no. 20130529.1744108. http://www.promedmail.org Accessed 12 September 2015.
  • 243.Giordano BV, Gasparotto A, Hunter FF. 2015. A checklist of the 67 mosquito species of Ontario, Canada. J Am Mosq Control Assoc 31:101–103. doi: 10.2987/14-6456R.1. [DOI] [PubMed] [Google Scholar]
  • 244.ProMED-mail. 23 August 2014. 2014. Zika virus—Japan ex Thailand. ProMED-mail archive no. 20140823.2716731. http://www.promedmail.org Accessed 12 September 2015.
  • 245.Shinohara K, Kutsuna S, Takasaki T, Moi ML, Ikeda M, Kotaki A, Yamamoto K, Fujiya Y, Mawatari M, Takeshita N, Hayakawa K, Kanagawa S, Kato Y, Ohmagari N. 2016. Zika fever imported from Thailand to Japan, and diagnosed by PCR in the urines [sic]. J Travel Med 23:tav011. doi: 10.1093/jtm/tav011. [DOI] [PubMed] [Google Scholar]
  • 246.ProMED-mail. 26 August 2014. Zika virus—Japan ex Thailand (02): comment. ProMED-mail archive no. 20140826.2725061. http://www.promedmail.org Accessed 12 September 2015.
  • 247.Kutsuna S, Kato Y, Takasaki T, Moi ML, Kotaki A, Uemeru H, Matono T, Fujiya Y, Mawatari M, Takeshita N, Hayamawa S, Kanagawa S, Ohmagari N. 2014. Two cases of Zika fever imported from French Polynesia to Japan, December 2013 to Jauary 2014 [corrected]. Euro Surveill 19:20683 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20683. [DOI] [PubMed] [Google Scholar]
  • 248.Oki M, Yamamoto T. 2013. Simulation of the probable vector density that caused the Nagasaki dengue outbreak vectored by Aedes albopictus in 1942. Epidemiol Infect 141:2612–2622. doi: 10.1017/S0950268813000447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 249.Kojima G. 2015. Autochthonous dengue fever imported to England from Japan, 2014. Emerg Infect Dis 21:182–184. doi: 10.3201/eid2101.141581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 250.World Health Organization. 2014. Pacific syndromic surveillance report. Week 36, ending 7 September, 2014 World Health Organization Western Pacific Region, Manila, Philippines. [Google Scholar]
  • 251.ProMED-mail. 9 October 2014. Zika virus—Pacific (13): New Zealand ex Cook Islands. ProMED-mail archive no. 20140910.2762121. http://www.promedmail.org Accessed 12 September 2015.
  • 252.Holder P, George S, Disbury M, Singe M, Kean JM, McFadden A. 2010. A biosecurity response to Aedes albopictus (Diptera: Culicidae) in Auckland, New Zealand. J Med Entomol 47:600–609. doi: 10.1093/jmedent/47.4.600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 253.van den Hurk AF, Hall-Mendelin S, Pyke AT, Smith GA, Mackenzie JS. 2010. Vector competence of Australian mosquitoes for chikungunya virus. Vector Borne Zoonotic Dis 10:489–495. doi: 10.1089/vbz.2009.0106. [DOI] [PubMed] [Google Scholar]
  • 254.Barber B, Denholm JT, Spelman D. 2009. Ross River virus. Aust Fam Physician 38:586–589. [PubMed] [Google Scholar]
  • 255.ProMED-mail. 12 September 2014. Zika virus—Pacific (14): New Zealand ex Cook Islands, comment. ProMED-mail archive no. 20140912.2769285. http://www.promedmail.org Accessed 12 September 2015.
  • 256.Laird M, Easton J. 1994. Aedes notoscriptus (Dipteria: Culicidae) in Wellington Province. N Z Entomol 17:14–17. [Google Scholar]
  • 257.ProMED-mail. 3 July 2007. Zika virus—Micronesia: Guam ex Yap, suspected. ProMED-mail archive no. 20070703.2115. http://www.promedmail.org Accessed 12 September 2015.
  • 258.Kiedrzynski T, Souares Y, Stewart T. 1998. Dengue situation in the Pacific: an updated story. Pac Health Dialog 5:129–136. [Google Scholar]
  • 259.Kwong JC, Druce JD, Leder K. 2013. Zika virus infection acquired during brief travel to Indonesia. Am J Trop Med Hyg 89:516–517. doi: 10.4269/ajtmh.13-0029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 260.Leung GH, Baird RW, Druce J, Anstey NM. 2015. Zika virus infection in Australia following a monkey bite in Indonesia. Southeast Asian J Trop Med Public Health 46:460–464. [PubMed] [Google Scholar]
  • 261.Pyke AT, Daly MT, Cameron JN, Moore PR, Taylor CT, Hewitson GR, Humphreys JL, Gair R. 2014. Imported Zika virus infection from the Cook Islands into Australia, 2014. PLoS Curr 6:ecurrents.outbreaks.4635a54dbffba2156fb2fd76dc49f65e. doi: 10.1371/currents.outbreaks.4635a54dbffba2156fb2fd76dc49f65e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 262.Macesis N, Abbott IJ, F JD. 2015. Photo quiz. Fever and rash in a husband and wife returning from the Cook Islands. Clin Infect Dis 61:1485–1486. doi: 10.1093/cid/civ401. [DOI] [PubMed] [Google Scholar]
  • 263.Viennet E, Ritchie SA, Faddy HM, Williams CR, Harley D. 2014. Epidemiology of dengue in a high-income country: a case study in Queensland, Australia. Parasit Vectors 7:379. doi: 10.1186/1756-3305-7-379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 264.Nicholson J, Ritchie SA, van den Hurk AF. 2014. Aedes albopictus (Diptera: Culicidae) as a potential vector of endemic and exotic arboviruses in Australia. J Med Entomol 51:661–669. doi: 10.1603/ME13204. [DOI] [PubMed] [Google Scholar]
  • 265.Buathong R, Hermann L, Thaisomboonsuk B, Rutvisuttinunt W, Klungthong C, Chinnawirotpisan P, Manasatienkij W, Nisalak A, Fernandez S, Yoon IK, Akrasewi P, Plipat T. 2015. Detection of Zika virus infection in Thailand, 2012–2014. Am J Trop Med Hyg 93:380–383. doi: 10.4269/ajtmh.15-0022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 266.Korhonen EM, Huhtamo E, Smura T, Kallio-Kokko H, Raassina M, Vapalahti O. 14 January 2016. Zika virus infection in a traveller returning from the Maldives, June 2015. Euro Surveill doi: 10.2807/1560-7917.ES.2016.21.2.30107. [DOI] [PubMed] [Google Scholar]
  • 267.Musso D, Nhan T-X. 2015. Emergence of Zika virus. Clin Microbiol 4:222. [DOI] [PubMed] [Google Scholar]
  • 268.Kuno G, Chang GJ. 2007. Full-length sequencing and genomic characterization of Bagaza, Kedougou, and Zika viruses. Arch Virol 152:687–696. doi: 10.1007/s00705-006-0903-z. [DOI] [PubMed] [Google Scholar]
  • 269.Lanciotti RS, Lambert AJ, Holodniy M, Saavedra S, del Carmen Castillo Signor L. 29 January 2016. Phylogeny of Zika virus in Western Hemisphere, 2015. Emerg Infect Dis doi: 10.3201/eid2205.160065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 270.Chambers T. 2008. Flaviviruses: general features, p 241–252. In Encyclopedia of virology, 3rd ed Acadamic Press, New York, NY. [Google Scholar]
  • 271.Haddow AD, Schuh AJ, Yasuda CY, Kasper MR, Heang V, Huy R, Guzman H, Tesh RB, Weaver SC. 2012. Genetic characterization of Zika virus strains: geographic expansion of the Asian lineage. PLoS Negl Trop Dis 6:e1477. doi: 10.1371/journal.pntd.0001477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 272.Berthet FX, Zeller HG, Drouet MT, Rauzier J, Digoutte JP, Deubel V. 1997. Extensive nucleotide changes and deletions within the envelope glycoprotein gene of Euro-African West Nile viruses. J Gen Virol 78:2293–2397. [DOI] [PubMed] [Google Scholar]
  • 273.Adams SC, Broom AK, Sammels LM, Hartnett AC, Howard MJ, Coelen RJ, Mackenzie JS, Hall RA. 1995. Glycosylation and antigenic variation among Kunjin virus isolates. Virology 206:49–56. [DOI] [PubMed] [Google Scholar]
  • 274.Aaskov J, Buzacott K, Field E, Lowry K, Berlioz-Arthaud A, Holmes EC. 2007. Multiple recombinant dengue type 1 viruses in an isolate from a dengue patient. J Gen Virol 88:3334–3340. doi: 10.1099/vir.0.83122-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 275.Nhan T-X, Cao-Lormeau VM, Musso D. 2014. Les infections à virus Zika. Rev Francoph Lab 467:45–52. (In French.) [Google Scholar]
  • 276.Calvet G, Aguiar RS, Melo AS, Sampaio SA, de Filippis I, Fabri A, Araujo ES, de Sequeira PC, de Mendonça MC, de Oliveira L, Tschoeke DA, Schrago CG, Thompson FL, Brasil P, dos Santos FB, Nogueira RM, Tanuri A, de Filippis AM. 17 February 2016. Detection and sequencing of Zika virus from amniotic fluid of fetuses with microcephaly in Brazil: a case study. Lancet Infect Dis doi: 10.1016/S1473-3099(16)00095-5. [DOI] [PubMed] [Google Scholar]
  • 277.Wolfe ND, Kilbourn AM, Karesh WB, Rahman HA, Bosi EJ, Cropp BC, Andau M, Spielman A, Gubler DJ. 2001. Sylvatic transmission of arboviruses among Bornean orangutans. Am J Trop Med Hyg 64:310–316. [DOI] [PubMed] [Google Scholar]
  • 278.Kilbourn AM, Karesh WB, Wolfe ND, Bosi EJ, Cook RA, Andau M. 2003. Health evaluation of free-ranging and semi-captive orangutans (Pongo pygmaeus pygmaeus) in Sabah, Malaysia. J Wildl Dis 39:73–83. doi: 10.7589/0090-3558-39.1.73. [DOI] [PubMed] [Google Scholar]
  • 279.Renaudet J, Jan C, Ridet J, Adam C, Robin Y. 1978. A serological survey of arboviruses in the human population of Senegal. Bull Soc Pathol Exot Filiales 71:131–140. (In French.) [PubMed] [Google Scholar]
  • 280.Saluzzo JF, Ivanoff B, Languillat G, Georges AJ. 1982. Serological survey for arbovirus antibodies in the human and simian population of the South-East of Gabon. Bull Soc Pathol Exot Filiales 75:262–266. (In French.) [PubMed] [Google Scholar]
  • 281.Andral L, Brès P, Sérié C, Casals J, Panthier R. 1968. Studies on yellow fever in Ethiopia. 3. Serological and virological studies of the woodland fauna. Bull World Health Organ 38:855–861. (In French.) [PMC free article] [PubMed] [Google Scholar]
  • 282.Hayes EB. 2009. Zika virus outside Africa. Emerg Infect Dis 15:1347–1350. doi: 10.3201/eid1509.090442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 283.Haddow AJ, Dick GW. 1948. Catches of biting Diptera in Uganda, with anaesthetized monkeys as bait. Ann Trop Med Parasitol 42:271–277. [DOI] [PubMed] [Google Scholar]
  • 284.Boorman JP, Porterfield JS. 1956. A simple technique for infection of mosquitoes with viruses; transmission of Zika virus. Trans R Soc Trop Med Hyg 50:238–242. [DOI] [PubMed] [Google Scholar]
  • 285.Reed LJ, Muench H. 1938. A simple method of estimating fifty per cent endpoints. Am J Hyg 27:493–497. [Google Scholar]
  • 286.Cornet M, Robin Y, Adam C, Valade M, Calvo M-A. 1979. Comparison between experimental transmission of yellow fever and Zika viruses in Aedes aegypti. Cah Orstom Ser Entomol Med Parasitol 27:47–53. (In French.) [Google Scholar]
  • 287.Gubler DJ. 2012. Arthropods in disease transmission, p 1012–1016. In Magill AJ, Ryan ET, Solomon T, Hill DR (ed), Hunter's tropical medecine and emerging infectious disease, 9th ed Elsevier, New York, NY. [Google Scholar]
  • 288.Gubler DJ, Nalim S, Tan R, Saipan H, Sulianti Saroso J. 1979. Variation in susceptibility to oral infection with dengue viruses among geographic strains of Aedes aegypti. Am J Trop Med Hyg 28:1045–1052. [DOI] [PubMed] [Google Scholar]
  • 289.Gubler DJ, Rosen L. 1976. Variation among geographic strains of Aedes albopictus in susceptibility to infection with dengue viruses. Am J Trop Med Hyg 25:318–325. [DOI] [PubMed] [Google Scholar]
  • 290.Li MI, Wong PSJ, Ng LC, Tan CH. 2012. Oral susceptibility of Singapore Aedes (Stegomyia) aegypti (Linnaeus) to Zika virus. PLoS Negl Trop Dis 6:e1792. doi: 10.1371/journal.pntd.0001792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 291.Diagne CT, Diallo D, Faye O, Ba Y, Faye O, Gaye A, Dia I, Faye O, Weaver SC, Sall AA, Diallo M. 2015. Potential of selected Senegalese Aedes spp. mosquitoes (Diptera: Culicidae) to transmit Zika virus. BMC Infect Dis 15:492. doi: 10.1186/s12879-015-1231-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 292.Miller BR, Monath TP, Tabachnick WJ, Ezike VI. 1989. Epidemic yellow fever caused by an incompetent mosquito vector. Trop Med Parasitol 40:396–399. [PubMed] [Google Scholar]
  • 293.Paupy C, Delatte H, Bagny L, Corbel V, Fontenille D. 2009. Aedes albopictus, an arbovirus vector: from the darkness to the light. Microbes Infect 11:1177–1185. doi: 10.1016/j.micinf.2009.05.005. [DOI] [PubMed] [Google Scholar]
  • 294.Wong PS, Li MZ, Chong CS, Ng LC, Tan CH. 2013. Aedes (Stegomyia) albopictus (Skuse): a potential vector of Zika virus in Singapore. PLoS Negl Trop Dis 7:e2348. doi: 10.1371/journal.pntd.0002348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 295.Ledermann JP, Guillaumot L, Yug L, Saweyog SC, Tided M, Machieng P, Pretrick M, Marfel M, Griggs A, Bel M, Duffy MR, Hancock WT, Ho-Chen T, Powers AM. 2014. Aedes hensilli as a potential vector of chikungunya and Zika viruses. PLoS Negl Trop Dis 8:e3188. doi: 10.1371/journal.pntd.0003188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 296.Cao-Lormeau VM. 2009. Dengue viruses binding proteins from Aedes aegypti and Aedes polynesiensis salivary glands. Virol J 6:35. doi: 10.1186/1743-422X-6-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 297.Calvez E, Guillaumot L, Millet L, Marie J, Bossin H, Rama V, Faamoe A, Kilama S, Teurlai M, Mathieu-Daudé F, Dupont-Rouzeyrol M. 2016. Genetic diversity and phylogeny of Aedes aegypti, the main arbovirus vector in the Pacific. PLoS Negl Trop Dis 10:e0004374. doi: 10.1371/journal.pntd.0004374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 298.Lardeux F, Rivière F, Séchan Y, Loncke S. 2002. Control of the Aedes vectors of the dengue viruses and Wuchereria bancrofti: the French Polynesian experience. Ann Trop Med Parasitol 96(Suppl 2):S105–S116. doi: 10.1179/atm.2002.96.supplement1.009. [DOI] [PubMed] [Google Scholar]
  • 299.Guillaumot L. 2005. Arboviruses and their vectors in the Pacific—status report. Pacific Health Dialog 12:45–52. [PubMed] [Google Scholar]
  • 300.Richard V, Paoaafaite T, Cao-Lormeau VM. 2015. Vector competence of Aedes aegypti and Aedes polynesiensis for Zika and chikungunya viruses in French Polynesia, poster LB-5113. 64th Annual Meeting of the American Society of Tropical Medicine and Hygiene, Philadelphia, PA, 25 to 29 October 2015. [Google Scholar]
  • 301.Dupont-Rouzeyrol M, Caro V, Guillaumot L, Vazeille M, D'Ortenzio E, Thiberge JM, Baroux N, Gourinat AC, Grandadam M, Failloux AB. 2012. Chikungunya virus and the mosquito vector Aedes aegypti in New Caledonia (South Pacific Region). Vector Borne Zoonotic Dis 12:1036–1041. doi: 10.1089/vbz.2011.0937. [DOI] [PubMed] [Google Scholar]
  • 302.Noel M. 2005. Dengue fever larval control in New Caledonia: assessment of a door-to-door health educators program. Pac Health Dialog 12:39–44. [PubMed] [Google Scholar]
  • 303.Filipe AR, Martins CM, Rocha H. 1973. Laboratory infection with Zika virus after vaccination against yellow fever. Arch Gesamte Virusforsch 43:315–319. (In German.) [DOI] [PubMed] [Google Scholar]
  • 304.McCarthy M. 2016. Zika virus was transmitted by sexual contact in Texas, health officials report. BMJ 352:i720. doi: 10.1136/bmj.i720. [DOI] [PubMed] [Google Scholar]
  • 305.Musso D, Roche C, Robin E, Nhan T, Teissier A, Cao-Lormeau VM. 2015. Potential sexual transmission of Zika virus. Emerg Infect Dis 21:359–361. doi: 10.3201/eid2102.141363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 306.Patiño-Barbosa AM, Medina I, Gil-Restrepo AF, Rodriguez-Morales AJ. 2015. Zika: another sexually transmitted infection? Sex Transm Infect 91:359. doi: 10.1136/sextrans-2015-052189. [DOI] [PubMed] [Google Scholar]
  • 307.Besnard M, Lastère S, Teissier A, Cao-Lormeau V, Musso D. 2014. Evidence of perinatal transmission of Zika vrus, French Polynesia, December 2013 and February 2014. Euro Surveill 19:20751 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20751. [PubMed] [Google Scholar]
  • 308.Oliveira Melo AS, Malinger G, Ximenes R, Szejnfeld PO, Alves Sampaio S, Bispo de Filippis AM. 2016. Zika virus intrauterine infection causes fetal brain abnormality and microcephaly: tip of the iceberg? Ultrasound Obstet Gynecol 47:6–7. doi: 10.1002/uog.15831. [DOI] [PubMed] [Google Scholar]
  • 309.Pealer LN, Marfin AA, Petersen LR, Lanciotti RS, Page PL, Stramer SL, Stobierski MG, Signs K, Newman B, Kapoor H, Goodman JL, Chamberland ME. 2003. Transmission of West Nile virus through blood transfusion in the United States in 2002. N Engl J Med 349:1236–1245. doi: 10.1056/NEJMoa030969. [DOI] [PubMed] [Google Scholar]
  • 310.Marano G, Pupella S, Vaglio S, Liumbruno GM, Grazzini G. 5 November 2015. Zika virus and the never-ending story of emerging pathogens and transfusion medicine. Blood Transfus doi: 10.2450/2015.0066-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 311.Franchini M, Velati C. 5 November 2015. Blood safety and zoonotic emerging pathogens: now it's the turn of Zika virus! Blood Transfus doi: 10.2450/2015.0187-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 312.Musso D, Nhan T, Robin E, Roche C, Bierlaire D, Zisou K, Shan Yan A, Cao-Lormeau VM, Broult J. 2014. Potential for Zika virus transmission through blood transfusion demonstrated during an outbreak in French Polynesia, November 2013 to February 2014. Euro Surveill 19:20761 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20761. [DOI] [PubMed] [Google Scholar]
  • 313.Bierlaire D, Beau F, Lastere S, Musso D, Broult J. 2014. Virus Zika en Polynésie Française: hémovigilance receveur. Transfus Clin Biol 21:234. doi: 10.1016/j.tracli.2014.08.005. [DOI] [Google Scholar]
  • 314.Allain JP, Bianco C, Blajchman MA, Brecher ME, Busch M, Leiby D, Lin L, Stramer S. 2005. Protecting the blood supply from emerging pathogens: the role of pathogen inactivation. Transfus Med Rev 19:110–126. doi: 10.1016/j.tmrv.2004.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 315.Musso D, Richard V, Green J, Broult J, Aubry M. 2015. The use of pathogen inactivation (amotosalen and ultraviolet A light illumination) in areas with active co-circulation of arboviruses. Congesso Brasilero de Hematologia, Hemoterapia e Terapia Celular, Sao Paulo, Brazil, 9 to 22 November 2015. [Google Scholar]
  • 316.Musso D, Richard V, Broult J, Cao-Lormeau VM. 2014. Inactivation of dengue virus in plasma with amotosalen and ultraviolet A illumination. Transfusion 54:2924–2930. doi: 10.1111/trf.12713. [DOI] [PubMed] [Google Scholar]
  • 317.Aubry M, Richard V, Green J, Broult J, Musso D. 2016. Inactivation of Zika virus in plasma with amotosalen and ultraviolet A illumination. Transfusion 56:33–40. doi: 10.1111/trf.13271. [DOI] [PubMed] [Google Scholar]
  • 318.Hamel R, Dejarnac O, Wichit S, Ekchariyawat P, Neyret A, Luplertlop N, Perera-Lecoin M, Surasombatpattana P, Talignani L, Thomas F, Cao-Lormeau VM, Choumet V, Briant L, Desprès P, Amara A, Yssel H, Missé D. 2015. Biology of Zika virus infection in human skin cells. J Virol 89:8880–8896. doi: 10.1128/JVI.00354-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 319.Tappe D, Pérez-Girón JV, Zammarchi L, Rissland J, Ferreira DF, Jaenisch T, Gómez-Medina S, Günther S, Bartoloni A, Muñoz-Fontela C, Schmidt-Chanasit J. 24 December 2015. Cytokine kinetics of Zika virus-infected patients from acute to reconvalescent phase. Med Microbiol Immunol doi: 10.1007/s00430-015-0445-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 320.Buckley A, Gould EA. 1988. Detection of virus-specific antigen in the nuclei or nucleoli of cells infected with Zika or Langat virus. J Gen Virol 69:1913–1920. [DOI] [PubMed] [Google Scholar]
  • 321.Bell TM, Field EJ, Narang HK. 1971. Zika virus infection of the central nervous system of mice. Arch Gesamte Virusforsch 35:183–193. [DOI] [PubMed] [Google Scholar]
  • 322.319 Casals J. 1963. Relationships among arthropod-borne animal viruses determined by cross-challenge tests. Am J Trop Med Hyg 12:587–596. [DOI] [PubMed] [Google Scholar]
  • 323.Casals J. 1957. Viruses: the versatile parasites; the arthropod-borne group of animal viruses. Trans N Y Acad Sci 19:219–235. [DOI] [PubMed] [Google Scholar]
  • 324.Hammon WM, Sather GE. 1956. Immunity of hamsters to West Nile and Murray Valley viruses following immunization with St. Louis and Japanese B. Proc Soc Exp Biol Med 91:521–524. [DOI] [PubMed] [Google Scholar]
  • 325.Henderson BE, Cheshire PP, Kirya GB, Lule M. 1970. Immunologic studies with yellow fever and selected African group B arboviruses in rhesus and vervet monkeys. Am J Trop Med Hyg 19:110–118. [DOI] [PubMed] [Google Scholar]
  • 326.Bearcroft WG. 1957. The histopathology of the liver of yellow fever-infected rhesus monkeys. J Pathol Bacteriol 74:295–303. [Google Scholar]
  • 327.Tukei P. 1974. Yellow fever infection in East Africa. Meeting of directors of World Health Organization reference centres for arboviruses, Chlamydiae and Rickettsiae. World Health Organization, Geneva, Switzerland: https://extranet.who.int/iris/restricted/bitstream/10665/77641/1/VIR_RC_74.13_Arbo_eng.pdf. [Google Scholar]
  • 328.Villamil-Gómez WE, González-Camargo O, Rodriguez-Ayubi J, Zapata-Serpa D, Rodriguez-Morales AJ. 2 January 2016. Dengue, chikungunya and Zika co-infection in a patient from Colombia. J Infect Public Health doi: 10.1016/j.jiph.20. [DOI] [PubMed] [Google Scholar]
  • 329.Centers for Disease Control and Prevention. 2009. Biosafety in microbiology and biomedical laboratories, 5th ed Centers for Disease Control and Prevention, Atlanta, GA: http://www.cdc.gov/biosafety/publications/bmbl5/BMBL.pdf. [Google Scholar]
  • 330.Pan American Health Organization. 2015. Zika virus (ZIKV) surveillance in the Americas: interim guidance for laboratory detection and diagnosis. Pan American Health Organization, Washington, DC: http://www.paho.org/hq/index.php?option=com_docman&task=doc_view&gid=30176&Itemid=270. [Google Scholar]
  • 331.World Health Organization. 2009. Dengue: guidelines for diagnosis, treatment, prevention and control. World Health Organization, Geneva, Switzerland: http://www.who.int/tdr/publications/documents/dengue-diagnosis.pdf. [PubMed] [Google Scholar]
  • 332.Dussart P, Petit L, Labeau B, Bremand L, Leduc A, Moua D, Matheus S, Baril L. 2008. Evaluation of two new commercial tests for the diagnosis of acute dengue virus infection using NS1 antigen detection in human serum. PLoS Negl Trop Dis 2:e280. doi: 10.1371/journal.pntd.0000280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 333.Taylor RM. 1952. Studies on certain viruses isolated in the tropics of Africa and South America; their growth and behavior in the embryonated hen egg. J Immunol 68:473–494. [PubMed] [Google Scholar]
  • 334.Way JH, Bowen ET, Platt GS. 1976. Comparative studies of some African arboviruses in cell culture and in mice. J Gen Virol 30:123–130. [DOI] [PubMed] [Google Scholar]
  • 335.Digoutte JP, Calvo-Wilson MA, Mondo M, Traore-Lamizana M, Adam F. 1992. Continuous cell lines and immune ascitic fluid pools in arbovirus detection. Res Virol 143:417–422. [DOI] [PubMed] [Google Scholar]
  • 336.Alera MT, Hermann L, Tac-An IA, Klungthong C, Rutvisuttinunt W, Manasatienkij W, Villa D, Thaisomboonsuk B, Velasco JM, Chinnawirotpisan P, Lago CB, Roque VG Jr, Macareo LR, Srikiatkhachorn A, Fernandez S, Yoon IK. 2015. Zika virus infection, Philippines, 2012. Emerg Infect Dis 21:722–724. doi: 10.3201/eid2104.141707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 337.American Committee on Arthropod-Borne Viruses, Subcommittee on Interrelationship among Catalogued Arboviruses. 2001. Identification of arboviruses and certain rodent-borne viruses: reevaluation of the paradigm. Emerg Infect Dis 7:756–758. doi: 10.3201/eid0704.017431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 338.Lanciotti RS, Calisher CH, Gubler DJ, Chang GJ, Vorndam AV. 1992. Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J Clin Microbiol 30:545–551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 339.Espy MJ, Uhl JR, Sloan LM, Buckwalter SP, Jones MF, Vetter EA, Yao JDC, Wengenack NL, Rosenblatt JE, Cockerill FR III, Smith TF. 2006. Real-time PCR in clinical microbiology: applications for routine laboratory testing. Clin Microbiol Rev 19:165–256. doi: 10.1128/CMR.19.1.165-256.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 340.Lanciotti RS. 2003. Molecular amplification assays for the detection of flaviviruses. Adv Virus Res 61:67–99. doi: 10.1016/S0065-3527(03)61002-X. [DOI] [PubMed] [Google Scholar]
  • 341.Gaunt MW, Gould EA. 2005. Rapid subgroup identification of the flaviviruses using degenerate primer E-gene RT-PCR and site specific restriction enzyme analysis. J Virol Methods 128:113–127. doi: 10.1016/j.jviromet.2005.04.006. [DOI] [PubMed] [Google Scholar]
  • 342.Meiyu F, Huosheng C, Cuihua C, Xiaodong T, Lianhua J, Yifei P, Weijun C, Huiyu G. 1997. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set. Microbiol Immunol 41:209–213. [DOI] [PubMed] [Google Scholar]
  • 343.Chow VT, Seah CL, Chan YC. 1993. Use of NS3 consensus primers for the polymerase chain reaction amplification and sequencing of dengue viruses and other flaviviruses. Arch Virol 133:157–170. [DOI] [PubMed] [Google Scholar]
  • 344.Fulop L, Barrett AD, Phillpotts R, Martin K, Leslie D, Titball RW. 1993. Rapid identification of flaviviruses based on conserved NS5 gene sequences. J Virol Methods 44:179–188. [DOI] [PubMed] [Google Scholar]
  • 345.Pierre V, Drouet MT, Deubel V. 1994. Identification of mosquito-borne flavivirus sequences using universal primers and reverse transcription/polymerase chain reaction. Res Virol 145:93–104. [DOI] [PubMed] [Google Scholar]
  • 346.Maher-Sturgess SL, Forrester NL, Wayper PJ, Gould EA, Hall RA, Barnard RT, Gibbs MJ. 2008. Universal primers that amplify RNA from all three flavivirus subgroups. Virol J 5:16. doi: 10.1186/1743-422X-5-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 347.Scaramozzino N, Crance JM, Jouan A, DeBriel DA, Stoll F, Garin D. 2001. Comparison of Flavivirus universal primer pairs and development of a rapid, highly sensitive heminested reverse transcription-PCR assay for detection of flaviviruses targeted to a conserved region of the NS5 gene sequences. J Clin Microbiol 39:1922–1927. doi: 10.1128/JCM.39.5.1922-1927.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 348.Chang GJ, Trent DW, Vorndam AV, Vergne E, Kinney RM, Mitchell CJ. 1994. An integrated target sequence and signal amplification assay, reverse transcriptase-PCR-enzyme-linked immunosorbent assay, to detect and characterize flaviviruses. J Clin Microbiol 32:477–483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 349.Heang V, Yasuda CY, Sovann L, Haddow AD, Travassos da Rosa AP, Tesh RB, Kasper MR. 2012. Zika virus infection, Cambodia, 2010. Emerg Infect Dis 18:349–351. doi: 10.3201/eid1802.111224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 350.Faye O, Faye O, Dupressoir A, Weidmann M, Ndiaye M, Sall AA. 2008. One-step RT-PCR for detection of Zika virus. J Clin Virol 43:96–101. doi: 10.1016/j.jcv.2008.05.005. [DOI] [PubMed] [Google Scholar]
  • 351.Balm MN, Lee CK, Lee HK, Chiu L, Koay ES, Tang JW. 2012. A diagnostic polymerase chain reaction assay for Zika virus. J Med Virol 84:1501–1505. doi: 10.1002/jmv.23241. [DOI] [PubMed] [Google Scholar]
  • 352.Hirayama T, Mizuno Y, Takeshita N, Kotaki A, Tajima S, Omatsu T, Sano K, Kurane I, Takasaki T. 2012. Detection of dengue virus genome in urine by real-time reverse transcriptase PCR: a laboratory diagnostic method useful after disappearance of the genome in serum. J Clin Microbiol 50:2047–2052. doi: 10.1128/JCM.06557-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 353.Barzon L, Pacenti M, Franchin E, Pagni S, Martello T, Cattai M, Cusinato R, Palù G. 2013. Excretion of West Nile virus in urine during acute infection. J Infect Dis 208:1086–1092. doi: 10.1093/infdis/jit290. [DOI] [PubMed] [Google Scholar]
  • 354.World Health Organization. 2014. Guidance on regulations for the transport of infectious substances 2013–2014. World Health Organization, Geneva, Switzerland: http://apps.who.int/iris/bitstream/10665/78075/1/WHO_HSE_GCR_2012.12_eng.pdf?ua=1. [Google Scholar]
  • 355.Prado I, Rosario D, Bernardo L, Alvarez M, Rodríguez R, Vázquez S, Guzmán MG. 2005. PCR detection of dengue virus using dried whole blood spotted on filter paper. J Virol Methods 125:75–81. doi: 10.1016/j.jviromet.2005.01.001. [DOI] [PubMed] [Google Scholar]
  • 356.Aubry M, Roche C, Dupont-Rouzeyrol M, Aaskov J, Viallon J, Marfel M, Lalita P, Elbourne-Duituturaga S, Chanteau S, Musso D, Pavlin BI, Harrison D, Kool JL, Cao-Lormeau VM. 2012. Use of serum and blood samples on filter paper to improve the surveillance of dengue in Pacific island countries. J Clin Virol 55:23–29. doi: 10.1016/j.jcv.2012.05.010. [DOI] [PubMed] [Google Scholar]
  • 357.World Health Organization. 2014. Asia Pacific strategy for emerging diseases progress report 2014. World Health Organization Western Pacific Region, Manila, Philippines: http://www.wpro.who.int/emerging_diseases/documents/apsed_progressreport_2014.pdf?ua=1. [Google Scholar]
  • 358.Musso D, Roche C, Marfel M, Bel M, Nilles EJ, Cao-Lormeau VM. 2014. Improvement of leptospirosis surveillance in remote Pacific islands using serum spotted on filter paper. Int J Infect Dis 20:74–76. doi: 10.1016/j.ijid.2013.12.002. [DOI] [PubMed] [Google Scholar]
  • 359.Johnson AJ, Martin DA, Karabatsos N, Roehrig JT. 2000. Detection of anti-arboviral immunoglobulin G by using a monoclonal antibody-based capture enzyme-linked immunosorbent assay. J Clin Microbiol 38:1827–1831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 360.Martin DA, Muth DA, Brown T, Johnson AJ, Karabatsos N, Roehrig JT. 2000. Standardization of immunoglobulin M capture enzyme-linked immunosorbent assays for routine diagnosis of arboviral infections. J Clin Microbiol 38:1823–1826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 361.Kuno G. 2003. Serodiagnosis of flaviviral infections and vaccinations in humans. Adv Virus Res 61:3–65. doi: 10.1016/S0065-3527(03)61001-8. [DOI] [PubMed] [Google Scholar]
  • 362.World Health Organization. 2007. Guidelines for plaque reduction neutralization testing of human antibodies to dengue viruses. World Health Organization, Geneva, Switzerland: http://apps.who.int/iris/bitstream/10665/69687/1/who_ivb_07.07_eng.pdf. [Google Scholar]
  • 363.Maeda A, Maeda J. 2013. Review of diagnostic plaque reduction neutralization tests for flavivirus infection. Vet J 195:33–40. doi: 10.1016/j.tvjl.2012.08.019. [DOI] [PubMed] [Google Scholar]
  • 364.Calisher CH, Karabatsos N, Dalrymple JM, Shope RE, Porterfield JS, Westaway EG, Brandt WE. 1989. Antigenic relationships between flaviviruses as determined by cross-neutralization tests with polclonal antisera. J Gen Virol 70:37–43. [DOI] [PubMed] [Google Scholar]
  • 365.Johnson BW, Kosoy O, Hunsperger E, Beltran M, Delorey M, Guirakhoo F, Monath T. 2009. Evaluation of chimeric Japanese encephalitis and dengue viruses for use in diagnostic plaque reduction neutralization tests. Clin Vaccine Immunol 16:1052–1059. doi: 10.1128/CVI.00095-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 366.Theilier M, Casals J. 1958. The serological reactions in yellow fever. Am J Trop Med Hyg 7:585–594. [DOI] [PubMed] [Google Scholar]
  • 367.Bearcroft WG. 1956. Zika virus infection experimentally induced in a human volunteer. Trans R Soc Trop Med Hyg 50:442–448. [PubMed] [Google Scholar]
  • 368.Bres P, Lacan A, Diop I, MIchel R, Peretti P, Vidal C. 1963. Arboviruses in Senegal. A virological survey. Bull Soc Pathol Exot 56:384–402. (In French.) [PubMed] [Google Scholar]
  • 369.Fry SR, Meyer M, Semple MG, Simmons CP, Sekaran SD, Huang JX, McElnea C, Huang CY, Valks A, Young PR, Cooper MA. 2011. The diagnostic sensitivity of dengue rapid test assays is significantly enhanced by using a combined antigen and antibody testing approach. PLoS Negl Trop Dis 5:e1199. doi: 10.1371/journal.pntd.0001199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 370.Petersen EE, Staples JE, Meaney-Delman D, Fischer M, Ellington SR, Callaghan WM, Jamieson DJ. 2016. Interim guidelines for pregnant women during a Zika virus outbreak—United States, 2016. MMWR Morb Mortal Wkly Rep 65:30–33. doi: 10.15585/mmwr.mm6502e1. [DOI] [PubMed] [Google Scholar]
  • 371.Staples JE, Dziuban EJ, Fischer M, Cragan JD, Rasmussen SA, Cannon MJ, Frey MT, Renquist CM, Lanciotti RS, Muñoz JL, Powers AM, Honein MA, Moore CA. 2016. Interim guidelines for the evaluation and testing of infants with possible congenital Zika virus infection—United States, 2016. MMWR Morb Mortal Wkly Rep 65:63–67. doi: 10.15585/mmwr.mm6503e3. [DOI] [PubMed] [Google Scholar]
  • 372.Sow A, Loucoubar C, Diallo D, Faye O, Ndiaye Y, Senghor CS, Dia AT, Faye O, Weaver SC, Diallo M, Malvy D, Sall AA. 2016. Concurrent malaria and arbovirus infections in Kedougou, southeastern Senegal. Malar J 15:47. doi: 10.1186/s12936-016-1100-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 373.Weaver SC, Lecuit M. 2015. Chikungunya virus and the global spread of a mosquito-borne disease. N Engl J Med 372:1231–1239. doi: 10.1056/NEJMra1406035. [DOI] [PubMed] [Google Scholar]
  • 374.Porter KR, Beckett CG, Kosasih H, Tan RI, Alisjahbana B, Rudiman PI, Widjaja S, Listiyaningsih E, Ma'Roef CN, McArdle JL, Parwati I, Sudjana P, Jusuf H, Yuwono D, Wuryadi S. 2005. Epidemiology of dengue and dengue hemorrhagic fever in a cohort of adults living in Bandung, West Java, Indonesia. Am J Trop Med Hyg 72:60–66. [PubMed] [Google Scholar]
  • 375.Rossi SL, Ross TM, Evans JD. 2010. West Nile virus. Clin Lab Med 30:47–65. doi: 10.1016/j.cll.2009.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 376.Sejvar JJ, Baughman AL, Wise M, Morgan OW. 2011. Population incidence of Guillain-Barré syndrome: a systematic review and meta-analysis. Neuroepidemiology 36:123–133. doi: 10.1159/000324710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 377.Mallet HP. 2014. Emergence du virus Zika en Polynésie française, p 28 15th Journées Nationales d'Infectiologie, Bordeaux, France, 11 to 13 June 2014. [Google Scholar]
  • 378.Carod-Artal FJ, Wichmann O, Farrar J, Gascón J. 2013. Neurological complications of dengue virus infection. Lancet Neurol 12:906–919. doi: 10.1016/S1474-4422(13)70150-9. [DOI] [PubMed] [Google Scholar]
  • 379.Abraham A, Ziv S, Drory VE. 2011. Posterior reversible encephalopathy syndrome resulting from Guillain-Barré-like syndrome secondary to West Nile virus infection. J Clin Neuromuscul Dis 12:113–117. doi: 10.1097/CND.0b013e318209ef9a. [DOI] [PubMed] [Google Scholar]
  • 380.Ahmed S, Libman R, Wesson K, Ahmed F, Einberg K. 2000. Guillain-Barré syndrome: an unusual presentation of West Nile virus infection. Neurology 55:144–146. doi: 10.1212/WNL.55.1.144. [DOI] [PubMed] [Google Scholar]
  • 381.Lebrun G, Chadda K, Reboux AH, Martinet O, Gaüzère BA. 2009. Guillain-Barré syndrome after chikungunya infection. Emerg Infect Dis 15:495–496. doi: 10.3201/eid1503.071482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 382.Oehler E, Fournier E, Leparc-Goffart I, Larre P, Cubizolle S, Sookhareea C, Lastère S, Ghawche F. 3 December 2015. Increase in cases of Guillain-Barré syndrome during a chikungunya outbreak, French Polynesia, 2014 to 2015. Euro Surveill doi: 10.2807/1560-7917.ES.2015.20.48.30079. [DOI] [PubMed] [Google Scholar]
  • 383.Fontes BM. 2016. Zika virus-related hypertensive iridocyclitis. Arq Bras Oftalmol 79:63. doi: 10.5935/0004-2749.20160020. [DOI] [PubMed] [Google Scholar]
  • 384.Pan American Health Organization. 2016. Epidemiological update. Neurological syndrome, congenital anomalies, and Zika virus infection. Pan American Health Organization, Washington, DC: http://www.paho.org/hq/index.php?option=com_docman&task=doc_view&Itemid=270&gid=32879&lang=en. [Google Scholar]
  • 385.ProMED-mail. 18 November 2015. 2016. Zika virus—Brazil (16) (Pernambuco) microcephaly cause undetermined. ProMED-mail archive no. 20151118.3799192. http://www.promedmail.org Accessed 1 February 2016.
  • 386.Gulland A. 2016. Zika virus is a global public health emergency, declares WHO. BMJ 352:i657. doi: 10.1136/bmj.i657. [DOI] [PubMed] [Google Scholar]
  • 387.Tetro JA. 14 January 2016. Zika and microcephaly: causation, correlation, or coincidence? Microbes Infect doi: 10.1016/j.micinf.2015.12.010. [DOI] [PubMed] [Google Scholar]
  • 388.Musso D, Baud D. 17 February 2016. Zika virus: time to move from case reports to case control. Lancet Infect Dis doi: 10.1016/S1473-3099(16)00096-7. [DOI] [PubMed] [Google Scholar]
  • 389.Adams Waldorf KM, McAdams RM. 2013. Influence of infection during pregnancy on fetal development. Reproduction 146:R151–R162. doi: 10.1530/REP-13-0232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 390.Ville Y, Leruez-Ville M. 2014. Managing infections in pregnancy. Curr Opin Infect Dis 27:251–257. doi: 10.1097/QCO.0000000000000066. [DOI] [PubMed] [Google Scholar]
  • 391.Vouga M, Musso D, Van Mieghem T, Baud D. 18 February 2016. CDC Interim guidelines for pregnant women during the Zika outbreak: an obstetric perspective. Lancet doi: 10.1016/S0140-6736(16)00383-4. [DOI] [PubMed] [Google Scholar]
  • 392.Ventura CV, Maia M, Bravo-Filho V, Góis AL, Belfort R Jr. 2016. Zika virus in Brazil and macular atrophy in a child with microcephaly. Lancet 387:228. doi: 10.1016/S0140-6736(16)00006-4. [DOI] [PubMed] [Google Scholar]
  • 393.ProMED-mail. 17 November 2015. Zika virus—Brazil (15) (Alagoas) Request for information. ProMED-mail archive no. 20151117.3799132. http://www.promedmail.org Accessed 1 February 2016.
  • 394.Arzuza-Ortega L, Polo A, Pérez-Tatis G, López-García H, Parra E, Pardo-Herrera LC, Rico-Turca AM, Villamil-Gómez W, Rodríguez-Morales AJ. 16 February 2016. Fatal Zika virus infection in girl with sickle cell disease, Colombia. Emerg Infect Dis (Letter.) doi: 10.3201/eid2205.151934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 395.Keighley CL, Saunderson RB, Kok J, Dwyer DE. 2015. Viral exanthems. Curr Opin Infect Dis 28:139–150. doi: 10.1097/QCO.0000000000000145. [DOI] [PubMed] [Google Scholar]
  • 396.Ioos S, Mallet HP, Leparc Goffart I, Gauthier V, Cardoso T, Herida M. 2014. Current Zika virus epidemiology and recent epidemics. Med Mal Infect 44:302–307. doi: 10.1016/j.medmal.2014.04.008. [DOI] [PubMed] [Google Scholar]
  • 397.Ritchie SA. 2014. Dengue vectors bionomics: why Aedes aegypti is such a good vector, p 455–480. In Gubler DJ, Ooi EE, Vasudevan S, Farrar J (ed), Dengue and dengue hemorrhagic fever, 2nd ed CAB International, Boston, MA. [Google Scholar]
  • 398.Reiter P. 2014. Surveillance and control of urban dengue vectors, p 481–518. In Gubler DJ, Ooi EE, Vasudevan S, Farrar J (ed), Dengue and dengue hemorrhagic fever, 2nd ed CAB International, Boston, MA. [Google Scholar]
  • 399.Lucey DR, Gostin LO. 27 January 2016. The emerging Zika pandemic: enhancing preparedness. JAMA doi: 10.1001/jama.2016.0904. [DOI] [PubMed] [Google Scholar]
  • 400.Gubler DJ. 2004. The changing epidemiology of yellow fever and dengue, 1900 to 2003: full circle? Comp Immunol Microbiol Infect Dis 27:319–330. doi: 10.1016/j.cimid.2004.03.013. [DOI] [PubMed] [Google Scholar]
  • 401.Yakob L, Walker T. 2016. Zika virus outbreak in the Americas: the need for novel mosquito control methods. Lancet Glob Health 4:e148-9. doi: 10.1016/S2214-109X(16)00048-6. [DOI] [PubMed] [Google Scholar]
  • 402.McCarthy M. 2016. Zika virus outbreak prompts US to issue travel alert to pregnant women. BMJ 352:i306. doi: 10.1136/bmj.i306. [DOI] [PubMed] [Google Scholar]
  • 403.Oduyebo T, Petersen EE, Rasmussen SA, Mead PS, Meaney-Delman D, Renquist CM, Ellington SR, Fischer M, Staples JE, Powers AM, Villanueva J, Galang RR, Dieke A, Muñoz JL, Honein MA, Jamieson DJ. 2016. Update: interim guidelines for health care providers caring for pregnant women and women of reproductive age with possible Zika virus exposure—United States, 2016. MMWR Morb Mortal Wkly Rep 65:122–127. doi: 10.15585/mmwr.mm6505e2. [DOI] [PubMed] [Google Scholar]
  • 404.Tsai TF, Popovici F, Cernescu C, Campbell GL, Nedelcu NI. 1998. West Nile encephalitis epidemic in southeastern Romania. Lancet 352:767–771. [DOI] [PubMed] [Google Scholar]
  • 405.Petersen LR, Roehrig JT. 2001. West Nile virus: a reemerging global pathogen. Emerg Infect Dis 7:611–614. doi: 10.3201/eid0704.017401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 406.Roehrig JT. 2013. West Nile virus in the United States—a historical perspective. Viruses 5:3088–3108. doi: 10.3390/v5123088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 407.Nash D, Mostashari F, Fine A, Miller J, O'Leary D, Murray K, Huang A, Rosenberg A, Greenberg A, Sherman M, Wong S, Layton M, West Nile Outbreak Response Working Group. 2001. The outbreak of West Nile virus infections in the New York City area in 1999. N Engl J Med 344:1807–1814. [DOI] [PubMed] [Google Scholar]
  • 408.Petersen LR, Hayes EB. 2004. Westward ho?—The spread of West Nile virus. N Engl J Med 351:2257–2259. doi: 10.1056/NEJMp048261. [DOI] [PubMed] [Google Scholar]
  • 409.Renault P, Solet JL, Sissoko D, Balleydier E, Larrieu S, Filleul L, Lassalle C, Thiria J, Rachou E, de Valk H, Ilef D, Ledrans M, Quatresous I, Quenel P, Pierre V. 2007. A major epidemic of chikungunya virus infection on Réunion Island, France, 2005–2006. Am J Trop Med Hyg 77:727–731. [PubMed] [Google Scholar]
  • 410.Chandak NH, Kashyap RS, Kabra D, Karandikar P, Saha SS, Morey SH, Purohit HJ, Taori GM, Daginawala HF. 2009. Neurological complications of chikungunya virus infection. Neurol India 57:177–180. doi: 10.4103/0028-3886.51289. [DOI] [PubMed] [Google Scholar]
  • 411.Tournebize P, Charlin C, Lagrange M. 2009. Neurological manifestations in chikungunya: about 23 cases collected in Reunion Island. Rev Neurol 165:48–51. (In French.) doi: 10.1016/j.neurol.2008.06.009. [DOI] [PubMed] [Google Scholar]
  • 412.Marfin AA, Gubler DJ. 2001. West Nile encephalitis: an emerging disease in the United States. Clin Infect Dis 33:1713–1719. doi: 10.1086/322700. [DOI] [PubMed] [Google Scholar]
  • 413.Chiu CY, Bres V, Yu G, Krysztof D, Naccache SN, Lee D, Pfeil J, Linnen JM, Stramer SL. 2015. Genomic assays for Identification of chikungunya virus in blood donors, Puerto Rico, 2014. Emerg Infect Dis 21:1409–1413. doi: 10.3201/eid2108.150458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 414.Paz S, Semenza JC. 2016. El Niño and climate change—contributing factors in the dispersal of Zika virus in the Americas? Lancet 387:745. doi: 10.1016/S0140-6736(16)00256-7. [DOI] [PubMed] [Google Scholar]
  • 415.Kraemer MU, Sinka ME, Duda KA, Mylne A, Shearer FM, Barker CM, Moore CG, Carvalho RG, Coelho GE, Van Bortel W, Hendrickx G, Schaffner F, Elyazar IR, Teng H-J, Brady OJ, Messina JP, Pigott DM, Scott TW, Smith DL, Wint GW, Golding N, Hay SI. 2015. The global distribution of the arbovirus vectors Aedes aegypti and A. albopictus. Elife 4:e08347. doi: 10.7554/eLife.08347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 416.Kraemer MU, Sinka ME, Duda KA, Mylne A, Shearer FM, Brady OJ, Messina JP, Barker CM, Moore CG, Carvalho RG, Coelho GE, Van Bortel W, Hendrickx G, Schaffner F, Wint GR, Elyazar IR, Teng HJ, Hay SI. 2015. The global compendium of Aedes aegypti and A. albopictus occurrence. Sci Data 2:150035. doi: 10.1038/sdata.2015.35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 417.Smithburn KC. 1952. Neutralizing antibodies against certain recently isolated viruses in the sera of human beings residing in East Africa. J Immunol 69:223–234. [PubMed] [Google Scholar]
  • 418.Macnamara FN, Horn DW, Porterfield JS. 1959. Yellow fever and other arthropod-borne viruses; a consideration of two serological surveys made in South Western Nigeria. Trans R Soc Trop Med Hyg 53:202–212. [DOI] [PubMed] [Google Scholar]
  • 419.Smithburn KC, Kerr JA, Gatne PB. 1954. Neutralizing antibodies against certain viruses in the sera of residents of India. J Immunol 72:248–257. [PubMed] [Google Scholar]
  • 420.Hammon WM, Schrack WD Jr, Sather GE. 1958. Serological survey for a arthropod-borne virus infections in the Philippines. Am J Trop Med Hyg 7:323–328. [DOI] [PubMed] [Google Scholar]
  • 421.Pond WL. 1963. Arthropod-borne virus antibodies in sera from residents of South-East Asia. Trans R Soc Trop Med Hyg 57:364–371. [DOI] [PubMed] [Google Scholar]
  • 422.Smithburn KC. 1954. Neutralizing antibodies against arthropod-borne viruses in the sera of long-time residents of Malaya and Borneo. Am J Hyg 59:157–163. [DOI] [PubMed] [Google Scholar]
  • 423.Smithburn KC, Taylor RM, Rirz F, Kader A. 1954. Immunity to certain arthropod-borne viruses among indigenous residents of Egypt. Am J Trop Med Hyg 3:9–18. [DOI] [PubMed] [Google Scholar]
  • 424.Kokernot RH, Smithburn KC, Gandara AF, McIntosh BM, Heymann CS. 1960. Neutralization tests with sera from individuals residing in Mozambique against specific viruses isolated in Africa, transmitted by arthropods. An Inst Med Trop (Lisb) 17:201–230. (In Portuguese.) [PubMed] [Google Scholar]
  • 425.Sérié C, Casals J, Panthier R, Brès P, Williams MC. 1968. Studies on yellow fever in Ethiopia. 2. Serological study of the human population. Bull World Health Organ 38:843–854. (In French.) [PMC free article] [PubMed] [Google Scholar]
  • 426.Chippaux-Hyppolite C, Chippaux A. 1966. Yellow fever antibodies in children in the Central African Republic. Bull World Health Organ 34:105–111. (In French.) [PMC free article] [PubMed] [Google Scholar]
  • 427.Robin Y, Brès P, Lartigue JJ, Gidel R, Lefèvre M, Athawet B, Hery G. 1968. Arboviruses in Ivory Coast. Serological survey in the human population. Bull Soc Pathol Exot Filiales 61:833–845. (In French.) [PubMed] [Google Scholar]
  • 428.Pinto MR. 1967. Survey for antibodies to arboviruses in the sera of children in Portuguese Guinea. Bull World Health Organ 37:101–108. [PMC free article] [PubMed] [Google Scholar]
  • 429.Salaun JJ, Brottes H. 1967. Arboviruses in Cameroon: serologic investigation. Bull World Health Organ 37:343–361. (In French.) [PMC free article] [PubMed] [Google Scholar]
  • 430.Monath TP, Wilson DC, Casals J. 1973. The 1970 yellow fever epidemic in Okwoga District, Benue Plateau State, Nigeria. 3. Serological responses in persons with and without pre-existing heterologous group B immunity. Bull World Health Organ 49:235–244. [PMC free article] [PubMed] [Google Scholar]
  • 431.Henderson BE, Metselaar D, Cahill K, Timms GL, Tukei PM, Williams MC. 1968. Yellow fever immunity surveys in Northern Uganda and Kenya and Eastern Somalia, 1966-67. Bull World Health Organ 38:229–237. [PMC free article] [PubMed] [Google Scholar]
  • 432.Robin Y. 1967. Rapport de la 7ème conference technique de l'Organisation de Coordination et de Coopération pour la lutte contre les Grandes Endémies. OCCGE, Bobo-Dioulasso, Burkina Faso. (In French.) [Google Scholar]
  • 433.Geser A, Henderson BE, Christensen S. 1970. A multipurpose serological survey in Kenya. 2. Results of arboviruses serological tests. Bull World Health Organ 43:539–552. [PMC free article] [PubMed] [Google Scholar]
  • 434.Henderson BE, Kirya GB, Hewitt LE. 1970. Serological survey for arboviruses in Uganda, 1967–69. Bull World Health Organ 42:797–805. [PMC free article] [PubMed] [Google Scholar]
  • 435.Henderson BE, Metselaar D, Kirya GB, Timms GL. 1970. Investigations into yellow fever virus and other arboviruses in the northern regions of Kenya. Bull World Health Organ 42:787–795. [PMC free article] [PubMed] [Google Scholar]
  • 436.Fagbami AH, Monath TP, Fabiyi A. 1977. Dengue virus infections in Nigeria: a survey for antibodies in monkeys and humans. Trans R Soc Trop Med Hyg 71:60–65. [DOI] [PubMed] [Google Scholar]
  • 437.Filipe AR, De Carvalho RG, Relvas A, Casaca V. 1975. Arbovirus studies in Angola: Serological survey for antibodies to arboviruses. Am J Trop Med Hyg 24:516–520. [DOI] [PubMed] [Google Scholar]
  • 438.Robin Y, Mouchet J. 1975. Serological and entomological study on yellow fever in Sierra Leone. Bull Soc Pathol Exot Filiales 68:249–258. (In French.) [PubMed] [Google Scholar]
  • 439.Gonzales JP, Saluzzo JF, Hervé JP, Geoffry B. 1979. Serological survey on the prevalence of arboviruses in man in forest and periforest environments of the region of Lobaye (Central African Republic). Bull Soc Pathol Exot Filiailes 72:416–423. (In French.) [PubMed] [Google Scholar]
  • 440.Fagbami A. 1977. Epidemiological investigations on arbovirus infections at Igbo-Ora, Nigeria. Trop Geogr Med 29:187–1891. [PubMed] [Google Scholar]
  • 441.Saluzzo JF, Gonzalez JP, Hervé JP, Georges AJ. 1981. Serological survey for the prevalence of certain arboviruses in the human population of the south-east area of Central African Republic. Bull Soc Pathol Exot Filiales 74:490–499. (In French.) [PubMed] [Google Scholar]
  • 442.Adekolu-John EO, Fagbami AH. 1983. Arthropod-borne virus antibodies in sera of residents of Kainji Lake Basin, Nigeria 1980. Trans R Soc Trop Med Hyg 77:149–151. [DOI] [PubMed] [Google Scholar]
  • 443.Olson JG, Ksiazek TG, Gubler DJ, Lubis SI, Simanjuntak G, Lee VH, Nalim S, Juslis K, See R. 1983. A survey for arboviral antibodies in sera of humans and animals in Lombok, Republic of Indonesia. Ann Trop Med Parasitol 77:131–137. [DOI] [PubMed] [Google Scholar]
  • 444.Rodhain F, Gonzalez JP, Mercier E, Helynck B, Larouze B, Hannoun C. 1989. Arbovirus infections and viral haemorrhagic fevers in Uganda: a serological survey in Karamoja District, 1984. Trans R Soc Top Med Hyg 83:851–854. [DOI] [PubMed] [Google Scholar]
  • 445.Fokam EB, Levai LD, Guzman H, Amelia PA, Titanji VP, Tesh RB, Weaver SC. 2010. Silent circulation of arboviruses in Cameroon. East Afr Med J 87:262–268. [DOI] [PubMed] [Google Scholar]
  • 446.Babaniyi OA, Mwaba P, Mulenga D, Monze M, Songolo P, Mazaba-Liwewe ML, Mweene-Ndumba I, Masaninga F, Chizema E, Eshetu-Shibeshi M, Malama C, Rudatsikira E, Siziya S. 2015. Risk assessment for yellow fever in western and north-western provinces of Zambia. J Glob Infect Dis 7:11–17. doi: 10.4103/0974-777X.150884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 447.Henderson BE, Hewitt L, Lule M. 1968. Serology of wild mammals, p 48–51. Virus Research Institute annual report. East African Printer, Nairobi, Kenya. [Google Scholar]
  • 448.Carey DE, Kemp GE, Troup JM, White HA, Smith EA, Addy RF, Fom AL, Pifer J, Jones EM, Brès P, Shope RE. 1972. Epidemiological aspects of the 1969 yellow fever epidemic in Nigeria. Bull World Health Organ 46:645–651. [PMC free article] [PubMed] [Google Scholar]
  • 449.Lee VH, Moore DL. 1972. Vectors of the 1969 yellow fever epidemic on the Jos Plateau, Nigeria. Bull World Health Organ 46:669–673. [PMC free article] [PubMed] [Google Scholar]
  • 450.Berge TO. (ed). 1975. International catalog of arboviruses: including certain other viruses of vertebrates. U.S. Public Health Service, Washington, DC. [Google Scholar]
  • 451.Reference deleted.
  • 452.ProMED-mail. 13 December 2015. Zika virus—Netherland ex Suriname. ProMED-mail archive no. 20151213.3858300. http://www.promedmail.org Accessed 1 February 2016.
  • 453.Calvet GA, Filippis AMB, Mendonça MCL, Sequeira PC, Siqueira AM, Veloso VG, Nogueira RM, Brasil P. 2016. First detection of autochthonous Zika virus transmission in a HIV-infected patient in Rio de Janeiro, Brazil. J Clin Virol 74:1–3. doi: 10.1016/j.jcv.2015.11.014. [DOI] [PubMed] [Google Scholar]
  • 454.Powers AM, Brault AC, Shirako Y, Strauss EG, Kang W, Strauss JH, Weaver SC. 2001. Evolutionary relationships and systematics of the alphaviruses. J Virol 75:10118–10131. doi: 10.1128/JVI.75.21.10118-10131.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 455.Robinson MC. 1955. An epidemic of virus disease in Southern Province, Tanganyika Territory, in 1952–53. I. Clinical features. Trans R Soc Trop Med Hyg 49:28–32. [DOI] [PubMed] [Google Scholar]
  • 456.Carey DE. 1971. Chikungunya and dengue: a case of mistaken identity? J Hist Med Allied Sci 26:243–262. [DOI] [PubMed] [Google Scholar]
  • 457.Halstead SB. 2015. Reappearance of chikungunya, formerly called dengue, in the Americas. Emerg Infect Dis 21:557–561. doi: 10.3201/eid2104.141723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 458.Kimura R, Hotta S. 1944. Studies on dengue fever (VI). On the inoculation of dengue virus into mice. Nippon Igazu 3379:629–633. (In Japanese.) [Google Scholar]
  • 459.Gubbler DJ. 1997. Dengue and dengue hemorrhagic fever: its history and resurgence as a global public health problem, p 1–22. In Gubler DJ, Kuno G (), Dengue dengue hemorrhagic fever. CAB International, New York, NY. [Google Scholar]
  • 460.Chretien J-P, Anyamba A, Bedno SA, Breiman RF, Sang R, Sergon K, Powers AM, Onyango CO, Small J, Tucker CJ, Linthicum KJ. 2007. Drought-associated chikungunya emergence along coastal East Africa. Am J Trop Med Hyg 76:405–407. [PubMed] [Google Scholar]
  • 461.Platonov AE, Shipulin GA, Shipulina OY, Tyutyunnik EN, Frolochkina TI, Lanciotti RS, Yazyshina S, Platonova OV, Obukhov IL, Zhukov AN, Vengerov YY, Pokrovskii VI. 2001. Outbreak of West Nile virus infection, Volgograd region, Russia, 1999. Emerg Infect Dis 7:128–132. doi: 10.3201/eid0701.010118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 462.Barzon L, Squarzon L, Cattai M, Franchin E, Pagni S, Cusinato R, Palu G. 2009. West Nile virus infection in Veneto region, Italy, 2008–2009. Euro Surveill 14:19289 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19289. [DOI] [PubMed] [Google Scholar]
  • 463.Paquet C, Quatresous I, Solet JL, Sissoko D, Renault P, Pierre V, Cordel H, Lassalle C, Thiria J, Zeller H, Schuffnecker I. 2006. Chikungunya outbreak in Réunion: epidemiology and surveillance, 2005 to early January 2006. Euro Surveill 11:E060202.3 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=2891. [DOI] [PubMed] [Google Scholar]
  • 464.Gubler DJ. 2007. The continuing spread of West Nile virus in the Western Hemisphere. Clin Infect Dis 45:1039–1046. doi: 10.1086/521911. [DOI] [PubMed] [Google Scholar]
  • 465.Lanciotti RS, Roehrig JT, Deubel V, Smith J, Parker M, Steele K, Crise B, Volpe KE, Crabtree MB, Scherret JH, Hall RA, MacKenzie JS, Cropp CB, Panigrahy B, Ostlund E, Schmitt B, Malkinson M, Banet C, Weissman J, Komar N, Savage HM, Stone W, McNamara T, Gubler DJ. 1999. Origin of the West Nile virus responsible for an outbreak of encephalitis in the northeastern United States. Science 286:2333–2337. [DOI] [PubMed] [Google Scholar]
  • 466.Ravi V. 2006. Re-emergence of chikungunya virus in India. Indian J Med Microbiol 24:83–84. doi: 10.4103/0255-0857.25175. [DOI] [PubMed] [Google Scholar]
  • 467.Pulmanausahakul R, Roytrakul S, Auewarakul P, Smith DR. 2011. Chikungunya in Southeast Asia: understanding the emergence and finding solutions. Int J Infect Dis 15:e671–e676. doi: 10.1016/j.ijid.2011.06.002. [DOI] [PubMed] [Google Scholar]
  • 468.Weaver SC. 2014. Arrival of chikungunya virus in the New World: prospects for spread and impact on public health. PLoS Negl Trop Dis 8:e2921. doi: 10.1371/journal.pntd.0002921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 469.Caglioti C, Lalle E, Castilletti C, Carletti F, Capobianchi MR, Bordi L. 2013. Chikungunya virus infection: an overview. New Microbiol 36:211–227. [PubMed] [Google Scholar]
  • 470.Leparc-Goffart I, Nougairede A, Cassadou S, Prat C, de Lamballerie X. 2014. Chikungunya in the Americas. Lancet 383:514. doi: 10.1016/S0140-6736(14)60185-9. [DOI] [PubMed] [Google Scholar]
  • 471.Petersen LR, Brault AC, Nasci RS. 2013. West Nile virus: review of the literature. JAMA 310:308–315. doi: 10.1001/jama.2013.8042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 472.Economopoulou A, Dominguez M, Helynck B, Sissoko D, Wichmann O, Quenel P, Germonneau P, Quatresous I. 2009. Atypical chikungunya virus infections: clinical manifestations, mortality and risk factors for severe disease during the 2005–2006 outbreak on Réunion. Epidemiol Infect 137:534–541. doi: 10.1017/S0950268808001167. [DOI] [PubMed] [Google Scholar]
  • 473.Lanciotti RS, Valadere AM. 2014. Transcontinental movement of Asian genotype of chikungunya virus. Emerg Infect Dis 20:1400–1402. doi: 10.3201/eid2008.140268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 474.Donadieu E, Bahuon C, Lowenski S, Zientara S, Coulpier M, Lecollinet S. 2013. Differential virulence and pathogenesis of West Nile viruses. Viruses 5:2856–2880. doi: 10.3390/v5112856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 475.Charrel RN, de Lamballerie X, Raoult D. 2007. Chikungunya outbreaks—the globalization of vectorborne diseases. N Engl J Med 356:769–771. doi: 10.1056/NEJMp078013. [DOI] [PubMed] [Google Scholar]
  • 476.Gubler DJ. 2014. Dengue viruses: their evolution, history and emergence as a global public health problem, p 1–29. In Gubler DJ, Ooi EE, Vasudevan S, Farrar J (ed), Dengue and dengue hemorrhagic fever, 2nd ed CAB International, London, United Kingdom. [Google Scholar]
  • 477.Coffey LL, Failloux AB, Weaver SC. 2014. Chikungunya virus-vector interactions. Viruses 6:4628–4663. doi: 10.3390/v6114628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 478.Volk SM, Chen R, Tsetsarkin KA, Adams AP, Garcia TI, Sall AA, Nasar F, Scuh AJ, Holmes EC, Higgs S, Maharaj PD, Brault AC, Weaver SC. 2010. Genome-scale phylogenetic analyses of chikungunya virus reveal independent emergences of recent epidemics and various evolutionary rates. J Virol 84:6497–6504. doi: 10.1128/JVI.01603-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 479.Burt FJ, Rolph MS, Rulli NE, Mahalingam S, Heise MT. 2012. Chikungunya: a re-emerging virus. Lancet 379:662–671. doi: 10.1016/S0140-6736(11)60281-X. [DOI] [PubMed] [Google Scholar]
  • 480.Atkinson B, Hearn P, Afrough B, Lumley S, Carter D, Aarons EJ, Simpson AJ, Brooks TJ, Hewson R. 11 February 2016. Detection of Zika virus in semen. Emerg Infect Dis doi: 10.3201/eid2205.160107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 481.Cao-Lormeau V-M. 18 February 2016. Tropical islands as new hubs for emerging arboviruses. Emerg Infect Dis doi: 10.3201/eid2205.150547. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Clinical Microbiology Reviews are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES