Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2016 Apr 22;84(5):1526–1535. doi: 10.1128/IAI.00163-16

Lactobacilli Reduce Helicobacter pylori Attachment to Host Gastric Epithelial Cells by Inhibiting Adhesion Gene Expression

Nele de Klerk a, Lisa Maudsdotter a, Hanna Gebreegziabher a, Sunil D Saroj a, Beatrice Eriksson a, Olaspers Sara Eriksson a, Stefan Roos b, Sara Lindén c, Hong Sjölinder a, Ann-Beth Jonsson a,✉
Editor: S R Blanke
PMCID: PMC4862695  PMID: 26930708

Abstract

The human gastrointestinal tract, including the harsh environment of the stomach, harbors a large variety of bacteria, of which Lactobacillus species are prominent members. The molecular mechanisms by which species of lactobacilli interfere with pathogen colonization are not fully characterized. In this study, we aimed to study the effect of lactobacillus strains upon the initial attachment of Helicobacter pylori to host cells. Here we report a novel mechanism by which lactobacilli inhibit adherence of the gastric pathogen H. pylori. In a screen with Lactobacillus isolates, we found that only a few could reduce adherence of H. pylori to gastric epithelial cells. Decreased attachment was not due to competition for space or to lactobacillus-mediated killing of the pathogen. Instead, we show that lactobacilli act on H. pylori directly by an effector molecule that is released into the medium. This effector molecule acts on H. pylori by inhibiting expression of the adhesin-encoding gene sabA. Finally, we verified that inhibitory lactobacilli reduced H. pylori colonization in an in vivo model. In conclusion, certain Lactobacillus strains affect pathogen adherence by inhibiting sabA expression and thereby reducing H. pylori binding capacity.

INTRODUCTION

The human body is home to an extensive microbiota that outnumber our human cells 10 to 1. This bacterial community plays a role in functions that are beneficial to the host, such as nutrition, immune function, development, and defense against pathogens (1). Even in the stomach, an organ previously thought to be sterile because of its low pH, the microbial load is 101 to 103 CFU bacteria/ml gastric content, although the load in the stomach is lower than in the colon (1010 to 1012 CFU/ml) (2, 3). In recent years, and due to new technologies that facilitate the large-scale analysis of genetic and metabolic profiles, the gut microbiota has been extensively studied. Healthy individuals and patients with various clinical conditions differ in their microbiota compositions, which strongly suggests that modification of the microbiota may have an impact on health (4). Well-known members of the normal microbiota are bacteria of the genus Lactobacillus. These lactic acid bacteria are considered beneficial for health and are widely studied for the inhibition of pathogens.

Helicobacter pylori is a Gram-negative, helix-shaped, microaerophilic, human-specific bacterium that colonizes the stomach of more than half of the world's population (5). H. pylori cause chronic gastritis and when left untreated can eventually lead to the development of gastroduodenal ulcers and gastric cancer in a subset of infected individuals (5). Although the majority of Helicobacter bacteria remain in the mucus layer lining the gastric epithelium (6–8), it is widely accepted that the bacteria in contact with epithelial cells cause disease. H. pylori produces several important virulence molecules that interact with epithelial cells and immune cells. The cag pathogenicity island (PAI) encodes type 4 secretion systems that inject CagA into target cells upon attachment (9–11). After CagA injection, CagA undergoes tyrosine phosphorylation and causes actin-cytoskeletal rearrangements, proliferation of host cells, and interleukin 8 (IL-8) release, all factors important for disease development. Another important virulence factor is VacA, a secreted toxin that induces vacuoles in target gastric cells (12). Lactobacilli have been studied in relation to H. pylori but mainly as a possible additive to antibiotic treatment (13). The mechanisms behind pathogen inhibition mediated by lactobacilli are still largely unknown.

In this study, we investigated how lactobacilli can affect the early colonization by H. pylori of the gastric epithelium. Three lactobacillus strains that could reduce H. pylori adhesion were identified in a screen with 28 lactobacillus strains. The effector molecule is a component that can be released into the surroundings. The inhibitory lactobacilli act on H. pylori directly by reducing the expression of the SabA adhesin on a transcriptional level. The ability of effector molecules released from lactobacillus strains to reduce H. pylori attachment is intriguing. The finding opens for research the characterization of the Lactobacillus effector molecule that reduces H. pylori attachment and further investigation of its mode of action. Since attachment is the first and crucial step to establish infection, any compound able to inhibit pathogen adherence might be a possible novel therapeutic agent and help battle the continued problem of antimicrobial resistance.

MATERIALS AND METHODS

Bacterial strains and cell lines.

The gastric epithelial cell lines AGS (ATCC CRL-1739) and MKN45 (Japan Health Science Research Resource Bank JCRB0254) were cultured in RPMI 1640 (Life Technologies) supplemented with 10% heat-inactivated fetal bovine serum (Sigma-Aldrich). The cells were maintained at 37°C and 5% CO2 in a humidified environment. The cells were seeded into tissue culture plates the day before the experiment to form a monolayer overnight. At the start of each experiment, the cell culture medium was replaced with RPMI 1640 without serum.

The Helicobacter pylori strains J99 (ATCC 700824), J99ΔSabA (described in reference 14 and kindly provided by Thomas Borén, Umeå University), 67:21 (described in reference 15), and SS1 (described in reference 16), were grown on Columbia blood agar plates (Acumedia) supplemented with 8% defibrinated horse blood and 8% inactivated horse serum (Håtunalab) for 3 days at 37°C under microaerophilic conditions, i.e., in an incubator with 5% O2 10% CO2, and 85% N2. J99ΔSabA was grown on plates supplemented with chloramphenicol. The Lactobacillus strains that were used have been described or isolated in connection with a study by Roos et al. (17), were obtained from culture collections, or were a gift from BioGaia AB and are listed in Table 1. Lactobacilli were grown on Rogosa agar plates and cultured overnight in MRS broth (Oxoid) at 37°C and 5% CO2 in a humidified environment.

TABLE 1.

Lactobacillus strains used in this study

Species Strain Source
L. salivarius LMG 9477 Human saliva
Kx 166 A1 Human gastric biopsy specimena
Kx 308 A1 Human gastric biopsy specimena
L. rhamnosus Kx 151 A1 Human gastric biopsy specimena
Kx 169 C3 Human gastric biopsy specimena
L. casei Kx 126 A2 Human gastric biopsy specimena
Kx 169 C4 Human gastric biopsy specimena
L. fermentum Kx 134 A2 Human gastric biopsy specimena
Kx 293 A3 Human gastric biopsy specimena
L. oris Kx 112 A1 Human gastric biopsy specimena
L. gasseri Kx 110 A1 Human gastric biopsy specimena
Kx 126 A5 Human gastric biopsy specimena
MV1-1a Human vaginab
L. acidophilus ATCC 4356 Human pharynx
L. brevis ATCC 14869 Human feces
L. reuteri ATCC 55730 Human breast milkb
ATCC PTA 4659 Human breast milkb
MV4:1A Human vaginab
MV29:2A Human vaginab
ATCC PTA 4964 Human fecesb
DSM 20016 Human feces
ATCC PTA 5289 Human salivab
FJ2 Human salivab
L. crispatus MV24-1a Human vaginab
L. antri DSM 16041 Human gastric biopsy specimena
L. kalixensis DSM 16043 Human gastric biopsy specimena
L. gastricus DSM 16045 Human gastric biopsy specimena
L. ultunensis DSM 16047 Human gastric biopsy specimena
a

Isolated in connection with the experiments described by Roos et al. (17).

b

Kind gift from BioGaia AB, Stockholm, Sweden.

Urease assay.

AGS cells in a 96-well plate were infected with H. pylori 67:21 alone or in combination with lactobacilli at a multiplicity of infection (MOI) of 100 for each bacterium. After 2 h of incubation, the unbound bacteria were washed away three times with 50 mM potassium phosphate, pH 6.8. Urease assay buffer (50 mM potassium phosphate [pH 6.8], 250 mM urea, and 20 μg/ml phenol red) was added, and the absorbance at 560 nm was measured every 10 min for 2 h. A dilution series with known amounts of bacteria was used as a standard.

Adhesion assays by viable counts.

H. pylori bacteria from plates were suspended to homogeneity in RPMI 1640 to an optical density of 0.7, i.e., 108 CFU/ml. Lactobacillus strains from overnight cultures were suspended in RPMI 1640 to an optical density of 1.0. Epithelial cells in 48-well plates were infected with H. pylori alone or together with lactobacilli at an MOI of 100 for each species. After 2 h of incubation, the cells were washed three times with phosphate-buffered saline (PBS) to remove any unbound bacteria. The host cells were lysed by treatment with 1% saponin in RPMI 1640 for 5 min. The number of adhered CFU was determined by serial dilution and spreading the lysate on agar plates. The H. pylori bacteria on blood agar plates were incubated for 4 to 7 days, and Rogosa plates with lactobacilli were incubated for 2 days.

Pretreatment of bacteria.

Heat-killed lactobacilli were obtained by incubation at 95°C for 15 min. Formaldehyde-killed lactobacilli were obtained by fixing them in 4% formaldehyde for 15 min at room temperature. Residual formaldehyde was removed by three washing steps of resuspension of the bacteria in 1 ml RPMI 1640 and centrifugation at 10,000 × g for 1 min. Treated bacterial samples were spread on plates to confirm that all bacteria were dead.

Pretreatment of host cells.

Host epithelial cells were fixed by incubation with 4% formaldehyde in RPMI 1640 for 15 min at room temperature and subsequently washed three times with RPMI 1640 to remove residual formaldehyde.

H. pylori viability assay.

For assessment of H. pylori viability, coincubation of H. pylori with lactobacilli on the host cells was conducted as described above for 2 h. The supernatants were saved, and the cells were treated with 1% saponin in RPMI 1640 for 5 min and pooled with the supernatants. The number of viable bacteria was determined by serial dilution and spreading on plates as described above.

Experiments with CM.

Conditioned medium (CM) from lactobacilli was prepared by incubating lactobacilli in RPMI 1640 at approximately 2 × 107 CFU/ml for 2 h at 37°C and 5% CO2. The suspension was filtered through a 0.2-μm sterile filter to remove the bacterial cells.

Preincubation of H. pylori in CM.

H. pylori was resuspended in CM to approximately 2 × 107 CFU/ml and incubated for 2 h at 37°C. To remove the CM, the suspension was centrifuged at 4,000 × g for 10 min and resuspended in RPMI 1640. The CM-pretreated H. pylori was added to AGS cells at an MOI of 100. At 2 h postinfection, the unbound bacteria were washed away, and the bound bacteria were plated for viable counts. Heat treatment of CM was done at 95°C for 15 min.

Microscopy.

The bacteria were resuspended in PBS, and 1 μg of DyLight N-hydroxysuccinimide (NHS) ester (Thermo Scientific) was added per 108 CFU. After incubation for 15 min at 37°C, the bacteria were washed with Tris-buffered saline (50 mM Tris and 150 mM NaCl), followed by a wash with RPMI 1640. The AGS gastric epithelial cells, grown on poly-d-lysine-coated coverslips, were infected with the stained bacteria to an MOI of 100. The bacteria were allowed to adhere to the host cells for 2 h, after which the unbound bacteria were washed away three times with RPMI 1640. The cells were fixed with 4% formaldehyde for 10 min at room temperature and subsequently mounted in Vectashield mounting medium. Bright-field and fluorescence microscopy images were taken with an inverted Zeiss Cell Observer microscope.

qPCR analysis.

The H. pylori bacteria that had been incubated in conditioned media from lactobacilli for 2 h were resuspended in lysis buffer (30 mM Tris-HCl, 1 mM EDTA, 15 mg/ml lysozyme, and proteinase K) and incubated for 20 min at room temperature, with 10 s of vortexing and 2-min rest cycles. The RNA was isolated using the RNeasy kit (Qiagen) according to the manufacturer's instructions. To remove the genomic DNA, the RNA was incubated with Turbo-DNase (Ambion) for 1 h at 37°C. The RNA was then purified with an RNA Clean & Concentrator kit (Zymo Research). The complete removal of genomic DNA from the RNA was confirmed by PCR with primers for the H. pylori housekeeping gene gyrB. SuperScript VILO Mastermix (Invitrogen) was used to synthesize the cDNA. Quantitative PCR (qPCR) was performed using a LightCycler 480 (Roche) and a SYBR green I master kit (Roche). The primers used are listed in Table 2. The SabA fwd1 and rev1 primers were used for detection of sabA in H. pylori strains 67:21 and J99, and the SabA P1 primer pair was used to detect sabA in the SS1 strain. All of the primers were designed using Primer-BLAST software, except for the qPCR primers for the housekeeping gene gyrB that were described previously (18). The PCR program was a follows: initial denaturation at 95°C for 10 min, followed by amplification for 40 cycles with denaturation at 95°C for 10 s; annealing at 50°C for 20 s; and extension at 72°C for 20 s. The melting curve analysis was as follows: 95°C for 5 s, 65°C for 1 min, and then increases to 95°C at 0.08°C/s. The expression was normalized against the housekeeping gene gyrB. The expression levels were given as the fold change relative to the control samples.

TABLE 2.

Primers used in this study

Primer type and gene Primer name Sequence (5′-3′)
qPCR primers
    Gyrase B gene HpGyrB fwd1 CGTGGATAACGCTGTAGATGAGAGCa
HpGyrB rev1 GGGATTTTTTCCGTGGGGTGa
    sabA SabA fwd1 TGAAACGCCACTGATGACGA
SabA rev1 AACCGTGAGCAACGCTCTTA
SabA P1 fwd CTCCCACCGCCATAAGTCC
SabA P1 rev TGGCGAAAGCAAAAGATGGG
    babA BabA fwd1 CGATACCCTGGCTCGTTGTT
BabA rev1 GGTTTTGGAATGTCGTGGGC
    horB HorB fwd2 GTGGGATTCGCTTAGGCACT
HorB rev2 TAAAAGGCATAGGGGCGGTG
    alpA AlpA fwd1 CACGCACTTCCAGTTCCTCT
AlpA rev1 ACTACGCCAAATTCCACCGT
    alpB AlpB fwd1 GCCGGTAACAGCTCTCAAGT
AlpB rev1 AAGCCGTAGTAGCGTAAGCC
    cagL CagL fwd1 CTCAAAGCAATGGCCGCTTT
CagL rev1 AGACCAACCAACAAGTGCTCA
    hopZ HopZ fwd1 ATCGCACCGTTGTTGGTTTG
HopZ rev1 GGGGCTTACAGGCCGTTTAT
    oipA OipA fwd1 TAACGATAAGCGAGCGTCCC
OipA rev1 TTAGCGTCTAGCGTTCTGCC
    labA LabA fwd1 GCTCATGACTTGCCACAACC
LabA rev1 CCGACCCCAACGCTATCAAT
PCR primers
    Gyrase B gene HpGyrB fwd PCR CGTTTCGGTTGTGAACGCTT
HpGyrB rev PCR TTGAATGCCGCACCCAAAAG
a

HpGyrB primer sequences have been previously described (18).

Western blotting.

H. pylori that had been incubated in conditioned medium from lactobacilli for 2 h were resuspended in sample buffer containing 5% β-mercaptoethanol, separated on 10% SDS-PAGE gels, and transferred to Immobilon-P membranes (Millipore). SabA was detected using a rabbit polyclonal antibody (kindly provided by Thomas Boren and Anna Arnqvist). For quantification of protein expression levels, a polyclonal AhpC antibody (19) was used as a normalization control. The SabA and AhpC antibodies were detected using infrared (IR)-reactive dye-conjugated goat anti-rabbit 800CW secondary antibodies (Li-Cor) and visualized using an Odyssey IR scanner (Li-Cor). ImageJ analysis software was used to analyze image files. Protein expression was quantified from two independent experiments in duplicate.

Mouse model of infection.

The hCD46Ge transgenic mouse line (CD46+/+) harbors the complete human CD46 gene, expresses CD46 in a human-like pattern (20–22), and is susceptible to H. pylori infection (23). The mice, 5 to 7 weeks old, were fed ad libitum and monitored daily. To study the influence of inhibitory lactobacilli on the colonization of H. pylori in the gastric tract, the normal flora was reduced by providing antibiotic treatment in drinking water for 2 days. The antibiotic solution contained 1 g/liter ampicillin, 1 g/liter neomycin, 1 g/liter metronidazole, and 0.5 g/liter vancomycin (Sigma-Aldrich). The mice were left without antibiotics in water for 18 h before inoculation with 108 CFU L. gasseri Kx 110 A1 or L. salivarius LMG 9477 suspended in 100 μl PBS by gavage twice per day for 2 days. The mice (n = 6) were then infected perorally with 108 CFU of the mouse-adapted H. pylori strain SS1 in brucella broth, alone or together with 108 CFU L. gasseri Kx 110 A1 or L. salivarius LMG 9477. At 6 h postinfection, the mice were sacrificed, and the stomach tissue was collected. The bacterial counts were determined by plating the serial dilutions of the homogenized samples on selective Columbia blood agar plates containing 200 μg/ml bacitracin, 100 μg/ml vancomycin, 10 μg/ml nalidixic acid, and 3.3 μg/ml polymixin B. The Helicobacter pylori colonies were identified by morphology and urease activity.

The mouse experiments described in the present study were conducted at the animal facility at Stockholm University. All animal care and experiments were conducted according to the institution's guidelines. All of the protocols were approved by the Swedish Ethical Committee on Animal Experiments.

Statistical analysis.

All of the experiments were performed on three independent occasions with triplicate samples, except for the qPCR, for which the results were obtained in three independent experiments with duplicate samples. The differences between groups were analyzed using ANOVA (analysis of variance), followed by the Bonferroni post hoc test. Statistical analysis of the ratios or relative values was performed using the log ratios. The data from the mouse experiment were analyzed with the Kruskal-Wallis test. Differences with a P value below 0.05 were considered statistically significant. The error bars represent standard deviations. The statistical analysis was performed using GraphPad Prism 5 software.

RESULTS

Certain lactobacilli can inhibit adhesion of H. pylori to host gastric epithelial cells.

Here, we examined whether lactobacilli can affect the early colonization by H. pylori of human gastric epithelial cells. In a screen using urease activity as a measurement for adhesion, we found that 3 out of 28 Lactobacillus strains tested could reduce attachment of the H. pylori strain 67:21 to AGS cells (Fig. 1A). The lactobacilli used in this study do not express any urease activity (data not shown), but to exclude any false positives due to interference of the lactobacilli with H. pylori urease activity, we confirmed the inhibitory effect by the viable count method using five representative strains. In line with the results from the urease assay, L. salivarius LMG 9477 and L. rhamnosus Kx 151 A1 were noninhibitory, whereas L. gasseri Kx 110 A1 and Kx 126 A5 as well as L. brevis ATCC 14869 inhibited H. pylori adhesion (Fig. 1B).

FIG 1.

FIG 1

Certain lactobacilli can reduce the adhesion of H. pylori to host gastric epithelial cells. Attachment levels to gastric epithelial cells of H. pylori alone or together with lactobacilli at an MOI of 100 of each strain for 2 h are shown. (A) Adhesion of H. pylori strain 67:21 to AGS cells as determined by urease activity; (B) adhesion of H. pylori strain 67:21 to AGS cells as determined by viable count; (C) adhesion of H. pylori 67:21 to MKN45 cells as determined by viable count; (D) adhesion of H. pylori strain J99 to AGS epithelial cells as determined by viable count. The numbers of CFU/ml were determined by serial dilution and plating. Hp, H. pylori. A complete list of Lactobacillus strains and sources is shown in Table 1. The data shown are representative of three independent experiments with triplicate samples. The differences between groups were analyzed using ANOVA (analysis of variance), followed by the Bonferroni post hoc test. The error bars represent standard deviations. An asterisk indicates a statistically significant difference (P < 0.05) from the results with H. pylori alone. Lactobacillus strain abbreviations: L.sal1, L. salivarius LMG 9477; L.sal2, L. salivarius Kx 166 A1; L.sal3, L. salivarius Kx 308 A1; L.rham1, L. rhamnosus Kx 151 A1; L.rham2, L. rhamnosus Kx 169 C3; L.cas1, L. casei Kx 126 A2; L.cas2, L. casei Kx 169 C4; L.fer1, L. fermentum Kx 134 A2; L.fer2, L. fermentum Kx 293 A3; L.oris, L. oris Kx 112 A1; L.gas1, L. gasseri Kx 110 A1; L.gas2, L. gasseri Kx 126 A5; L.gas3, L. gasseri MV1-1a; L.acid, L. acidophilus ATCC 4356; L.bre, L. brevis ATCC 14869; L.reu1, L. reuteri ATCC 55730; L.reu2, L. reuteri ATCC PTA 4659; L.reu3, L. reuteri MV4:1A; L.reu4, L. reuteri MV29:2A; L.reu5, L. reuteri ATCC PTA 4964; L.reu6, L. reuteri DSM 20016; L.reu7, L. reuteri ATCC PTA 5289; L.reu8, L. reuteri FJ2; L. cris, L. crispatus MV24-1a; L.ant, L. antri DSM 16041; L.kal, L. kalixensis DSM 16043; L.gstr, L. gastricus DSM 16045; L.ult, L. ultunensis DSM 16047.

To assess whether the lactobacillus-mediated inhibition was cell line specific, we used the human gastric epithelial cell line MKN45. Indeed, L. gasseri Kx 110 A1 and L. brevis ATCC 14869 inhibited H. pylori 67:21 adhesion to the MKN45 cells too (Fig. 1C). To verify that these results were relevant to other H. pylori strains, we tested H. pylori strain J99 on the AGS cells. Again, L. gasseri Kx 110 A1 and L. brevis ATCC 14869 reduced H. pylori adhesion (Fig. 1D). In summary, 3 out of 28 lactobacilli strains reduced H. pylori attachment to the target cells. The reduced adherence was not dependent on a specific cell line or H. pylori strain.

H. pylori colonization is inhibited by lactobacilli in vivo.

To study whether H. pylori colonization was also reduced by lactobacilli in vivo, we infected mice with H. pylori in the presence of the inhibitory L. gasseri Kx 110 A1. We used transgenic mice that expressed the human protein CD46 to mimic a more human-like stomach and the mouse-adapted H. pylori strain SS1. The mouse model was used since it has been shown that H. pylori infection reduces human CD46 in gastric tissue (24) and that CD46 transgenic mice are susceptible to H. pylori gastric colonization (23).

Before the experiments in mice, we confirmed that the inhibitory lactobacilli reduced the attachment of SS1 similar to the way it reduced the attachment of strains 67:21 and J99 (Fig. 2A). First, the microbiota of the mice was reduced by antibiotic treatment for 2 days. The mice were then inoculated perorally with L. gasseri Kx 110 A1, L. salivarius LMG 9477, or control buffer twice a day for 2 days before infection with H. pylori. The mice treated with the inhibitory L. gasseri Kx 110 A1 had less H. pylori bacteria in their stomach than the mice infected with H. pylori alone, whereas the H. pylori level in mice treated with the noninhibitory L. salivarius LMG 9477 was not reduced (Fig. 2B). In summary, these data show that L. gasseri Kx 110 A1 can also reduce the initial colonization of H. pylori in vivo.

FIG 2.

FIG 2

Lactobacilli reduce H. pylori (Hp) colonization in vivo. L.sal1, L. salivarius LMG 9477; L.gas1, L. gasseri Kx 110 A1; L.bre, L. brevis ATCC 14869. (A) Adhesion of the H. pylori strain SS1 to AGS gastric epithelial cells alone or in combination with lactobacilli. The numbers of CFU/ml were determined by serial dilution and plating. The data shown are representative of three independent experiments with triplicate samples. The differences between groups were analyzed using ANOVA (analysis of variance), followed by the Bonferroni post hoc test. The error bars represent standard deviations. (B) Mice pretreated with L. gasseri Kx 110 A1, L. salivarius LMG 9477, or PBS were perorally infected with H. pylori (108 CFU/mouse) alone or together with L. gasseri Kx 110 A1 or L. salivarius LMG 9477 (108 CFU/mouse). H. pylori colonization of the stomach was determined by viable counts at 6 h postinfection. The horizontal lines represent median numbers of CFU/g tissue. The data from the mouse experiment were analyzed with the Kruskal-Wallis test. An asterisk indicates a statistically significant difference (P < 0.05) from the results for H. pylori alone.

Lactobacilli do not compete for space and are not bactericidal.

Several possible mechanisms have been described on how lactobacilli might protect against pathogen colonization (1). To investigate whether the inhibitory lactobacilli in this study could act synergistically to reduce H. pylori attachment, we used a mixture of two lactobacillus strains in an adhesion assay. The combination of L. gasseri Kx 110 A1 and L. brevis ATCC 14869 did not increase the inhibitory effect on H. pylori adhesion, suggesting that the two lactobacillus strains reduce H. pylori attachment through similar processes without synergistic effects (Fig. 3A).

FIG 3.

FIG 3

Lactobacillus-mediated reduction of H. pylori attachment is not mediated by competition for space or bacterial killing. L.gas1, L. gasseri Kx 110 A1; L.bre, L. brevis ATCC 14869. (A) Adhesion of H. pylori to host gastric epithelial cells upon coinfection with a combination of lactobacilli for 2 h in cell culture medium RPMI 1640. (B) Fluorescence microscopy images showing binding of H. pylori and lactobacilli to host cells. H. pylori were prestained with DyLight 594 NHS ester (red), and lactobacilli were prestained with DyLight 488 NHS ester (green). Representative images are shown. Scale bar, 10 μm. (C) The pH of the cell culture medium upon infection of the host cells with H. pylori alone or together with lactobacilli for 2 h, under the same conditions as for the adhesion inhibition experiments described for panel A. (D) Viability of H. pylori upon coincubation with lactobacilli on host cells for 2 h. Hp, H. pylori 67:21. AGS epithelial cells were used. The adhesion and viability of bacteria were determined by a viable count assay. The numbers of CFU/ml were determined by serial dilution and plating. The data shown are representative of three independent experiments with triplicate samples. The differences between groups were analyzed using ANOVA (analysis of variance), followed by the Bonferroni post hoc test. The error bars represent standard deviations. An asterisk indicates a statistically significant difference (P < 0.05) from the results for H. pylori alone. ns, nonsignificant difference.

To investigate whether steric hindrance was of importance for adhesion inhibition, we stained the bacteria with fluorescent dyes and used microscopy to determine the binding patterns of the different strains. The imaging data suggested that the lactobacilli and H. pylori did not adhere to the same locations on the host cells (Fig. 3B). Although we cannot completely rule out the possibility of steric hindrance, this finding indicates that competition for space is most likely not the mechanism of inhibition.

Changes in pH can affect the binding modes of H. pylori (25–27). The lactic acid that lactobacilli produce and the low pH that results from this production have been implicated in the inhibition of H. pylori (28–31). We therefore measured the pH of the cell culture medium after 2 h of infection with H. pylori alone or together with lactobacilli. The differences in pH were minimal (Fig. 3C), which indicates that the lactobacilli do not reduce H. pylori attachment by altering the pH of the environment.

Lactobacilli can produce bactericidal molecules like bacteriocins and hydrogen peroxide (32, 33). However, the viability of H. pylori was not affected by coincubation with lactobacilli (Fig. 3D), excluding killing as an antiadhesion mechanism. Together, these data demonstrate that lactobacilli do not physically shield H. pylori from host cells and do not affect the viability of the pathogen.

The effector molecule of lactobacilli is a released component.

To better determine the nature of the effector component from lactobacilli, we compared the adhesion inhibition capacities of dead and live lactobacilli. Both heat-killed and formaldehyde-fixed lactobacilli reduced H. pylori attachment equally as well as live lactobacilli (Fig. 4A). Further, heat treatment of CM at 95°C for 15 min still inhibited attachment of H. pylori, indicating a heat-stable effector molecule (see Fig. S1 in the supplemental material). This suggests that a heat- and formaldehyde-resistant component is likely responsible for the inhibitory effect.

FIG 4.

FIG 4

The effector molecule of lactobacilli is a released component. L.gas1, L. gasseri Kx 110 A1; L.bre, L. brevis ATCC 14869. (A) Effects of live, heat-killed, or formaldehyde-fixed lactobacilli on the adhesion of H. pylori (Hp) to host cells. H. pylori bacteria alone or together with lactobacilli were added to host cells at an MOI of 100 for each strain for 2 h. (B) The effect of conditioned medium (CM) from lactobacilli on the adhesion of H. pylori. To produce CM, the lactobacilli were grown in RPMI 1640 for 2 h and then filtered to remove the bacteria. H. pylori bacteria alone or together with CM were added to AGS cells for 2 h at an MOI of 100. As a negative control, sterile growth medium without CM (−) was used. The adhesion of the bacteria was determined by a viable count assay. The numbers of CFU/ml were determined by serial dilution and plating. The data shown are representative of three independent experiments with triplicate samples. The differences between groups were analyzed using ANOVA (analysis of variance), followed by the Bonferroni post hoc test. The error bars represent standard deviations. ns, nonsignificant difference. An asterisk indicates a statistically significant difference (P < 0.05) from the results for H. pylori alone.

To investigate whether the effector component is a released bacterial molecule, we grew lactobacillus strains in RPMI 1640 for 2 h and then filter sterilized the medium to remove the bacterial cells. The obtained conditioned medium (CM) was then added to the host cells together with H. pylori. Interestingly, CM from lactobacilli reduced the adhesion of H. pylori (Fig. 4D), similar to whole lactobacilli, which indicates the release of the inhibitory molecule into the environment. Because both formaldehyde-fixed lactobacilli and CM from live lactobacilli can reduce H. pylori adhesion, we propose that the effector molecule from inhibitory lactobacilli is a component released into the environment.

Lactobacilli release an effector molecule that affects H. pylori binding capacity.

There are two ways in which lactobacilli can inhibit H. pylori adhesion: either directly by interfering with the pathogen's binding characteristics or indirectly by affecting the host cell receptors. To explore these possibilities, we fixed the AGS cells with formaldehyde to stop all signaling and metabolic activity in the host cells. Remarkably, H. pylori bound to the fixed cells to a similar extent as it did to untreated host cells, and the lactobacilli still reduced the adhesion to fixed cells (Fig. 5A). This suggests that the host epithelial cells do not play a role in the adhesion inhibition process. To assess whether lactobacilli had a direct effect on H. pylori, we preincubated H. pylori bacteria in CM for 2 h and then centrifuged and resuspended them in RPMI 1640 and used these H. pylori bacteria to infect the host epithelial cells. The H. pylori bacteria that were preincubated in CM from inhibitory lactobacilli attached less to the host cells than the H. pylori that were preincubated in the control medium or in CM from noninhibitory lactobacilli (Fig. 5B). These data indicate that lactobacilli have a direct effect on H. pylori binding capacity and that they are not acting through the host cells.

FIG 5.

FIG 5

Lactobacilli directly affect H. pylori adhesion capacity. L.gas1, L. gasseri Kx 110 A1; L.bre, L. brevis ATCC 14869; L.sal1, L. salivarius LMG 9477. (A) Adhesion of H. pylori to live and formaldehyde-fixed host epithelial cells. H. pylori strain 67:21 (Hp) bacteria alone or together with lactobacilli were added to the host AGS cells at an MOI of 100 for each strain and allowed to adhere for 2 h. The number of adherent bacteria was determined by the viable count assay. (B) Adhesion of H. pylori to host cells after preincubation of H. pylori in conditioned medium from lactobacilli. Adhesion of the bacteria was determined by the viable count assay. The numbers of CFU/ml were determined by serial dilution and plating. The data shown are representative of three independent experiments with triplicate samples. The differences between groups were analyzed using ANOVA (analysis of variance), followed by the Bonferroni post hoc test. The error bars represent standard deviations. ns, nonsignificant difference. An asterisk indicates a statistically significant difference (P < 0.05) from the results for H. pylori alone.

Lactobacilli affect H. pylori attachment by inhibiting sabA expression.

H. pylori expresses several adhesins that mediate attachment to host surfaces. SabA, BabA, and AlpA/B are among the most studied adhesins of H. pylori and bind to sialyl-Lewis X, Lewis B antigen, and laminin, respectively (14, 34, 35). CagL uses beta-integrins on the host cells as a receptor (36), whereas LabA interacts with the LacdiNAc motif on gastric mucins (37). However, H. pylori also expresses other putative adhesins, like OipA, HopZ, and HorB, for which the receptors have not yet been identified (38–40). Because lactobacilli can reduce the binding capacity of H. pylori, we examined the expression of adhesins by qPCR after incubation in CM from live lactobacilli. We determined that several genes were differentially regulated, but the most pronounced decrease was observed for the sabA gene, and this also matches the inhibition pattern observed in the adhesion assays. Among the tested adhesion-associated genes, some showed differences in expression but only when H. pylori was incubated in CM from L. brevis ATCC 14869. Interestingly, L. brevis ATCC 14869, but not L. gasseri Kx 110 A1, or L. salivarius LMG 9477, induced significant 2-fold upregulation of babA, oipA, and hopZ. This indicates that certain lactobacillus strains may also induce adhesion genes. However, this 2-fold gene upregulation did not alter the host cell attachment level of H. pylori. Expression of alpA, alpB, horB, and labA was not affected (Fig. 6A). Interestingly, sabA was the only gene that was downregulated by the CM from both L. gasseri Kx 110 A1 and L. brevis ATCC 14869, whereas it remained unaltered upon incubation with CM from the noninhibitory L. salivarius LMG 9477 (Fig. 6A). To confirm changes also in SabA protein expression, we performed a Western blot analysis using SabA antibodies. As shown in Fig. 6B, SabA protein expression as detected by Western blotting was also reduced after incubation with CM from lactobacilli. In addition, we confirmed that inhibitory lactobacilli reduced sabA not only in strain 67:21 but also in strains J99 and SS1 (see Fig. S2 in the supplemental material). Similar to the findings of a previous report (41), the SabA mutant available in strain J99 adhered less to host epithelial cells than did the wild-type H. pylori (Fig. 6C), confirming the importance of SabA in adhesion. Lactobacilli were unable to reduce the attachment of the SabA mutant (Fig. 6C), suggesting that lactobacilli affect SabA-mediated adhesion. In conclusion, these data suggest that lactobacilli directly reduce the binding capacity of H. pylori through inhibition of the SabA adhesin at a transcriptional level.

FIG 6.

FIG 6

Lactobacilli inhibit SabA expression. L.gas1, L. gasseri Kx 110 A1; L.bre, L. brevis ATCC 14869; L.sal1, L. salivarius LMG 9477. (A) Analysis of mRNA expression of different H. pylori colonization-associated genes by qPCR after incubation of H. pylori strain 67:21 in conditioned medium from lactobacilli for 2 h. The results were obtained in three independent experiments with duplicate samples. (B) Analysis of SabA expression levels in strain 67:21 by quantitative Western blotting. The results were obtained in two independent experiments with duplicate samples. (C) Adhesion of wild-type H. pylori (J99 WT) and an H. pylori mutant deficient in SabA (J99ΔsabA) to host cells alone and together with lactobacilli. Adhesion of the bacteria was determined by a viable count assay. The numbers of CFU/ml were determined by serial dilution and plating. The adhesion data shown are representative of three independent experiments with triplicate samples. The differences between groups were analyzed using ANOVA (analysis of variance), followed by the Bonferroni post hoc test. The error bars represent standard deviations. ns, nonsignificant difference. An asterisk indicates a statistically significant difference (P < 0.05) from the results for H. pylori alone.

DISCUSSION

The microbiota of the human gastrointestinal tract has an important role in protection against pathogens. However, the mechanisms by which this occurs are less well known. In this study, we attempted to elucidate if and how lactobacilli can inhibit the colonization of the gastric pathogen H. pylori. By screening 28 different lactobacillus strains, we found that only certain strains were able to reduce H. pylori adhesion to gastric epithelial cells. This inhibitory action is most likely mediated by an effector molecule that can be released into the environment. We also showed that the host cells do not play a role in this process but rather that the lactobacilli act directly on H. pylori itself. Lactobacilli reduced the expression of the adhesin-encoding gene sabA, thereby reducing the ability of H. pylori to bind to host cell receptors.

It has been reported that the inhibition of pathogen colonization by lactobacilli is strain specific (42), and our results of screening different lactobacillus strains confirm these reports. Two out of three L. gasseri strains had an antiadhesive effect. Interestingly, the two inhibitory strains were isolated from human gastric biopsy specimens, while the third was sampled from the human vagina. This could indicate adaptation of the lactobacillus strains to their environment and the pathogens they encounter. However, habitat location is not a determinative factor, because not all isolates from gastric biopsy specimens were able to block H. pylori adhesion.

We show that a released effector molecule in conditioned medium from lactobacilli can reduce H. pylori attachment. The nature of the effector molecule remains to be determined. It might be a surface-associated molecule that is released or an actively secreted compound that is not normally part of the bacterial surface. Formaldehyde-fixed or heat-killed lactobacilli were still able to reduce H. pylori attachment, indicating a fixation- and heat-resistant effector molecule.

We demonstrate that the inhibitory Lactobacillus isolates directly reduce H. pylori adhesion capacity and that the host epithelial cells are not active in this process. Additionally, competition for space on the host cells was not a contributing factor in this study. This is in agreement with the fact that most bacteria in the gastrointestinal tract reside in the mucus layer lining the epithelium (8, 43). Theinhibition of H. pylori adhesion by lactobacilli would appear to be more effective if acting directly on H. pylori rather than via the host epithelium.

The fact that lactobacilli reduce sabA mRNA expression and that lactobacilli cannot inhibit adhesion of a sabA mutant strain of H. pylori indicates that the lactobacilli have an effect on this particular adhesin. In vivo experiments showed that inhibitory lactobacilli, but not noninhibitory lactobacilli, reduced gastric levels of the mouse-adapted H. pylori strain SS1 at a time point of 6 h. The sabA mutant available in strain J99 bound less in vitro to gastric AGS cells at 2 h (Fig. 6B). It is tempting to speculate that reduction of sabA by certain lactobacilli might help to prevent H. pylori colonization in the stomach. Interestingly, the lactobacillus CM reduced the adherence of wild-type H. pylori more than the sabA mutant did, suggesting involvement of an additional factor. SabA expression is regulated by different mechanisms. Gene conversion due to intragenomic recombination allows variation in copy number and locus of the sabA gene (44). Two simple sequence repeats mediate slipped-strand mispairing, which leads to variation in expression. A dinucleotide cytosine-thymidine repeat in the 5′ coding region allows for phase variation, which turns the expression of SabA on and off (18). A T-tract, located at the promoter region, controls sabA transcription initiation because the T-tract length influences binding of the RNA polymerase (45, 46). Finally, the two-component signal transduction system ArsRS mediates the regulation of gene transcription by environmental changes. SabA has been shown to be derepressed in a mutant for the histidine kinase ArsS (47), which leads to more adhesion to the host cells due to higher sabA expression (18). These multiple regulatory mechanisms explain why the expression of SabA is found to be so variable between isolates (48, 49). Because the ArsRS system responds to environmental cues, this might be a probable candidate providing the lactobacilli with a means to repress sabA expression. It has been reported that an acidic pH is a key signal for the ArsRS system (50). However, protein expression studies at a neutral pH with an arsS mutant indicate that the ArsRS system also has a role in the regulation of the expression in the absence of the low pH stimulus and that the system might be able to respond to other environmental factors (51). Lactobacilli did not change the pH in our experiment, but they did release a molecule into the surroundings that causes an adhesion-inhibitory effect. It is tempting to speculate that the ArsRS system might respond to this component and thereby allow for the repression of sabA. Interestingly, L. brevis induced significant 2-fold induction of babA, oipA, and hopZ. This indicates that certain lactobacillus strains may also induce adhesion genes. However, the 2-fold induction did not alter H. pylori attachment to host cells. In the future, it would be interesting to find out whether any of these genes are under the control of ArsRS. Further, L. brevis ATCC 14869 slightly but significantly reduced cagL. However, there was also a trend that both noninhibitory and inhibitory lactobacilli reduced cagL, suggesting that the effect on cagL is not linked to attachment levels.

It has been well demonstrated that the microbiota is an important component of our defense against pathogens. In this study, we show that certain lactobacilli can reduce initial adhesion to host epithelial cells by affecting the binding capacity of H. pylori. The ability of some lactobacilli, but not all, to interfere with H. pylori virulence gene expression is intriguing and prompts further studies to identify the lactobacillus component as well its mechanism of action. In the future, it would be interesting to also evaluate the role of lactobacilli in long-term colonization of H. pylori using available model systems. Understanding the molecular mechanisms by which the microbiota inhibits pathogen colonization may reveal new knowledge of bacterial pathogenesis and help in the development of novel, more effective treatment strategies against bacterial infections.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We thank Anna Arnqvist and Thomas Boren for providing the SabA antibody.

We have no conflicts of interest.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/IAI.00163-16.

REFERENCES

  • 1.Reid G, Younes JA, Van der Mei HC, Gloor GB, Knight R, Busscher HJ. 2011. Microbiota restoration: natural and supplemented recovery of human microbial communities. Nat Rev Microbiol 9:27–38. doi: 10.1038/nrmicro2473. [DOI] [PubMed] [Google Scholar]
  • 2.O'Hara AM, Shanahan F. 2006. The gut flora as a forgotten organ. EMBO Rep 7:688–693. doi: 10.1038/sj.embor.7400731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Berg RD. 1996. The indigenous gastrointestinal microflora. Trends Microbiol 4:430–435. doi: 10.1016/0966-842X(96)10057-3. [DOI] [PubMed] [Google Scholar]
  • 4.Marchesi JR, Adams DH, Fava F, Hermes GD, Hirschfield GM, Hold G, Quraishi MN, Kinross J, Smidt H, Tuohy KM, Thomas LV, Zoetendal EG, Hart A. 2015. The gut microbiota and host health: a new clinical frontier. Gut 65:330–339. doi: 10.1136/gutjnl-2015-309990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dunne C, Dolan B, Clyne M. 2014. Factors that mediate colonization of the human stomach by Helicobacter pylori. World J Gastroenterol 20:5610–5624. doi: 10.3748/wjg.v20.i19.5610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hessey SJ, Spencer J, Wyatt JI, Sobala G, Rathbone BJ, Axon AT, Dixon MF. 1990. Bacterial adhesion and disease activity in Helicobacter associated chronic gastritis. Gut 31:134–138. doi: 10.1136/gut.31.2.134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hidaka E, Ota H, Hidaka H, Hayama M, Matsuzawa K, Akamatsu T, Nakayama J, Katsuyama T. 2001. Helicobacter pylori and two ultrastructurally distinct layers of gastric mucous cell mucins in the surface mucous gel layer. Gut 49:474–480. doi: 10.1136/gut.49.4.474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Schreiber S, Konradt M, Groll C, Scheid P, Hanauer G, Werling HO, Josenhans C, Suerbaum S. 2004. The spatial orientation of Helicobacter pylori in the gastric mucus. Proc Natl Acad Sci U S A 101:5024–5029. doi: 10.1073/pnas.0308386101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hatakeyama M. 2014. Helicobacter pylori CagA and gastric cancer: a paradigm for hit-and-run carcinogenesis. Cell Host Microbe 15:306–316. doi: 10.1016/j.chom.2014.02.008. [DOI] [PubMed] [Google Scholar]
  • 10.de Bernard M, Josenhans C. 2014. Pathogenesis of Helicobacter pylori infection. Helicobacter 19(Suppl 1):S11–S18. doi: 10.1111/hel.12160. [DOI] [PubMed] [Google Scholar]
  • 11.Sibony M, Jones NL. 2012. Recent advances in Helicobacter pylori pathogenesis. Curr Opin Gastroenterol 28:30–35. doi: 10.1097/MOG.0b013e32834dda51. [DOI] [PubMed] [Google Scholar]
  • 12.Palframan SL, Kwok T, Gabriel K. 2012. Vacuolating cytotoxin A (VacA), a key toxin for Helicobacter pylori pathogenesis. Front Cell Infect Microbiol 2:92. doi: 10.3389/fcimb.2012.00092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Patel A, Shah N, Prajapati JB. 2014. Clinical application of probiotics in the treatment of Helicobacter pylori infection—a brief review. J Microbiol Immunol Infect 47:429–437. doi: 10.1016/j.jmii.2013.03.010. [DOI] [PubMed] [Google Scholar]
  • 14.Mahdavi J, Sonden B, Hurtig M, Olfat FO, Forsberg L, Roche N, Angstrom J, Larsson T, Teneberg S, Karlsson KA, Altraja S, Wadstrom T, Kersulyte D, Berg DE, Dubois A, Petersson C, Magnusson KE, Norberg T, Lindh F, Lundskog BB, Arnqvist A, Hammarstrom L, Boren T. 2002. Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science 297:573–578. doi: 10.1126/science.1069076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bjorkholm B, Lundin A, Sillen A, Guillemin K, Salama N, Rubio C, Gordon JI, Falk P, Engstrand L. 2001. Comparison of genetic divergence and fitness between two subclones of Helicobacter pylori. Infect Immun 69:7832–7838. doi: 10.1128/IAI.69.12.7832-7838.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lee A, O'Rourke J, De Ungria MC, Robertson B, Daskalopoulos G, Dixon MF. 1997. A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain. Gastroenterology 112:1386–1397. doi: 10.1016/S0016-5085(97)70155-0. [DOI] [PubMed] [Google Scholar]
  • 17.Roos S, Engstrand L, Jonsson H. 2005. Lactobacillus gastricus sp. nov., Lactobacillus antri sp. nov, Lactobacillus kalixensis sp nov and Lactobacillus ultunensis sp nov, isolated from human stomach mucosa Int J Syst Evol Microbiol 55:77–82. [DOI] [PubMed] [Google Scholar]
  • 18.Goodwin AC, Weinberger DM, Ford CB, Nelson JC, Snider JD, Hall JD, Paules CI, Peek RM Jr, Forsyth MH. 2008. Expression of the Helicobacter pylori adhesin SabA is controlled via phase variation and the ArsRS signal transduction system. Microbiology 154:2231–2240. doi: 10.1099/mic.0.2007/016055-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tavares R, Pathak SK. 2015. Helicobacter pylori protein JHP0290 exhibits proliferative and anti-apoptotic effects in gastric epithelial cells. PLoS One 10:e0124407. doi: 10.1371/journal.pone.0124407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Johansson L, Rytkonen A, Bergman P, Albiger B, Kallstrom H, Hokfelt T, Agerberth B, Cattaneo R, Jonsson AB. 2003. CD46 in meningococcal disease. Science 301:373–375. doi: 10.1126/science.1086476. [DOI] [PubMed] [Google Scholar]
  • 21.Johansson L, Rytkonen A, Wan H, Bergman P, Plant L, Agerberth B, Hokfelt T, Jonsson AB. 2005. Human-like immune responses in CD46 transgenic mice. J Immunol 175:433–440. doi: 10.4049/jimmunol.175.1.433. [DOI] [PubMed] [Google Scholar]
  • 22.Sjolinder H, Jonsson AB. 2007. Imaging of disease dynamics during meningococcal sepsis. PLoS One 2:e241. doi: 10.1371/journal.pone.0000241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Basmarke-Wehelie R, Sjolinder H, Jurkowski W, Elofsson A, Arnqvist A, Engstrand L, Hagner M, Wallin E, Guan N, Kuranasekera H, Aro H, Jonsson AB. 2011. The complement regulator CD46 is bactericidal to Helicobacter pylori and blocks urease activity. Gastroenterology 141:918–928. doi: 10.1053/j.gastro.2011.05.009. [DOI] [PubMed] [Google Scholar]
  • 24.Sasaki M, Joh T, Tada T, Okada N, Yokoyama Y, Itoh M. 1998. Altered expression of membrane inhibitors of complement in human gastric epithelium during Helicobacter-associated gastritis. Histopathology 33:554–560. doi: 10.1046/j.1365-2559.1998.00539.x. [DOI] [PubMed] [Google Scholar]
  • 25.Huesca M, Borgia S, Hoffman P, Lingwood CA. 1996. Acidic pH changes receptor binding specificity of Helicobacter pylori: a binary adhesion model in which surface heat shock (stress) proteins mediate sulfatide recognition in gastric colonization. Infect Immun 64:2643–2648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Linden S, Mahdavi J, Hedenbro J, Boren T, Carlstedt I. 2004. Effects of pH on Helicobacter pylori binding to human gastric mucins: identification of binding to non-MUC5AC mucins. Biochem J 384:263–270. doi: 10.1042/BJ20040402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Linden SK, Wickstrom C, Lindell G, Gilshenan K, Carlstedt I. 2008. Four modes of adhesion are used during Helicobacter pylori binding to human mucins in the oral and gastric niches. Helicobacter 13:81–93. doi: 10.1111/j.1523-5378.2008.00587.x. [DOI] [PubMed] [Google Scholar]
  • 28.Midolo PD, Lambert JR, Hull R, Luo F, Grayson ML. 1995. In vitro inhibition of Helicobacter pylori NCTC 11637 by organic acids and lactic acid bacteria. J Appl Bacteriol 79:475–479. doi: 10.1111/j.1365-2672.1995.tb03164.x. [DOI] [PubMed] [Google Scholar]
  • 29.Aiba Y, Suzuki N, Kabir AMA, Takagi A, Koga Y. 1998. Lactic acid-mediated suppression of Helicobacter pylori by the oral administration of Lactobacillus salivarius as a probiotic in a gnotobiotic murine model. Am J Gastroenterol 93:2097–2101. doi: 10.1111/j.1572-0241.1998.00600.x. [DOI] [PubMed] [Google Scholar]
  • 30.Sgouras D, Maragkoudakis P, Petraki K, Martinez-Gonzalez B, Eriotou E, Michopoulos S, Kalantzopoulos G, Tsakalidou E, Mentis A. 2004. In vitro and in vivo inhibition of Helicobacter pylori by Lactobacillus casei strain Shirota. Appl Environ Microbiol 70:518–526. doi: 10.1128/AEM.70.1.518-526.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zheng PX, Fang HY, Yang HB, Tien NY, Wang MC, Wu JJ. 2014. Lactobacillus pentosus strain LPS16 produces lactic acid, inhibiting multidrug-resistant Helicobacter pylori. J Microbiol Immunol Infect. doi: 10.1016/j.jmii.2014.04.014. [DOI] [PubMed] [Google Scholar]
  • 32.Cotter PD, Hill C, Ross RP. 2005. Bacteriocins: developing innate immunity for food. Nat Rev Microbiol 3:777–788. doi: 10.1038/nrmicro1273. [DOI] [PubMed] [Google Scholar]
  • 33.Martin R, Suarez JE. 2010. Biosynthesis and degradation of H2O2 by vaginal lactobacilli. Appl Environ Microbiol 76:400–405. doi: 10.1128/AEM.01631-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ilver D, Arnqvist A, Ogren J, Frick IM, Kersulyte D, Incecik ET, Berg DE, Covacci A, Engstrand L, Boren T. 1998. Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science 279:373–377. doi: 10.1126/science.279.5349.373. [DOI] [PubMed] [Google Scholar]
  • 35.Senkovich OA, Yin J, Ekshyyan V, Conant C, Traylor J, Adegboyega P, McGee DJ, Rhoads RE, Slepenkov S, Testerman TL. 2011. Helicobacter pylori AlpA and AlpB bind host laminin and influence gastric inflammation in gerbils. Infect Immun 79:3106–3116. doi: 10.1128/IAI.01275-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kwok T, Zabler D, Urman S, Rohde M, Hartig R, Wessler S, Misselwitz R, Berger J, Sewald N, Konig W, Backert S. 2007. Helicobacter exploits integrin for type IV secretion and kinase activation. Nature 449:862–866. doi: 10.1038/nature06187. [DOI] [PubMed] [Google Scholar]
  • 37.Rossez Y, Gosset P, Boneca IG, Magalhaes A, Ecobichon C, Reis CA, Cieniewski-Bernard C, Joncquel Chevalier Curt M, Leonard R, Maes E, Sperandio B, Slomianny C, Sansonetti PJ, Michalski JC, Robbe-Masselot C. 2014. The lacdiNAc-specific adhesin LabA mediates adhesion of Helicobacter pylori to human gastric mucosa. J Infect Dis 210:1286–1295. doi: 10.1093/infdis/jiu239. [DOI] [PubMed] [Google Scholar]
  • 38.Dossumbekova A, Prinz C, Mages J, Lang R, Kusters JG, Van Vliet AH, Reindl W, Backert S, Saur D, Schmid RM, Rad R. 2006. Helicobacter pylori HopH (OipA) and bacterial pathogenicity: genetic and functional genomic analysis of hopH gene polymorphisms. J Infect Dis 194:1346–1355. doi: 10.1086/508426. [DOI] [PubMed] [Google Scholar]
  • 39.Peck B, Ortkamp M, Diehl KD, Hundt E, Knapp B. 1999. Conservation, localization and expression of HopZ, a protein involved in adhesion of Helicobacter pylori. Nucleic Acids Res 27:3325–3333. doi: 10.1093/nar/27.16.3325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Snelling WJ, Moran AP, Ryan KA, Scully P, McGourty K, Cooney JC, Annuk H, O'Toole PW. 2007. HorB (HP0127) is a gastric epithelial cell adhesin. Helicobacter 12:200–209. doi: 10.1111/j.1523-5378.2007.00499.x. [DOI] [PubMed] [Google Scholar]
  • 41.Skindersoe ME, Rasmussen L, Andersen LP, Krogfelt KA. 2015. A novel assay for easy and rapid quantification of Helicobacter pylori adhesion. Helicobacter 20:199–205. doi: 10.1111/hel.12191. [DOI] [PubMed] [Google Scholar]
  • 42.Ryan KA, Daly P, Li Y, Hooton C, O'Toole PW. 2008. Strain-specific inhibition of Helicobacter pylori by Lactobacillus salivarius and other lactobacilli. J Antimicrob Chemother 61:831–834. doi: 10.1093/jac/dkn040. [DOI] [PubMed] [Google Scholar]
  • 43.Johansson ME, Phillipson M, Petersson J, Velcich A, Holm L, Hansson GC. 2008. The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc Natl Acad Sci U S A 105:15064–15069. doi: 10.1073/pnas.0803124105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Talarico S, Whitefield SE, Fero J, Haas R, Salama NR. 2012. Regulation of Helicobacter pylori adherence by gene conversion. Mol Microbiol 84:1050–1061. doi: 10.1111/j.1365-2958.2012.08073.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kao CY, Sheu SM, Sheu BS, Wu JJ. 2012. Length of thymidine homopolymeric repeats modulates promoter activity of sabA in Helicobacter pylori. Helicobacter 17:203–209. doi: 10.1111/j.1523-5378.2012.00936.x. [DOI] [PubMed] [Google Scholar]
  • 46.Aberg A, Gideonsson P, Vallstrom A, Olofsson A, Ohman C, Rakhimova L, Boren T, Engstrand L, Brannstrom K, Arnqvist A. 2014. A repetitive DNA element regulates expression of the Helicobacter pylori sialic acid binding adhesin by a rheostat-like mechanism. PLoS Pathog 10:e1004234. doi: 10.1371/journal.ppat.1004234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Forsyth MH, Cao P, Garcia PP, Hall JD, Cover TL. 2002. Genome-wide transcriptional profiling in a histidine kinase mutant of Helicobacter pylori identifies members of a regulon. J Bacteriol 184:4630–4635. doi: 10.1128/JB.184.16.4630-4635.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Odenbreit S, Swoboda K, Barwig I, Ruhl S, Boren T, Koletzko S, Haas R. 2009. Outer membrane protein expression profile in Helicobacter pylori clinical isolates. Infect Immun 77:3782–3790. doi: 10.1128/IAI.00364-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Shao L, Takeda H, Fukui T, Mabe K, Han J, Kawata S, Ootani K, Fukao A. 2010. Genetic diversity of the Helicobacter pylori sialic acid-binding adhesin (sabA) gene. Biosci Trends 4:249–253. [PubMed] [Google Scholar]
  • 50.Pflock M, Dietz P, Schar J, Beier D. 2004. Genetic evidence for histidine kinase HP165 being an acid sensor of Helicobacter pylori. FEMS Microbiol Lett 234:51–61. doi: 10.1111/j.1574-6968.2004.tb09512.x. [DOI] [PubMed] [Google Scholar]
  • 51.Loh JT, Gupta SS, Friedman DB, Krezel AM, Cover TL. 2010. Analysis of protein expression regulated by the Helicobacter pylori ArsRS two-component signal transduction system. J Bacteriol 192:2034–2043. doi: 10.1128/JB.01703-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES