Abstract
Background
Muscle wasting, a prominent feature of cancer cachexia, is mainly caused by sustained protein hypercatabolism. The enhanced muscle protein degradation rates rely on the activity of different proteolytic systems, although the Adenosine triphosphate (ATP)‐ubiquitin‐proteasome‐dependent pathway and autophagy have been shown to play a pivotal role. Bortezomib is a potent reversible and selective proteasome and NF‐κB inhibitor approved for the clinical use, which has been shown to be effective in preventing muscle wasting in different catabolic conditions. The aim of the present study has been to investigate whether pharmacological inhibition of proteasome by bortezomib may prevent skeletal muscle wasting in experimental cancer cachexia.
Methods
Cancer cachexia was induced in rats by intraperitoneal injection of Yoshida AH‐130 ascites hepatoma cells and in mice by subcutaneous inoculation of C26 carcinoma cells. Animals were then further randomized to receive bortezomib. The AH‐130 hosts were weighted and sacrificed under anaesthesia, on Days 3, 4, 5, and 7 after tumour inoculation, while C26‐bearing mice were weighted and sacrificed under anaesthesia 12 days after tumour transplantation. NF‐κB and proteasome activation, MuRF1 and atrogin‐1 mRNA expression and beclin‐1 protein levels were evaluated in the gastrocnemius of controls and AH‐130 hosts.
Results
Bortezomib administration in the AH‐130 hosts, although able to reduce proteasome and NF‐κB DNA‐binding activity in the skeletal muscle on Day 7 after tumour transplantation, did not prevent body weight loss and muscle wasting. In addition, bortezomib exerted a transient toxicity, as evidenced by the reduced food intake and by the increase in NF‐κB DNA‐binding activity in the AH‐130 hosts 3 days after tumour transplantation. Beclin‐1 protein levels were increased by bortezomib treatment in Day 3 controls but were unchanged on both Days 3 and 7 in the AH‐130 hosts, suggesting that an early compensatory induction of autophagy may exist in healthy but not in tumour‐bearing animals. Regarding C26‐bearing mice, bortezomib did not prevent as well body and muscle weight loss 12 days after tumour implantation.
Conclusions
The results obtained suggest that proteasome inhibition by bortezomib is not able to prevent muscle wasting in experimental cancer cachexia. Further studies are needed to address the issue whether a different dosage of bortezomib alone or in combination with other drugs modulating different molecular pathways may effectively prevent muscle wasting during cancer cachexia.
Keywords: Cancer cachexia, Muscle wasting, Proteasome, Bortezomib
Introduction
Muscle wasting is by far the most clinically relevant feature of cancer cachexia, a life‐threatening syndrome associated with poor prognosis and impaired quality of life.1 The mechanisms underlying muscle wasting in cancer cachexia are not yet fully understood, but studies performed in experimental models as well as in neoplastic patients have shown that a prominent role is played by sustained protein hypercatabolism.2 The enhanced muscle protein degradation rates result from hyperactivation of different proteolytic systems, but the degradative pathways dependent on proteasome and autophagy have been shown to play a prominent role.3, 4 The former relies on ubiquitylation of target proteins, which are subsequently degraded by the 26S proteasome, a multicatalytic complex, that contains a core (20S proteasome), which is characterized by five different peptidase activities: trypsin‐like, chymotrypsin‐like, peptidyl‐glutamyl peptidase, branched‐chain amino acid‐preferring, and small‐neutral amino acid‐preferring activities.5
Several chemical compounds able to inhibit proteasome activity have been described including peptide analogues of substrates with different C‐terminal groups such as aldehydes, epoxyketones, boronic acids, and vinyl sulfones.6, 7 Interestingly, different proteasome inhibitors have proved effective in preventing muscle wasting in many experimental conditions such as sepsis, burn injury, cancer, immobilization, and denervation atrophy.8, 9, 10, 11, 12 However, in recent years, bortezomib has attracted particular attention, as it was the first proteasome inhibitor approved for clinical use.13 Bortezomib is a selective dipeptide boronic acid analogue that works primarily by reversible inhibition of the chymotrypsin‐like site in the β5‐subunit of the 20S proteasome, but it can also inhibit the caspase‐like site (β1‐subunit) at high concentration and minimally affect the trypsin‐like site (β2‐subunit).14, 15, 16 Proteasome blockade by bortezomib results in many effects such as inhibition of angiogenesis, of NF‐κB activation, and of cytokine and growth factor production, apoptosis induction, cell cycle arrest.17, 18 Bortezomib has been approved by the Food and Drug Administration in 2003 as a third‐line treatment for relapsed and refractory multiple myeloma,19 in 2005 for multiple myeloma progressing after at least one prior therapy,20 and in 2008, it has been evaluated in a phase III clinical trial also as front‐line treatment for newly diagnosed multiple myeloma patients.21, 22 Bortezomib is also approved for mantle cell lymphoma,23 and trials in other conditions are in progress.24, 25, 26, 27, 28
Bortezomib has been reported to effectively prevent muscle wasting in different experimental catabolic conditions associated with proteasome hyperactivation such as burn injury,29 denervation atrophy,30 diaphragm weakness in COPD,31 and Duchenne muscular dystrophy.32, 33 However, bortezomib has been shown to only partially attenuate muscle atrophy caused by hindlimb casting34 and to prevent endotoxin‐induced diaphragm weight loss but not specific force reduction.35 As for cancer cachexia, bortezomib has been recently reported to be unable to restore muscle mass in mice implanted with LP07 adenocarcinoma,36, 37 and a subanalysis from two clinical trials suggested that bortezomib does not attenuate weight loss in patients with advanced pancreatic cancer.38 These observations, however, do not rule out that bortezomib may be effective in treating cancer‐related muscle wasting as differences in the level of proteasome activity may exist among different tumour stages as well as in different tumour types.39, 40, 41, 42 Indeed, while proteasome activity is increased in the skeletal muscle of gastric cancer patients and correlates with disease severity,39, 40 it is not modified in the skeletal muscle of esophageal41 and non‐small cell lung cancer patients.42 This would suggest that proteasome inhibition may differentially affect cancer‐related muscle wasting; hence, the role of bortezomib in the treatment of cancer cachexia is still incompletely understood.
In the present study, we therefore investigated whether pharmacological inhibition of proteasome by bortezomib may attenuate skeletal muscle wasting in rats bearing the Yoshida AH‐130 ascites hepatoma, a well‐described model of cancer cachexia associated to hyperactivation of the ubiquitin‐proteasome pathway.43, 44, 45, 46 Additional experiments were performed to evaluate bortezomib effectiveness in preventing body and muscle weight loss in mice implanted with the C26 colon adenocarcinoma, another experimental model of cancer cachexia associated to severe muscle wasting.47, 48
Material and methods
Animals
Experimental animals were cared for in compliance with the Italian Ministry of Health Guidelines (no. 86609 EEC, permit number 106/2007‐B) and the Policy on Humane Care and Use of Laboratory Animals (NIH 1996). The experimental protocol was approved by the Bioethical Committee of the University of Turin (Turin, Italy).
Male Wistar rats weighing approximately 150 g and male Balb‐c mice weighing approximately 20 g were obtained from Charles River Laboratories (Calco, Italy) and were maintained on a regular dark‐light cycle (light from 8 a.m. to 8 p.m.), with free access to food and water during the whole experimental period.
Tumour‐bearing rats received an i.p. inoculum of approximately 108 Yoshida AH‐130 ascites‐hepatoma cells whereas tumour‐bearing mice were inoculated s.c. dorsally with 5 × 105 C26 carcinoma cells. Control rats and mice were inoculated with a correspondent volume of vehicle (saline). Animals (rats or mice) were then further randomized to receive bortezomib (Velcade®, Millennium Pharmaceuticals, Cambridge MA, USA) or corresponding volume of vehicle (saline). In particular, two days after transplantation, rats were administered bortezomib (0.25 mg/kg, i.v., single dose), while mice received the drug (0.5 mg/kg, i.v.) on Day 7 after tumour transplantation and 4 h before sacrifice. The dose was chosen in view of results obtained in dose‐response experiments (data not shown).
Animal weight and food intake were recorded daily throughout the entire experiment.
As for the AH‐130 hosts, on Days 3, 4, 5, and 7 after tumour inoculation, rats were weighted and sacrificed under anaesthesia; mice were sacrificed under anaesthesia 12 days after C26 transplantation. Muscles and organs were rapidly excised, weighed, frozen in liquid nitrogen, and stored at −80°C until analysis.
Western blot
Approximately 50 mg of gastrocnemius muscle was homogenized in 80 mmol/L Tris‐HCl, pH 6.8, containing 100 mmol/L dithiothreitol, 70 mmol/L Sodium dodecyl sulfate (SDS), and 1 mmol/L glycerol, with freshly added protease and phosphatase inhibitor cocktails; kept on ice for 30 min; centrifuged at 15 000 g for 10 min at 4°C and the supernatant collected. Protein concentration was assayed according to Bradford using bovine serum albumin as working standard. Equal amounts of protein (30 mg) were heat denaturated in sample‐loading buffer (50 mmol/L Tris‐HCl, pH 6.8, 100 mmol/L dithiothreitol, 2% SDS, 0.1% bromophenol blue, 10% glycerol), resolved by SDS‐PolyAcrylamide Gel Electrophoresis (PAGE), and transferred to nitrocellulose membranes (Bio‐ Rad Laboratories, Hercules, CA). The filters were blocked with Tris‐buffered saline containing 0.05% Tween and 5% non‐fat dry milk and incubated overnight with an antibody directed against beclin‐1 (B6186, Sigma, St. Louis, MO, USA). A mouse monoclonal anti‐rat α‐tubulin antibody (T5168, Sigma‐Aldrich, St. Louis, MO) was used for loading control. Peroxidase‐conjugated IgG (Bio‐Rad Laboratories) were used as secondary antibodies. Immunoreactive protein bands were detected by enhanced chemoluminescence. Quantification of the bands was performed by densitometric analysis using specific software version 2006c (TotalLab; Nonlinear Dynamics, Newcastle on Tyne, UK).
Proteasome activity
Proteasome chymotrypsin‐like activity in the gastrocnemius was determined by cleavage of a specific fluorogenic substrate as previously described.40, 43
Briefly, gastrocnemius was homogenized in 20 mM Tris–HCl, pH 7.2, containing 0.1 mM EDTA, 1 mM 2‐mercaptoethanol, 5 mM ATP, 20% glycerol, 0.04% (v/v) Nonidet P‐40. Muscle homogenates were then centrifuged at 13 000 g for 15 min at 4°C. The supernatant was collected and protein concentration determined as described in the previous text. Aliquots of 50 µg protein were then incubated for 60 min at 37°C in the presence of the fluorogenic substrate succinyl‐Leu‐Leu‐Val‐Tyr‐7‐amino‐methyl‐coumarin (LLVY, Sigma, St. Louis, MO, USA). The incubation buffer was 50 mM Hepes, pH 8.0, containing 5 mM Ethylene glycol‐bis(2‐aminoethylether)‐N,N,N',N'‐tetraacetic acid (EGTA). Fluorescence was read with a spectrofluorometer (excitation: 380 nm, emission: 460 nm; Perkin–Elmer,Norwalk, CT, USA). The activity, expressed as nkatal/mg protein, was calculated by using free amino‐methyl‐coumarin as working standard.
Electrophoretic mobility shift assay
To prepare nuclear extracts, gastrocnemius (100 mg) was homogenized in ice‐cold 10 mm 4‐(2‐Hydroxyethyl)piperazine‐1‐ethanesulfonic acid (HEPES), pH 7.5, containing 10 mM MgCl2, 5 mM KCl, 0.1 mM EDTA pH 8.0, 0.1% Triton X‐100, 0.1 mM phenylmethanesulfonyl fluoride, 1 mM DL‐Dithiothreitol (DTT), 2 µg/ml aprotinin, 2 µg/ml leupeptin. Samples were centrifuged (5 min, 3000 g), pellets resuspended in ice‐cold 20 mM HEPES, pH 7.9, containing 25% glycerol, 500 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, pH 8.0, 0.2 mM phenylmethanesulfonyl fluoride, 0.5 mM DTT, 2 µg/ml aprotinin, 2 µg/ml leupeptin, and incubated on ice for 30 min. Cell debris were removed by centrifugation (5 min, 3000 g), the supernatant collected and stored at −80°C. NF‐κB oligonucleotides were purchased from Promega Italia (Milano, Italy). Oligonucleotide labelling and binding reactions were performed by using the Gel Shift Assay System (Promega, Milan, Italy). Binding reaction mixtures, containing nuclear proteins (10 µg) and gel shift binding buffer [10 mm Tris‐HCl, pH 7.5, containing 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 0.05 µg//μL poly(dI‐dC)·poly(dI‐dC), 4% glycerol], were incubated (10 min) at room temperature in the presence of 0.035 pmol 32P‐ATP end‐labelled double‐stranded oligonucleotide. After incubation, samples were electrophoresed in 0.5× Tris‐Borate‐EDTA buffer at 350 V for 40 min on a 4% non‐denaturing acrylamide gel. The gel was dried (45 min) and exposed overnight or longer to an autoradiography film (GE Healthcare, Milan, Italy) at −80°C with intensifying screens. Bands specificity was confirmed by adding an excess amount of a specific oligonucleotide (1.75 pmol) to a control gastrocnemius sample. HeLa cell nuclear extract was used as positive control (Promega, Milan, Italy).
Semi‐quantitative reverse transcriptase (RT)‐PCR
Total RNA was extracted from the gastrocnemius muscle with the TriPure reagent (Roche, Indianapolis, USA), and quantified spectrophotometrically. RNA integrity was checked by electrophoresis on 1.2% agarose gel, containing 10% 3‐(N‐morpholino)propanesulfonic acid (MOPS) 0.2 M and 18% formaldehyde.
Atrogin‐1 and MuRF1 mRNA levels were analysed by semi‐quantitative reverse‐transcription polymerase chain reaction using the kit ‘Ready‐to‐Go RT‐PCR Beads’ (Hybond C, Amersham Italia, Milano, Italy). Aliquots of total RNA (0.5 µg) were added to a RT‐PCR reaction mixture containing PCR buffer (10 mM Tris‐HCl pH 9.0, 60 mM KCl, 1.5 mM MgCl2), Taq DNA‐polymerase 2.0 units, 10 μM of each primer, and 200 μM deoxynucleotide triphosphate (dNTP). Primers for atrogin‐1, MuRF1, and Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH), described in Table 1, were obtained according to published sequences (Invitrogen, Milano, Italy).
Table 1.
Oligonucleotide sequences
Gene | Primer sequence | NCBI reference sequence |
---|---|---|
Atrogin‐1 | 5′‐CCATCAGGAGAAGTGGATCTATGTT‐3′ 3′‐GCTTCCCCCAAAGTGCAGTA‐5′ | AY059628.1 |
MuRF‐1 | 5′‐GGACGGAAATGCTATGGAGA‐3′ 3′‐AACGACCTCCAGACATGGAC‐5′ | AY059627.1 |
GAPDH | 5′‐GGTGAAGGTCGGAGTCAACG‐3′ 3′‐CAAAGTTGTCATGGATGACC‐5′ | M17701.1 |
NCBI, National Center for Biotechnology Information
Amplification conditions consisted of 1 min denaturation at 95°C, 1 min annealing at 60°C, and 2 min polymerization at 72°C for each step for 25 cycles and extension at 72°C for 7 min. Positive and negative controls have been performed. PCR products were electrophoresed on 2% agarose gels and visualized with ethidium bromide. A standard DNA ladder was used to estimate the length of each PCR product. Quantification was performed by densitometric analysis: individual product bands and representative background were excised from each gel lane and analysed by means of a specific software (Phoretix). The results were normalized according to 18S ribosomal subunit expression, amplified with the following conditions: denaturation (95°C, 30 s), annealing (55°C, 1 min), polymerization (72°C, 2 min), for 10 cycles, and extension (72°C, 7 min). Comparisons among groups have been made in the linear phase of amplification.
Statistical analysis
Results are reported as means ± SD. Statistical analysis was performed by using the Student's t‐test or one‐way analysis of variance followed by Tukey's post‐hoc test as appropriate. P < 0.05 was considered statistically significant.
Results
The growth of the Yoshida AH‐130 hepatoma determined in the hosts a progressive body and gastrocnemius weight loss (Figure 1A and B), consistent with previous studies using the same experimental model.45, 49 Treatment with bortezomib did not affect cancer‐induced body and muscle weight loss on Day 3 after tumour inoculum, while on Day 7, it worsened the cachectic phenotype (Figure 1A and B). As for the liver (Figure 2A), it was reduced in size in tumour hosts starting from Day 5 after transplantation. Bortezomib treatment lead to an increase of liver mass in Day 4 controls only. No effect of bortezomib administration could be observed in controls at Days 3, 5, and 7 or in the tumour hosts (Days 3–7). No significant differences in spleen weight were observed in control and tumour‐bearing rats treated with bortezomib (Figure 2B). Food consumption in control rats was not modified by bortezomib (Figure 3A). In contrast, the drug exerted a marked reduction of food intake on Day 3 in tumour‐bearing rats (24 h after the first administration), when tumour‐induced anorexia is not yet detectable in this experimental model. Such a reduction was likely due to a transient toxic effect of the drug. Indeed, at the subsequent time points (Days 5 and 7), the reduced food intake that characterizes tumour‐bearing rats was not further affected by bortezomib treatment (Figure 3A). No significant changes were observed for water intake among all the experimental groups (Figure 3B).
Figure 1.
Bortezomib does not prevent body and gastrocnemius muscle weight loss in AH‐130‐bearing rats. (A) Body and (B) gastrocnemius weight were evaluated in controls (C) and tumour‐bearing rats (AH‐130) treated or untreated with bortezomib (BTZ) at Day 3 (d3) and Day 7 (d7) after AH‐130 cell inoculation. Results (means ± SD) are expressed as percentage of controls (C and C + BTZ: n = 4; AH‐130, AH‐130 + BTZ: n = 8). *P < 0.05, **P < 0.01, ***P < 0.001 vs. control.
Figure 2.
Effects of bortezomib on liver and spleen weight. (A) Liver and (B) spleen weight were evaluated in controls (C) and tumour‐bearing rats (AH‐130) treated or untreated with bortezomib (BTZ) at Day 3 (d3), Day 4 (d4), Day 5 (d5), and Day 7 (d7) after AH‐130 cell inoculation. Results (means ± SD) are expressed as percentage of controls (C and C + BTZ: n = 4; AH‐130, AH‐130 + BTZ: n = 8). *P < 0.05, **P < 0.01 vs. control; ¶ P < 0.05 vs. C + BTZ.
Figure 3.
Effects of bortezomib on food and water intake. (A) Food intake and (B) water intake were evaluated daily in control (C) and tumour‐bearing rats (AH‐130) treated or untreated with bortezomib (BTZ). C and C + BTZ: n = 4; AH‐130, AH‐130 + BTZ: n = 8.
Tumour growth, evaluated as total cell number, was reduced by bortezomib treatment on Days 4 and 5 after implantation, but on Day 7, it was comparable in treated and untreated tumour‐bearing rats (Figure 4), suggesting the development of chemoresistance.
Figure 4.
Effects of bortezomib on AH‐130 cell number. Total cell number were evaluated in tumour‐bearing rats (AH‐130) treated or untreated with bortezomib (BTZ) at Day 3 (d3), Day 4 (d4), Day 5 (d5), and Day 7 (d7) after AH‐130 cell inoculation. Results are expressed as means ± SD (C and C + BTZ: n = 4; AH‐130, AH‐130 + BTZ: n = 8). *P < 0.05, ***P < 0.001 vs. AH‐130.
Bortezomib inhibitory activity is mainly exerted by blocking proteasome chymotrypsin‐like sites.17 In this regard, previous studies showed that chymotrypsin‐like activity is increased in the gastrocnemius of rats bearing the AH‐130 hepatoma.44, 46 In the present study, chymotrypsin‐like activity in the gastrocnemius of treated rats was significantly reduced compared with those of untreated animals (treated controls: 25% residual activity vs. untreated rats, P < 0.0001; treated AH‐130: 70% residual activity vs. untreated tumour hosts, P < 0.05), demonstrating that the bortezomib dosage adopted was indeed effective.
Data previously reported in the literature show that the inhibition of proteasome activity prevents IκB degradation and subsequent activation and nuclear translocation of NF‐κB.7 Consistently, the results shown in Figure 5 demonstrate that bortezomib treatment at Day 7 after tumour implantation significantly reduced NF‐κB DNA‐binding activity in the gastrocnemius of AH‐130 hosts (Figure 5). Surprisingly enough, a significant increase in NF‐κB DNA‐binding activity was observed on Day 3 in tumour‐bearing rats treated with bortezomib (Figure 5).
Figure 5.
Bortezomib modulates NF‐κB nuclear translocation in the gastrocnemius of the AH‐130 hosts. (A) Densitometric analysis and (B) representative pattern of NF‐κB DNA‐binding activity measured by electrophoretic mobility shift assay in the gastrocnemius of control (C) and tumour‐bearing rats (AH‐130) treated or untread with bortezomib (BTZ) at Day 3 (d3) and Day 7(d7) after AH‐130 cell inoculation. Results (means ± SD) are expressed as percentage of controls (C and C + BTZ: n = 4; AH‐130, AH‐130 + BTZ: n = 8). *P < 0.05 vs. control, §P < 0.05, §§P < 0.01 vs. AH‐130.
At any observation time, mRNA levels for atrogin‐1 and MuRF1 were not affected by bortezomib administration (Figure 6).
Figure 6.
Bortezomib does not modulate atrogin‐1 and MuRF1 mRNA levels in the gastrocnemius of the AH‐130 hosts. mRNA levels for (A) atrogin‐1 and (B) MuRF1 were determined by semi‐quantitative RT‐PCR in the gastrocnemius of controls (C) and tumour‐bearing rats (AH‐130) treated or untread with bortezomib (BTZ) at Day 3 (d3) and Day 7 (d7) after AH‐130 cell inoculation. Results (means ± SD) are expressed as percentage of controls (C and C + BTZ: n = 4; AH‐130, AH‐130 + BTZ: n = 8). **P < 0.01, ***P < 0.001 vs. control.
Because bortezomib has been proposed to stimulate autophagy,50, 51, 52, 53 although not consistently,54, 55 the levels of beclin‐1, an accepted marker of autophagic sequestration56 were evaluated. Bortezomib treatment induced a significant increase of beclin‐1 levels in control animals (Day 3). In contrast, beclin‐1 expression was slightly, although not significantly, increased in tumour hosts and was not modified by bortezomib (Figure 7).
Figure 7.
Bortezomib does not modulate beclin‐1 protein levels in the gastrocnemius of the AH‐130 hosts. Beclin‐1 protein levels in gastrocnemius muscle of controls (C) and tumour‐bearing rats (AH‐130) treated and untreated with bortezomib (BTZ) at Day 3 (d3) and Day 7 (d7) after AH‐130 cell inoculation were evaluated by western blotting. α‐tubulin was used as loading control. Densitometric quantification are shown in the figure, and results (means ± SD) are expressed as percentage of controls (C and C + BTZ: n = 4; AH‐130, AH‐130 + BTZ: n = 8). *P<0.05 vs. control.
Finally, in order to assess if results obtained with bortezomib treatment were model‐dependent, the experiment was repeated on mice bearing the colon 26 (C26). Consistently with previous experiments,57 the growth of the C26 tumour induced in the host mice a significant reduction of food intake, body weight, and gastrocnemius weight; all these parameters were not affected by bortezomib treatment 12 days after tumour implantation (Figure 8). Spleen and tumour weight were also not significantly modified by bortezomib treatment in the C26 hosts, while liver mass was significantly reduced (see Supporting Information).
Figure 8.
Bortezomib does not affect food intake and does not prevent body and gastrocnemius muscle weight loss in C26‐bearing mice. (A) Daily food intake, (B) body weight, and (C) gastrocnemius weight were evaluated in control (C) and tumour‐bearing mice (C26) treated or untreated with bortezomib (BTZ) 12 days after C26 cell inoculation. Results (means ± SD) are expressed as percentage of controls (controls: n = 7; C26: n = 8; C26 + BTZ: n = 7). **P < 0.001 vs. control.
Discussion
The results obtained in the present study show that bortezomib administration in vivo, although able to reduce proteasome and NF‐κB activity in the skeletal muscle, does not prevent body weight loss and muscle wasting in experimental cancer cachexia. These findings are in agreement with results obtained in LP07‐bearing mice, where treatment with bortezomib failed in preventing cancer‐related body and muscle weight loss.36, 37 These observations would suggest that inhibition of a single proteolytic system is not effective in counteracting muscle wasting in cancer cachexia. Indeed, enhanced muscle protein breakdown in cancer cachexia has been demonstrated to depend on the activity of different degradative mechanisms besides proteasome, such as the autophagic‐lysosomal pathway and the calcium‐dependent proteases (calpains).58, 59
Moreover, inhibition of a degradative pathway can have a negative impact on protein quality control and muscle performance. Indeed, the use of protein degradation inhibitors could have major drawbacks such as promoting the accumulation of misfolded or aggregate‐prone proteins.60 This could be very toxic for the cell, in particular, if other degradative systems, such as autophagy, are not contemporarily and efficiently working to remove accumulated proteins. In the present study, beclin‐1 protein levels were increased by bortezomib treatment in Day 3 controls but were unchanged on both Days 3 and 7 in the AH‐130 hosts, suggesting that an early compensatory induction of autophagy exists in healthy but not in tumour‐bearing animals. In this regard, recent observations have shown that the levels of p62, a marker of autophagosome disposal, markedly increase in the gastrocnemius of rats bearing the AH‐130 hepatoma 7 days after tumour inoculum, in face of unchanged beclin‐1 expression.59 This observation suggests that a progressive exhaustion of the lysosomal degradative capacity occurs in the skeletal muscle of tumour‐bearing animals. Therefore, upon proteasome inhibition, ubiquitylated protein aggregates might not be efficiently removed because of impaired autophagic degradation, which could partially explain the worsened cachectic phenotype observed in the gastrocnemius of bortezomib‐treated AH‐130 hosts. All this reasoning, however, remains speculative because the amount of ubiquitylated protein was not assessed. Further experiments would be needed to clarify this point.
Besides autophagy, other mechanisms participate to the disposal of ubiquitin conjugates, such as deubiquitylating enzymes.17, 61 Little is known about deubiquitylation and its role in cancer‐induced muscle wasting; however, an alteration of this process may play a role in the lack of effect of bortezomib administration to tumour‐bearing animals.
In contrast with the results shown in the present study, treatment with a different proteasome inhibitor, namely MG132, has been reported to attenuate body weight loss and muscle depletion in mice bearing the C26 colon adenocarcinoma.62 Such a discrepancy could rely on the fact that MG132 does not just inhibit proteasome, but also cathepsins and calpains.6 In addition, MG132 administration, unlike bortezomib in our experiment, caused a significant reduction of C26 mass,62 which could have contributed to improve skeletal muscle wasting.
Finally, additional specific effects of bortezomib besides proteasome inhibition may have affected the modulation of muscle mass in the present study. In this regard, bortezomib has been recently reported to inhibit differentiation, to arrest cell growth at G2/M phase, and to induce apoptosis in C2C12 myocyte cultures.63 Importantly, although bortezomib is less toxic compared with other proteasome inhibitors, several side effects have been reported such as asthenia (due to fatigue and weakness), gastrointestinal events (i.e. nausea, diarrhoea, vomiting, and poor appetite), haematological toxicity (low platelets and erithrocytes count),13 peripheral neuropathy,64 and cardiotoxicity.65, 66, 67 In the present experiment, bortezomib exerted a transient toxicity in tumour‐bearing rats as evidenced by reduced food intake and increased NF‐κB DNA‐binding activity at Day 3 after tumour transplantation, which could have contributed, at least in part, to the lack of effectiveness in preventing cancer‐related muscle wasting.
On the whole, the results shown in the present study demonstrate that proteasome inhibition by bortezomib is not able to prevent muscle wasting in tumour‐bearing animals. However, the molecular mechanisms occurring in the skeletal muscle in response to bortezomib administration during cancer cachexia still need to be defined, and further studies should address the issue whether a different dosage of bortezomib alone or in combination with other drugs modulating different molecular pathways may effectively prevent muscle wasting during cancer cachexia.
Acknowledgements
This study was supported by Associazione Italiana per la Ricerca sul Cancro (AIRC—IG9153), Milano, Ministero per l'Università e la Ricerca, Roma (PRIN projects), University of Torino (ex‐60% funds), and Regione Piemonte.
The authors certify that they comply with the ethical guidelines for authorship and publishing of the Journal of Cachexia, Sarcopenia and Muscle (von Haehling S, Morley JE, Coats AJS, Anker SD. Ethical guidelines for authorship and publishing in the Journal of Cachexia, Sarcopenia and Muscle. J Cachexia Sarcopenia Muscle. 2010;1:7–8).
Conflict of interest
None declared.
Supporting information
Supplementary figure. Bortezomib does not affect liver, spleen, and tumour weight in C26‐bearing mice (A) Liser, (B) spleen, and (C) tumour weight were evaluated in tumour‐bearing mice (C26) treated or untreated with bortezomib (BTZ) 12 days after C26 cell inoculation. Results (means ± SD) are expressed as percentage of controls (controls: n = 7; C26: n = 8; C26 + BTZ: n = 7). **P < 0.01 vs. control.
Supporting info item
Penna, F. , Bonetto, A. , Aversa, Z. , Minero, V. G. , Rossi Fanelli, F. , Costelli, P. , and Muscaritoli, M. (2016) Effect of the specific proteasome inhibitor bortezomib on cancer‐related muscle wasting. Journal of Cachexia, Sarcopenia and Muscle, 7: 345–354. doi: 10.1002/jcsm.12050.
References
- 1. Muscaritoli M, Molfino A, Gioia G, Laviano A, Rossi Fanelli F. The “parallel pathway”: a novel nutritional and metabolic approach to cancer patients. Intern Emerg Med 2011;6:105–12. [DOI] [PubMed] [Google Scholar]
- 2. Muscaritoli M, Bossola M, Aversa Z, Bellantone R, Rossi Fanelli F. Prevention and treatment of cancer cachexia: new insight into an old problem. Eur J Cancer 2006;42:31–41. [DOI] [PubMed] [Google Scholar]
- 3. Acharyya S, Guttridge DC. Cancer cachexia signaling pathways continue to emerge yet much still points to the proteasome. Clin Cancer Res 2007;13:1356–61. [DOI] [PubMed] [Google Scholar]
- 4. Penna F, Baccino FM, Costelli P. Coming back: autophagy in cachexia. Curr Opin Clin Nutr Metab Care 2014;17:241–6. [DOI] [PubMed] [Google Scholar]
- 5. Ciechanover A. The ubiquitin‐proteasome proteolytic pathway. Cell 1994;79:13–21. [DOI] [PubMed] [Google Scholar]
- 6. Kisselev AF, Goldberg AL. Proteasome inhibitors: from research tools to drug candidates. Chem Biol 2001;8:739–58. [DOI] [PubMed] [Google Scholar]
- 7. Crawford LJ, Walker B, Irvine AE. Proteasome inhibitors in cancer therapy. J Cell Commun Signal 2011;5:101–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Fischer D, Gang G, Pritts T, Hasselgren PO. Sepsis‐induced muscle proteolysis is prevented by a proteasome inhibitor in vivo . Biochem Biophys Res Commun 2000;270:215–21. [DOI] [PubMed] [Google Scholar]
- 9. Fang CH, Wang JJ, Hobler S, Li BG, Fischer JE, Hasselgren PO. Proteasome blockers inhibit protein breakdown in skeletal muscle after burn injury in rats. Clin Sci (Lond) 1998;95:225–33. [PubMed] [Google Scholar]
- 10. Zhang L, Tang H, Kou Y, Li R, Zheng Y, Wang Q, et al MG132‐mediated inhibition of the ubiquitin‐proteasome pathway ameliorates cancer cachexia. J Cancer Res Clin Oncol 2013a;139:1105–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Caron AZ, Haroun S, Leblanc E, Trensz F, Guindi C, Amrani A, et al The proteasome inhibitor MG132 reduces immobilization‐induced skeletal muscle atrophy in mice. BMC Musculoskelet Disord 2011;12:185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Tawa NE Jr, Odessey R, Goldberg AL. Inhibitors of the proteasome reduce the accelerated proteolysis in atrophying rat skeletal muscles. J Clin Invest 1997;100:197–203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Chen D, Frezza M, Schmitt S, Kanwar J, Dou QP. Bortezomib as the first proteasome inhibitor anticancer drug: current status and future perspectives. Curr Cancer Drug Targets 2011;11:239–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Elliott PJ, Ross JS. The proteasome: a new target for novel drug therapies. Am J Clin Pathol 2001;116:637–46. [DOI] [PubMed] [Google Scholar]
- 15. Schwartz R, Davidson T. Pharmacology, pharmacokinetics, and practical applications of bortezomib. Oncology (Williston Park) 2004;18:14–21. [PubMed] [Google Scholar]
- 16. Dick LR, Fleming PE. Building on bortezomib: second‐generation proteasome inhibitors as anti‐cancer therapy. Drug Discov Today 2010;15:243–9. [DOI] [PubMed] [Google Scholar]
- 17. Goldberg AL. Development of proteasome inhibitors as research tools and cancer drugs. Cell Biol 2012;199:583–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Kubiczkova L, Pour L, Sedlarikova L, Hajek R, Sevcikova S. Proteasome inhibitors ‐ molecular basis and current perspectives in multiple myeloma. J Cell Mol Med 2014;18:947–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Richardson PG, Barlogie B, Berenson J, Singhal S, Jagannath S, Irwin D, et al A phase 2 study of bortezomib in relapsed, refractory myeloma. N Engl J Med 2003;348:2609–17. [DOI] [PubMed] [Google Scholar]
- 20. Kane RC, Farrell AT, Sridhara R, Pazdur R. United States Food and Drug Administration approval summary: bortezomib for the treatment of progressive multiple myeloma after one prior therapy. Clin Cancer Res 2006;12:2955–60. [DOI] [PubMed] [Google Scholar]
- 21. San Miguel JF, Schlag R, Khuageva NK, Dimopoulos MA, Shpilberg O, Kropff M, et al Bortezomib plus melphalan and prednisone for initial treatment of multiple myeloma. N Engl J Med 2008;359:906–17. [DOI] [PubMed] [Google Scholar]
- 22. Mateos MV, Richardson PG, Schlag R, Khuageva NK, Dimopoulos MA, Shpilberg O, et al Bortezomib plus melphalan and prednisone compared with melphalan and prednisone in previously untreated multiple myeloma: updated follow‐up and impact of subsequent therapy in the phase III VISTA trial. J Clin Oncol 2010;28:2259–66. [DOI] [PubMed] [Google Scholar]
- 23. Kane RC, Dagher R, Farrell A, Ko CW, Sridhara R, Justice R, et al Bortezomib for the treatment of mantle cell lymphoma. Clin Cancer Res 2007;13:5291–4. [DOI] [PubMed] [Google Scholar]
- 24. Buac D, Shen M, Schmitt S, Kona FR, Deshmukh R, Zhang Z, et al From bortezomib to other inhibitors of the proteasome and beyond. Curr Pharm Des 2013;19:4025–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Bose P, Batalo MS, Holkova B, Grant S. Bortezomib for the treatment of non‐Hodgkin's lymphoma. Expert Opin Pharmacother 2014;15:2443–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Herrera AF, Kim HT, Bindra B, Jones KT, Alyea EP 3rd, Armand P, et al A phase II study of bortezomib plus prednisone for initial therapy of chronic graft‐versus‐host disease. Biol Blood Marrow Transplant 2014;20:1737–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Pai CC, Chen M, Mirsoian A, Grossenbacher SK, Tellez J, Ames E, et al Treatment of chronic graft‐versus‐host disease with bortezomib. Blood 2014;124:1677–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Skrott Z, Cvek B. Linking the activity of bortezomib in multiple myeloma and autoimmune diseases. Crit Rev Oncol Hematol 2014;92:61–70. [DOI] [PubMed] [Google Scholar]
- 29. Lang CH, Huber D, Frost RA. Burn‐induced increase in atrogin‐1 and MuRF‐1 in skeletal muscle is glucocorticoid independent but downregulated by IGF‐I. Am J Physiol Regul Integr Comp Physiol 2007;292:R328–36. [DOI] [PubMed] [Google Scholar]
- 30. Beehler BC, Sleph PG, Benmassaoud L, Grover GJ. Reduction of skeletal muscle atrophy by a proteasome inhibitor in a rat model of denervation. Exp Biol Med (Maywood) 2006;231:335–41. [DOI] [PubMed] [Google Scholar]
- 31. van Hees H, Ottenheijm C, Ennen L, Linkels M, Dekhuijzen R, Heunks L. Proteasome inhibition improves diaphragm function in an animal model for COPD. Am J Physiol Lung Cell Mol Physiol 2011;301:L110–6. [DOI] [PubMed] [Google Scholar]
- 32. Bonuccelli G, Sotgia F, Capozza F, Gazzerro E, Minetti C, Lisanti MP. Localized treatment with a novel FDA‐approved proteasome inhibitor blocks the degradation of dystrophin and dystrophin‐associated proteins in mdx mice. Cell Cycle 2007;6:1242–8. [DOI] [PubMed] [Google Scholar]
- 33. Gazzerro E, Assereto S, Bonetto A, Sotgia F, Scarfì S, Pistorio A, et al Therapeutic potential of proteasome inhibition in Duchenne and Becker muscular dystrophies. Am J Pathol 2010;176:1863–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Krawiec BJ, Frost RA, Vary TC, Jefferson LS, Lang CH. Hindlimb casting decreases muscle mass in part by proteasome‐dependent proteolysis but independent of protein synthesis. Am J Physiol Endocrinol Metab 2005;289:E969–80. [DOI] [PubMed] [Google Scholar]
- 35. Supinski GS, Vanags J, Callahan LA. Effect of proteasome inhibitors on endotoxin‐induced diaphragm dysfunction. Am J Physiol Lung Cell Mol Physiol 2009;296:L994–L1001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Chacon‐Cabrera A, Fermoselle C, Urtreger AJ, Mateu‐Jimenez M, Diament MJ, de Kier Joffé ED, et al Pharmacological strategies in lung cancer‐induced cachexia: effects on muscle proteolysis, autophagy, structure, and weakness. J Cell Physiol 2014;229:1660–72. [DOI] [PubMed] [Google Scholar]
- 37. Fermoselle C, García‐Arumí E, Puig‐Vilanova E, Andreu AL, Urtreger AJ, de KierJoffé ED, et al Mitochondrial dysfunction and therapeutic approaches in respiratory and limb muscles of cancer cachectic mice. Exp Physiol 2013;98:1349–65. [DOI] [PubMed] [Google Scholar]
- 38. Jatoi A, Alberts SR, Foster N, Morton R, Burch P, Block M, et al Is bortezomib, a proteasome inhibitor, effective in treating cancer‐associated weight loss? Preliminary results from the North Central Cancer Treatment Group. Support Care Cancer 2005;13:381–6. [DOI] [PubMed] [Google Scholar]
- 39. Bossola M, Muscaritoli M, Costelli P, Bellantone R, Pacelli F, Busquets S, et al Increased muscle ubiquitin mRNA levels in gastric cancer patients. Am J Physiol Regul Integr Comp Physiol 2001;280:R1518–23. [DOI] [PubMed] [Google Scholar]
- 40. Bossola M, Muscaritoli M, Costelli P, Grieco G, Bonelli G, Pacelli F, et al Increased muscle proteasome activity correlates with disease severity in gastric cancer patients. Ann Surg 2003;237:384–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Tardif N, Klaude M, Lundell L, Thorell A, Rooyackers O. Autophagic‐lysosomal pathway is the main proteolytic system modified in the skeletal muscle of esophageal cancer patients. Am J Clin Nutr 2013;98:1485–92. [DOI] [PubMed] [Google Scholar]
- 42. Op den Kamp CM, Langen RC, Minnaard R, Kelders MC, Snepvangers FJ, Hesselink MK, et al Pre‐cachexia in patients with stages I‐III non‐small cell lung cancer: systemic inflammation and functional impairment without activation of skeletal muscle ubiquitin proteasome system. Lung Cancer 2012;76:112–7. [DOI] [PubMed] [Google Scholar]
- 43. Baracos VE, DeVivo C, Hoyle DH, Goldberg AL. Activation of the ATP‐ubiquitin‐proteasome pathway in skeletal muscle of cachectic rats bearing a hepatoma. Am J Physiol 1995;268:E996–1006. [DOI] [PubMed] [Google Scholar]
- 44. Costelli P, Bossola M, Muscaritoli M, Grieco G, Bonelli G, Bellantone R, et al Anticytokine treatment prevents the increase in the activity of ATP‐ubiquitin‐ and Ca(2+)‐dependent proteolytic systems in the muscle of tumour‐bearing rats. Cytokine 2002;19:1–5. [DOI] [PubMed] [Google Scholar]
- 45. Costelli P, Muscaritoli M, Bossola M, Penna F, Reffo P, Bonetto A, et al IGF‐1 is downregulated in experimental cancer cachexia. J Physiol Regul Integr Comp Physiol 2006;291:R674–83. [DOI] [PubMed] [Google Scholar]
- 46. Mastrocola R, Reffo P, Penna F, Tomasinelli CE, Boccuzzi G, Baccino FM, et al Muscle wasting in diabetic and in tumor‐bearing rats: role of oxidative stress. Free Radic Biol Med 2008;44:584–93. [DOI] [PubMed] [Google Scholar]
- 47. Acharyya S, Butchbach ME, Sahenk Z, Wang H, Saji M, Carathers M, et al Dystrophin glycoprotein complex dysfunction: a regulatory link between muscular dystrophy and cancer cachexia. Cancer Cell 2005;8:421–32. [DOI] [PubMed] [Google Scholar]
- 48. Aulino P, Berardi E, Cardillo VM, Rizzuto E, Perniconi B, Ramina C, et al Molecular, cellular and physiological characterization of the cancer cachexia‐inducing C26 colon carcinoma in mouse. BMC Cancer 2010;10:363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Costelli P, Muscaritoli M, Bonetto A, Penna F, Reffo P, Bossola M, et al Muscle myostatin signalling is enhanced in experimental cancer cachexia. Eur J Clin Invest 2008;38:531–538. [DOI] [PubMed] [Google Scholar]
- 50. Fang J, Rhyasen G, Bolanos L, Rasch C, Varney M, Wunderlich M, et al Cytotoxic effects of bortezomib in myelodysplastic syndrome/acutemyeloid leukemia depend on autophagy‐mediated lysosomal degradation of TRAF6 and repression of PSMA1. Blood 2012;120:858–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Li C, Johnson DE. Bortezomib induces autophagy in head and neck squamous cell carcinoma cells via JNK activation. Cancer Lett 2012;314:102–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Granato M, Santarelli R, Lotti LV, Di Renzo L, Gonnella R, Garufi A, et al JNK and macroautophagy activation by bortezomib has a pro‐survival effect in primary effusion lymphoma cells. PLoS One 2013;8:e75965. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Min H, Xu M, Chen ZR, Zhou JD, Huang M, Zheng K, et al Bortezomib induces protective autophagy through AMP‐activated protein kinase activation in cultured pancreatic and colorectal cancer cells. Cancer Chemother Pharmacol 2014;74:167–76. [DOI] [PubMed] [Google Scholar]
- 54. Periyasamy‐Thandavan S, Jackson WH, Samaddar JS, Erickson B, Barrett JR, Raney L, et al Bortezomib blocks the catabolic process of autophagy via a cathepsin‐dependent mechanism, affects endoplasmic reticulum stress and induces caspase‐dependent cell death in antiestrogen‐sensitive and resistant ER+ breast cancer cells. Autophagy 2010;6:19–35. [DOI] [PubMed] [Google Scholar]
- 55. Kao C, Chao A, Tsai CL, Chuang WC, Huang WP, Chen GC, et al Bortezomib enhances cancer cell death by blocking the autophagic flux through stimulating ERK phosphorylation. Cell Death Dis 2014;5:e1510. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Funderburk SF, Wang QJ, Yue Z. The beclin 1‐VPS34 complex: at the crossroads of autophagy and beyond. Trends Cell Biol 2010;20:355e362. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Bonetto A, Penna F, Minero VG, Reffo P, Bonelli G, Baccino FM, et al Deacetylase inhibitors modulate the myostatin/follistatin axis without improving cachexia in tumor‐bearing mice. Curr Cancer Drug Targets 2009;9:608–16. [DOI] [PubMed] [Google Scholar]
- 58. Costelli P, Reffo P, Penna F, Autelli R, Bonelli G, Baccino FM. Ca(2+)‐dependent proteolysis in muscle wasting. Int J Biochem Cell Biol 2005;37:2134–46. [DOI] [PubMed] [Google Scholar]
- 59. Penna F, Costamagna D, Pin F, Camperi A, Fanzani A, Chiarpotto EM, et al Autophagic degradation contributes to muscle wasting in cancer cachexia. Am J Pathol 2013;182:1367–78. [DOI] [PubMed] [Google Scholar]
- 60. Sandri M. Protein breakdown in muscle wasting: role of autophagy‐lysosome and ubiquitine proteasome. Int J Biochem Cell Biol 2013;45:2121–2129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Wing SS. Deubiquitinases in skeletal muscle atrophy. Int J Biochem Cell Biol 2013;45:2130–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62. Zhang L, Tang H, Kou Y, Li R, Zheng Y, Wang Q, et al MG132‐mediated inhibition of the ubiquitin‐proteasome pathway ameliorates cancer cachexia. J Cancer Res Clin Oncol 2013b;139:1105–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Xing SS, Shen CC, Godard MP, Wang JJ, Yue YY, Yang ST, et al Bortezomib inhibits C2C12 growth by inducing cell cycle arrest and apoptosis. Biochem Biophys Res Commun 2014;445:375–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64. Cavaletti G, Jakubowiak AJ. Peripheral neuropathy during bortezomib treatment of multiple myeloma: a review of recent studies. Leuk Lymphoma 2010 Jul;51:1178–87. [DOI] [PubMed] [Google Scholar]
- 65. Enrico O, Gabriele B, Nadia C, Sara G, Daniele V, Giulia C, et al Unexpected cardiotoxicity in haematological bortezomib treated patients. Br J Haematol 2007;138:396–7. [DOI] [PubMed] [Google Scholar]
- 66. Nowis D, Maczewski M, Mackiewicz U, Kujawa M, Ratajska A, Wieckowski MR, et al Cardiotoxicity of the anticancer therapeutic agent bortezomib. Am J Pathol 2010;176:2658–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Xiao Y, Yin J, Wei J, Shang Z. Incidence and risk of cardiotoxicity associated with bortezomib in the treatment of cancer: a systematic review and meta‐analysis. PLoS One 2014;9:e87671. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary figure. Bortezomib does not affect liver, spleen, and tumour weight in C26‐bearing mice (A) Liser, (B) spleen, and (C) tumour weight were evaluated in tumour‐bearing mice (C26) treated or untreated with bortezomib (BTZ) 12 days after C26 cell inoculation. Results (means ± SD) are expressed as percentage of controls (controls: n = 7; C26: n = 8; C26 + BTZ: n = 7). **P < 0.01 vs. control.
Supporting info item