Skip to main content
American Journal of Physiology - Heart and Circulatory Physiology logoLink to American Journal of Physiology - Heart and Circulatory Physiology
. 2016 Jan 29;310(6):H693–H704. doi: 10.1152/ajpheart.00688.2015

KV7 channels contribute to paracrine, but not metabolic or ischemic, regulation of coronary vascular reactivity in swine

Adam G Goodwill 1, Lijuan Fu 2, Jillian N Noblet 1, Eli D Casalini 1, Daniel Sassoon 1, Zachary C Berwick 2, Ghassan S Kassab 2, Johnathan D Tune 1, Gregory M Dick 2,✉
PMCID: PMC4865062  PMID: 26825518

KV7 channels are expressed in some coronary artery cell types and may participate in coronary dilation mediated by the endothelium (i.e., paracrine responses). However, KV7 channels do not appear to function in coronary vasodilation in response to more relevant physiological and pathophysiological stimuli such as increased metabolic activity or ischemia.

Keywords: coronary circulation, metabolic vasodilation, KCNQ, hydrogen peroxide, linopirdine

Abstract

Hydrogen peroxide (H2O2) and voltage-dependent K+ (KV) channels play key roles in regulating coronary blood flow in response to metabolic, ischemic, and paracrine stimuli. The KV channels responsible have not been identified, but KV7 channels are possible candidates. Existing data regarding KV7 channel function in the coronary circulation (limited to ex vivo assessments) are mixed. Thus we examined the hypothesis that KV7 channels are present in cells of the coronary vascular wall and regulate vasodilation in swine. We performed a variety of molecular, biochemical, and functional (in vivo and ex vivo) studies. Coronary arteries expressed KCNQ genes (quantitative PCR) and KV7.4 protein (Western blot). Immunostaining demonstrated KV7.4 expression in conduit and resistance vessels, perhaps most prominently in the endothelial and adventitial layers. Flupirtine, a KV7 opener, relaxed coronary artery rings, and this was attenuated by linopirdine, a KV7 blocker. Endothelial denudation inhibited the flupirtine-induced and linopirdine-sensitive relaxation of coronary artery rings. Moreover, linopirdine diminished bradykinin-induced endothelial-dependent relaxation of coronary artery rings. There was no effect of intracoronary flupirtine or linopirdine on coronary blood flow at the resting heart rate in vivo. Linopirdine had no effect on coronary vasodilation in vivo elicited by ischemia, H2O2, or tachycardia. However, bradykinin increased coronary blood flow in vivo, and this was attenuated by linopirdine. These data indicate that KV7 channels are expressed in some coronary cell type(s) and influence endothelial function. Other physiological functions of coronary vascular KV7 channels remain unclear, but they do appear to contribute to endothelium-dependent responses to paracrine stimuli.

NEW & NOTEWORTHY

KV7 channels are expressed in some coronary artery cell types and may participate in coronary dilation mediated by the endothelium (i.e., paracrine responses). However, KV7 channels do not appear to function in coronary vasodilation in response to more relevant physiological and pathophysiological stimuli such as increased metabolic activity or ischemia.

major questions remain incompletely answered in coronary vascular physiology. For example, what is(are) the principle mechanism(s) that couple coronary blood flow to metabolism and ischemia in vivo? It is clear that multiple pathways of regulation exist, including both open-loop and negative feedback controls (3, 14). Recent evidence suggests that myocardial production of hydrogen peroxide (H2O2) may be a signal responsible for the near lockstep increases of coronary blood flow that accompany intensified metabolic demand (21, 40, 47). H2O2 is generated in a variety of cellular processes and may be the primary transmitter of physiological redox signals (9, 45). For example, in coronary microvessels, H2O2 is an endogenous hyperpolarizing factor released by mechanical and paracrine stimulation of the endothelium (31, 46). The specific redox-sensitive targets mediating H2O2-induced vasodilation of coronary vascular smooth have not been firmly established. Our previous findings suggest that voltage-dependent K+ (KV) channels may play an important role, but the identities of individual KV channels involved remain elusive (4, 5, 12, 38, 39).

KV7 channels are expressed in a variety of vascular smooth muscle cell types, including those from the coronary circulation (20, 23). Moreover, KV7 channels are redox sensitive, because they are activated by H2O2 (13, 25). These qualities make KV7 channels appropriate candidates to regulate coronary vascular resistance. Accordingly, it has been demonstrated ex vivo that KV7 channels play a role in coronary vasodilation. Specifically, using Langendorff-perfused rat hearts, Khanamiri et al. (20) demonstrated that linopirdine reduces coronary flow and attenuates reactive hyperemia. Importantly, however, these data have not been supported by more physiologically relevant in vivo studies of coronary blood flow. Additionally, crystalloid-perfused hearts suffer from inadequate oxygen delivery (2, 41), which may influence results. Moreover, a more recent study in mice by Lee et al. (23) clearly indicated that the function and expression of KV7 channels is much reduced in coronary arteries compared with cerebral arteries. Details regarding the presence and roles KV7 channels in the coronary circulation are not clear and require further investigation.

Because pharmacological agents selective for KV7 channels are available, it is possible to perform in vivo experiments to ascertain whether KV7 channels are involved in coupling coronary blood flow to metabolism, participate in ischemic vasodilation, or mediate responses to paracrine stimulation of the endothelium. In the present study, we tested the hypothesis the hypothesis that KV7 channels are present in cells of the coronary vascular wall and regulate vasodilation in swine. We used swine as experimental models and performed coronary blood flow measurements as well as isometric tension, patch-clamp electrophysiology, quantitative polymerase chain reaction (qPCR), Western blot, and immunohistochemistry (IHC) studies. We examined the role of KV7 channels in 1) regulating coronary vascular resistance at the resting heart rate, 2) ischemic vasodilation (reactive hyperemia induced by a 15-s coronary occlusion), 3) coronary vasodilation to exogenous H2O2, 4) coronary metabolic vasodilation elicited by pacing-induced tachycardia, and 5) paracrine-mediated (bradykinin induced) endothelium-dependent coronary vasodilation. We also investigated the expression of KCNQ genes and KV7 channels using molecular (qPCR), biochemical (IHC, Western blot), and functional (isometric tension, patch clamp) assays.

METHODS

All experiments involving animals were approved by an Institutional Animal Care and Use Committee and performed in accordance with the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85-23, Revised 2011). Lean adult male Ossabaw swine (n = 10) or domestic swine (n = 6) were sedated with telazol, xylazine, and ketamine (5, 2.5, and 2.5 mg/kg sc) before being anesthetized with morphine (3 mg/kg im) and α-chloralose (100 mg/kg iv). Following the completion of in vivo experimental protocols, hearts were fibrillated and excised for ex vivo studies.

qPCR analysis of KCNQ expression.

Epicardial coronary arteries (right coronary artery, RCA; left anterior descending coronary artery, LAD; and left circumflex coronary artery; LCx) were dissected from the heart. Total RNA was isolated using the RNeasy fibrous tissue kit (Qiagen) and stored at −80°C. cDNA synthesis was performed using 1 μg of total RNA and the iScript cDNA synthesis kit (Bio-Rad). Quantitative RT-PCR was performed using SYBR Green Supermix (Bio-Rad). The specificity of PCR amplification products was validated by melting curve analysis. Primers for KCNQ1, KCNQ2, KCNQ4, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) for swine were designed using Premier Primer 5 software (PREMIER Biosoft). Primers for KCNQ3 and KCNQ5 were those described previously by Svalø et al. (44). Primer sequences and amplicon sizes are given in Table 1. KCNQ gene expression was normalized to a reference gene (GAPDH) and analyzed with Bio-Rad CFX Manager software.

Table 1.

Primers used for quantitative PCR

Gene Channel Primers (5′→3′) Amplicon, bp Accession No.
KCNQ1 KV7.1 F TCGCCACCTCAGCCATCA 219 AB033207.1
R CCACTTGGCCGGACTCATT
KCNQ2 KV7.2 F GTGGTGTTTGGCGTGGAGT 140 AF110020.1
R GCAATGGAGGCGATGAGC
KCNQ3 KV7.3 F AAGACGGGACCCTACTGCTG 127 XM_005662845.1
R CGGTACTTGGCGTTGTTCCT
KCNQ4 KV7.4 F ACTCACGGTGGACGATGTTAT 100 XM_003128110.4
R CAGCGTCTCCTTGAATTTCCTT
KCNQ5 KV7.5 F CCCTGTGGACAGCAAAGACC 126 XM_003121265.4
R GTCTGGGCGCTGAACTCATT
GAPDH F TGGGAAACTGTGGCGTGAT 123 AF017079.1
R AAGGCCATGCCAGTGAGC

F, forward; R, reverse.

Western blot for KV7.4.

Segments of the LCx artery were homogenized in lysis and extraction buffer containing (in mM) 50 β-glycerophosphate, 0.1 Na3VO4, 2 MgCl2, 1 EGTA, 1 DTT, 0.02 pepstatin, 0.02 leupeptin, and 1 PMSF, as well as 0.5% Triton X-100 and 0.1 U/ml aprotinin. Lysate samples (300 μg of protein, measured by Bradford assay; Bio-Rad) were loaded on 4–12% Bis-Tris gels (Life Technologies) and subjected to electrophoresis. Proteins were transferred overnight at 4°C to nitrocellulose membranes, which were then blocked for 1 h at room temperature with 5% bovine serum albumin. Per the manufacturers' datasheets, immunoreactivity of KV7.4 (Alomone; product no. APC-164) and GAPDH (a loading control; Abcam) appear at ∼110 and 37 kDa, respectively. Thus membranes were bisected between those molecular weights and each half processed separately. Membranes were incubated overnight at 4°C in buffer containing primary antibody (1:400 for anti-KV7.4 and 1:1,000 for GAPDH). After washing was completed, membranes were placed for 1 h at room temperature in buffer containing horseradish peroxidase-linked secondary antibody (1:2,000 of goat anti-rabbit for KV7.4 and 1:10,000 goat anti-mouse for GAPDH; both from Santa Cruz Biotechnology). KV7.4 immunoreactivity was visualized with ECL Prime (Amersham), whereas GAPDH immunoreactivity was visualized with 3,3′-diaminobenzidine (DAB; Bio-Rad).

KV7.4 IHC.

Methods to detect the tissue distribution of KV7.4 included IHC with chromogenic and fluorescent indicators. Isolated coronary arteries and sections of myocardium were prepared for IHC studies using horseradish peroxidase detection. The myocardial sections were examined for KV7.4 immunoreactivity in a small-caliber resistance vessel, whereas cardiomyocytes served as a KV7.4-positive control. Formalin-fixed, paraffin-embedded sections of swine tissues were stained using an antibody against KV7.4 (sc-50417; Santa Cruz Biotechnology) in conjunction with the Indiana University Immunohistochemistry Laboratory Core (Indiana University Health, Department of Pathology). Slides were imaged on an Aperio Scan Scope CS (Leica Biosystems) at ×40 magnification, and images were processed with associated ImageScope software.

To more closely examine the cellular localization of KV7.4 in isolated epicardial coronary arteries, we used a fluorescently labeled secondary antibody. Segments of LCx arteries were fixed in paraformaldehyde and embedded in Richard-Allan Neg 50 frozen section medium (Thermo Scientific). Tissue was sectioned (8 μm) and placed on Superfrost Plus slides (Thermo Scientific). Samples were blocked with 10% donkey serum in PBS containing 0.1% Triton X-100 for 1 h at room temperature. Primary antibody (1:25; sc-50417; Santa Cruz Biotechnology) was added to sections in 2.5% donkey serum and allowed to incubate overnight at 4°C. Washed slides were incubated with secondary antibody (1:100 donkey anti-rabbit Alexa Fluor 594; Invitrogen) and Hoechst 33,342 stain (1:5,000; Invitrogen) for 1 h at room temperature. Slides were washed, Shandon Immu-Mount (Thermo Scientific) was applied, and coverslips were mounted. Red (KV7.4 immunoreactivity) and blue (nuclear staining) fluorescence was visualized and photographed.

Isometric tension studies.

The aorta was cannulated to perfuse the coronary tree with cold (4°C) Ca2+-free Krebs solution (containing in mM: 131.5 NaCl, 5 KCl, 1.2 NaH2PO4, 1.2 MgCl2, 25 NaHCO3, and 10 glucose) to remove blood. LCx arteries were cut into ∼3-mm rings and mounted in water-jacketed organ baths (37°C) filled with Krebs solution containing 4 mM CaCl2. Repeated contractions with 60 mM KCl at successively greater internal circumferences determined the optimal length of coronary artery rings as passive tension was increased in 1-g increments until K+-induced tension changed less than 10%. Arteries were constricted with 1 μM U46619 and relaxed with flupirtine or bradykinin in the presence or absence of linopirdine.

KV7 channel modulators.

Flupirtine and linopirdine stocks were made with DMSO. The final concentration of vehicle did not exceed 0.1% in any experiment.

Patch-clamp electrophysiology.

Segments of LCx arteries were enzymatically digested to isolate coronary smooth muscle cells as previously described (12). Currents were measured at room temperature in conventional dialyzed patches. The bath solution contained (in mM) 125 NaCl, 5 KCl, 2 MnCl2, 1 MgCl2, 10 glucose, 10 HEPES, and 5 Tris; pH 7.4. The pipette solution contained (in mM) 140 KCl, 3 Mg-ATP, 1 Na-GTP, 1 EGTA; 10 HEPES, and 5 Tris; pH 7.1. After whole cell access was established, series resistance and membrane capacitance were compensated as fully as possible (Axon 200B amplifier and pClamp 9 software).

Coronary blood flow measurements.

Acute in vivo experiments were conducted in open-chest anesthetized pigs with the use of an extracorporeal pressure-clamped perfusion system. Anesthetized pigs were intubated and ventilated with O2-supplemented room air. Catheters were placed into the thoracic aorta via the right femoral artery (for blood pressure and heart rate monitoring), into the left femoral artery (to draw a supply of blood for the extracorporeal perfusion system), and into the right femoral vein (for supplemental anesthetic, heparin, and sodium bicarbonate). Coronary perfusion pressure was maintained at 100 mmHg by a servo-controlled peristaltic pump throughout the study. Blood gas parameters were kept within normal physiological limits through periodic blood gas analyses and appropriate adjustments to breathing rate, tidal volume, and/or bicarbonate supplementation. The LCx artery was ligated proximally and cannulated with the pressure-controlled line of blood from the left femoral artery. An ∼30-min equilibration period elapsed before experiments commenced. Baseline parameters were obtained and experimental protocols performed as detailed below.

Five different kinds of experiments were performed to test whether KV7 channels were involved in regulating various functions of the coronary circulation. In all five experiments, coronary blood flow was measured in real time in the cannulated, pressure-controlled coronary circulation. Before experiments were initiated, blood gas parameters were obtained to establish that the animal was under balanced anesthesia as well as to determine the hematocrit. Based on hematocrit and coronary blood flow, the plasma volume flow of the coronary perfusion territory was determined. Harvard Apparatus syringe pumps were used to infuse drugs into the coronary perfusion line, and dose rates of drugs were calculated for specific coronary plasma concentrations listed below. 1) We examined the capacity of KV7 channels to change coronary vascular resistance at the resting heart rate by infusing KV7 channel modulators directly into the LCx artery (both channel activators and inhibitors were used; maximum concentrations achieved in the coronary plasma for flupirtine and linopirdine were 30 and 100 μM, respectively). 2) We investigated the role of KV7 channels in ischemic vasodilation by occluding the arterial cannula for 15 s and measuring reactive hyperemia before and during intracoronary infusion of 30 μM linopirdine. 3) We quantified the role of KV7 channels in the coronary vasodilation to exogenous H2O2 by infusing 0.3–3 μM H2O2 in to the coronary perfusion line in the absence or presence of linopirdine (10 μM; infused before and simultaneously with H2O2). 4) We investigated the role of KV7 channels in coronary metabolic vasodilation (using a subset of animals; n = 2) by pacing the heart to higher rates before and during intracoronary infusion of 10 μM linopirdine. In this experiment, arterial and coronary venous blood were sampled simultaneously at each heart rate to calculate myocardial oxygen consumption by the Fick principle (5). We assessed the role of KV7 channels in endothelium-dependent vasodilation by performing intracoronary bradykinin concentration-response protocols before (control) and during simultaneous infusion of 30 μM linopirdine.

Statistical analyses.

A variety of statistical tests were used. In all tests, a value of P < 0.05 was considered significant. Normalized qPCR data and isometric tension data were analyzed by two-way analysis of variance (ANOVA). Post hoc analyses followed ANOVA when applicable, and specific differences are indicated in figures, legends, or text. The data regarding KV7 channel modulators on resting coronary blood flow were analyzed by one-way repeated-measures ANOVA (RM-ANOVA), linear regression, and nonlinear regression (concentration-response fits). The data regarding the effect of linopirdine on H2O2- and bradykinin-induced coronary vasodilation were analyzed by two-way RM-ANOVA. The data regarding the effect of linopirdine on coronary metabolic vasodilation were analyzed by linear regression and analysis of covariance. The data regarding the effect of linopirdine on reactive hyperemia parameters were analyzed by paired t-test. The data regarding effects of KV7 modulators on currents in coronary vascular smooth muscle cells (current-voltage and conductance-voltage relationships) were analyzed by two-way RM-ANOVA. The data obtained in Ossabaw and domestic swine were analyzed for variance between strains (both groups were lean and metabolically healthy). No differences between strains were found; therefore, the data were pooled.

RESULTS

KCNQ genes and KV7.4 protein are expressed in swine coronary arteries.

KV7 channels are encoded by KCNQ genes, five of which are known (KCNQ1–KCNQ5). We performed qPCR experiments to determine the expression of KCNQ genes relative to a reference gene, GAPDH (Fig. 1A). The segments of coronary artery that were used are expected to contain a number of cell types (e.g., smooth muscle cells, endothelial cells, and adipocytes, as well as sympathetic nerve endings). A survey of the literature (Table 2) suggests that KCNQ1, KCNQ4, and KCNQ5 are commonly expressed in arteries and veins, whereas KCNQ2 and KCNQ3 are observed less frequently. We detected expression of all five KCNQ genes in the LAD, LCx, and RCA (Fig. 1). Group data (n = 3) indicate that there were no differences between arteries (P = 0.86), but there were significant differences in the level of individual KCNQ transcripts (P < 0.0001). KCNQ4 and KCNQ5 were the most abundant transcripts (the higher expression of these 2 transcripts was statistically indistinguishable from each other; Fig. 1B). There were significantly lower levels of KCNQ1, KCNQ2, and KCNQ3 (the more limited expression of these 3 transcripts was statistically indistinguishable from each other; Fig. 1B). KCNQ4 was one of the most abundant transcripts, and a recent study implicated KV7.4 channels in regulating coronary vascular responses (20); therefore, we performed Western blots to establish whether KV7.4 protein is expressed in the LCx artery. A band of immunoreactivity consistent with KV7.4 was detected (Fig. 1C).

Fig. 1.

Fig. 1.

Expression of KNCQ genes and KV7.4 protein in coronary arteries. A: representative quantitative PCR (qPCR) amplification plot. B: group data (n = 3) for KNCQ gene expression normalized to GAPDH. C: representative immunoblot for KV7.4 and GAPDH in the swine left circumflex coronary artery (LCx). LAD, left anterior descending coronary artery; RCA, right coronary artery.

Table 2.

Expression of KCNQ mRNA and KV7 channel protein in vascular tissues

Tissue KCNQ1 KV7.1 KCNQ2 KV7.2 KCNQ3 KV7.3 KCNQ4 KV7.4 KCNQ5 KV7.5 Ref.
Mouse portal vein + 35
Mouse aorta, carotid, femoral, mesenteric arteries + + + 50
Mouse portal vein + + + 48
Rat pulmonary artery + + + 18
Rat cerebral arteries + + + 52
Arteries from human adipose and mesentery + + + + 33
Rat basilar arteries + + + + + 28
Rat coronary artery + + + + 20
Rat gracilis artery + + + + 51
Pig coronary artery + + + 16
Mouse mesenteric artery + + 8
Rat pulmonary artery + 24
Mouse mesenteric artery + + + + 42
Rat aorta and vena cava + + 36

Immunohistochemical detection of KV7.4.

We performed IHC studies on sections of myocardium and isolated epicardial coronary arteries. The myocardium was strongly positive for KV7.4 immunoreactivity (example marked by a star in Fig. 2A; note cytosolic and membranous brown staining of cardiomyocytes). Moreover, coronary microvessels in those myocardial sections were positive for KV7.4 immunoreactivity (multiple examples marked by arrows in Fig. 2A). Conduit coronaries were also positive for KV7.4 immunoreactivity (brown color; Fig. 2B). To more closely examine the cellular distribution of KV7.4 immunoreactivity in the LCx artery, a fluorescent secondary antibody was used (Fig. 2C). The distribution of KV7.4 reactivity was not uniform across the vascular wall. Staining for KV7.4 was most prominent in the intimal layer (endothelial) and adventitial layer (containing loose connective tissue, adipocytes, sympathetic nerve endings, etc.). There was less KV7.4 staining in the medial (smooth muscle) layer. Figure 2C, inset, shows the red (KV7.4) channel only, and an arrow points to the thin line of immunostaining on the intimal surface.

Fig. 2.

Fig. 2.

Immunostaining for KV7 channels. A: section of swine myocardium stained for KV7.4. Brown color indicates positive immunoreactivity. Cardiomyocytes are strongly positive for KV7.4 immunostaining (example highlighted by star). Coronary microvessels are also KV7.4 positive (arrows point to several examples). B: section of swine LCx artery stained for KV7.4. There is diffuse brown staining in the sample. C: overlay of light and fluorescent microscope images of an LCx artery section. KV7.4 immunofluorescence is red (see inset for red-only channel; arrow points to endothelium) and nuclei are blue (4,6-diamidino-2-phenylindole).

Flupirtine-induced relaxations are largely endothelium dependent.

There is no single drug that opens all five known KV7 channels, but flupirtine is an agonist of KV7.2, KV7.3, KV7.4, and KV7.5 (27). Thus flupirtine was chosen to determine the effects of a KV7 channel opener on coronary vascular tone. The LCx artery was utilized for isometric tension experiments with flupirtine (3–300 μM). All artery rings were tested for functional endothelium before addition of any KV7 channel modulators. Artery segments were preconstricted with the stable thromboxane A2 mimetic U46619 (1 μM), and relaxation to 1 μM bradykinin was 94 ± 2, 95 ± 3, and 91 ± 2% in the rings serving as the control, linopirdine-treated, and DMSO-treated groups, respectively. Artery segments were again preconstricted with U46619, and increasing concentrations of flupirtine were added. Flupirtine relaxed coronary artery rings in the control group in a concentration-dependent manner (Fig. 3A; n = 7). To determine whether KV7 channels mediated the effects of flupirtine, two separate groups of rings were pretreated with the pan-KV7 antagonist linopirdine (10 or 30 μM; n = 7 per group) and subjected to identical flupirtine concentration-response protocols. Flupirtine-induced relaxation was significantly attenuated in the presence of linopirdine (Fig. 3A). Linopirdine pretreatment had no effect on baseline tension (i.e., the KV7 channel blocker did not elicit a contraction by itself) or the tension developed in response to U46619. Time control responses to vehicle (0.1% DMSO) demonstrated no significant change in active tension (11 ± 6% relaxation, n = 3).

Fig. 3.

Fig. 3.

Flupirtine relaxes coronary artery rings ex vivo. A: group data (n = 7) demonstrating the ability of flupirtine to relax LCx artery segments contracted with U46619. Pretreating 2 additional sets of rings with either 10 or 30 μM linopirdine inhibited flupirtine-induced relaxation (n = 7 each). *P < 0.05 indicates a difference between the control and linopirdine-treated groups. #P < 0.05 indicates a difference between 10 and 30 μM linopirdine. B: relaxation elicited by 300 μM flupirtine in rings denuded of endothelium in the presence or absence of 30 μM linopirdine (n = 3 each).

To determine whether the endothelium played a role in flupirtine-induced coronary artery relaxation, a separate set of rings (n = 3) was mechanically denuded of endothelium, preconstricted with U46619, and challenged with 300 μM flupirtine (Fig. 3B). Endothelial denudation significantly reduced flupirtine-induced relaxation of coronary artery rings (49 ± 8% in Fig. 3B vs. 91 ± 5% in Fig. 3A; P = 0.03). Whereas linopirdine inhibited the flupirtine-induced relaxation of intact rings (Fig. 3A), 30 μM linopirdine had no effect on the magnitude of flupirtine-induced relaxation in rings denuded of endothelium (Fig. 3B; 58 ± 2%; P = 0.34).

Linopirdine inhibits bradykinin-induced relaxation of coronary artery rings.

Having established a role for a functional endothelium in mediating coronary artery relaxation to the KV7 activator flupirtine, we assessed the role of KV7 channels in endothelium-dependent relaxation to bradykinin. Isolated coronary artery rings were preconstricted with 1 μM U46619 and exposed to increasing doses of bradykinin (1 to 30 μM) under control conditions or in the presence of 30 μM linopirdine (n = 3). Bradykinin relaxed coronary artery rings in a concentration-dependent manner (Fig. 4). Linopirdine diminished relaxation across the range of bradykinin concentrations tested, resulting in a right shift in the concentration-response curve (P = 0.02; Fig. 4). To establish whether this linopirdine effect resulted from alterations in the endothelial response to bradykinin or the vascular smooth muscle response to relaxing factors, rings were exposed to increasing doses of sodium nitroprusside (1 nM to 30 μM). The NO donor relaxed rings in a concentration-dependent manner, and linopirdine had no statistically significant inhibitory effect (95 ± 3% vs. 85 ± 8%; P = 0.44).

Fig. 4.

Fig. 4.

Linopirdine attenuates bradykinin-induced relaxation of coronary artery rings. The graph shows group data illustrating the effect of 30 μM linopirdine on bradykinin-induced relaxation of coronary artery rings (n = 3). Two-way RM ANOVA indicates a significant inhibitory effect of linopirdine (P < 0.001, but post hoc analysis failed to indicate where specific differences exist). Linopirdine appears to shift the bradykinin concentration-response curve to the right.

Effects of linopirdine on K+ current in coronary artery smooth muscle.

Linopirdine inhibits K+ current in smooth muscle cells from the LCx artery (Fig. 5A). Specifically, linopirdine reduced current 28–31% at potentials between −10 and +40 mV (Fig. 5B; n = 5). Moreover, linopirdine decreased tail currents 29–50% following conditioning steps between −30 and +40 mV (Fig. 5C), but linopirdine did not shift the half-activation potential (V1/2: −14 ± 1 and −15 ± 1 mV before and after linopirdine; Fig. 5D).

Fig. 5.

Fig. 5.

Linopirdine and KV current. A: current traces from a representative cell (top); voltage template is shown at bottom. Current was inhibited by 10 μM linopirdine. B: plot of group data (n = 5 cells) for the current-voltage relationship before and after addition of linopirdine (data taken from period indicated by horizontal bar in A, left). C: group data conductance-voltage curve (i.e., analysis of tail currents in same cells described for B; data come from area indicated by arrow in A, left). Maximal conductance was reduced by linopirdine. D: normalized conductance (G/Gmax)-voltage curve. Linopirdine did not shift the half-activation voltage (V1/2) of the tail currents (i.e., the voltage sensitivity of the channels was unaffected). *P < 0.05, between control and linopirdine.

It is possible that the contribution of KV7 channels to smooth muscle K+ current may best appreciated at the end of relatively long (4–5 s) voltage steps. This is because the presence of auxiliary/modulatory subunits (such as KCNE) could slow the activation kinetics of KV7 channels dramatically. Thus we more thoroughly examined the effect of linopirdine on coronary smooth muscle K+ current with long voltage steps (Fig. 6). Additionally, in these experiments, the concentration of the KV7 channel antagonist was doubled to increase efficacy. When the smooth muscle membrane was voltage-clamped to test potentials for nearly 5 s, a slow inactivation of current was seen at the more depolarized potentials (Fig. 6A). Linopirdine (20 μM) clearly reduced current at the earlier time points (Fig. 6B) as expected from the previous experiments (Fig. 5). Interestingly, however, the noninactivating current (or the current at the steady-state that might be attributed to KV7 channels) was not blocked by 20 μM linopirdine (Fig. 6D). Current in the presence of 20 μM linopirdine was 88–109% of control at voltages between −10 and +40 mV (there was no statistically significant effect).

Fig. 6.

Fig. 6.

Linopirdine and KV current: long voltage steps to assess steady-state current. A and B: current traces from the same cell before (A) and after (B) addition of 20 μM linopirdine. Early (peak) current was inhibited by linopirdine, similar to the effect of 10 μM linopirdine in Fig. 5. C: voltage template. D: group data (n = 5 cells) for the current-voltage relationship (data taken from period indicated by horizontal bar in A). There was no statistically significant effect of linopirdine on steady-state current.

KV7 channel modulators and coronary blood flow at the resting heart rate.

Our first in vivo experiment was designed to determine whether KV7 channels are active in the coronary circulation and regulate blood flow at the resting heart rate. There are two logical predictions to make with regard to KV7 channel modulators. First, the addition of a KV7 channel opener might increase coronary blood flow. This would be similar to what we have shown previously for another K+ channel opener, pinacidil (12), and would agree conceptually with the flupirtine-induced relaxation of coronary artery rings ex vivo (isometric tension data presented in Fig. 3A). Second, administration of a KV7 channel blocker might decrease coronary blood flow at rest. This would be similar to what we have shown previously with a different K+ channel blocker, 4-aminopyridine (12). Pigs were instrumented to measure blood flow in myocardium perfused by the LCx artery while it was pressure clamped at 100 mmHg.

Flupirtine is a KV7 channel agonist that can significantly relax coronary artery rings ex vivo (Fig. 3A). Flupirtine was infused directly into the coronary perfusion line at dose rates calculated to give specific coronary plasma concentrations between 1 and 30 μM to determine whether opening KV7 channels could regulate baseline coronary vascular resistance. Flupirtine had no effect on coronary blood flow at the resting heart rate over the tested range of concentrations (Fig. 7A). The data were analyzed three ways, all of which returned the same negative results with regard to flupirtine. Specifically, 1) one-way RM-ANOVA did not indicate any differences in absolute or delta blood flow at the various doses; 2) subjecting the data to a linear regression gave a slope that was not significantly different from zero (linear regression analysis produces a line with a slope of 0.009 ± 0.007; not different from zero); and 3) no meaningful concentration-dependent curve (nonlinear regression) could be applied.

Fig. 7.

Fig. 7.

KV7 modulators and coronary blood flow. A: plot of change (Δ) in coronary blood flow vs. intracoronary plasma concentration of flupirtine. Data are from 10 pigs. There is no significant relationship between Δcoronary blood flow and the concentration of KV7 channel agonist. That is, flupirtine has no effect on coronary blood flow at the resting heart rate (there is no flupirtine-induced vasodilation). B: plot of Δcoronary blood flow vs. intracoronary plasma concentration of linopirdine. Data are from 13 pigs. There is no significant relationship between Δcoronary blood flow and the concentration of the KV7 channel inhibitor. That is, linopirdine has no effect on coronary blood flow at the resting heart rate (there is no linopirdine-induced vasoconstriction).

Linopirdine is a KV7 channel antagonist that antagonized, at least partly, flupirtine-induced relaxation of LCx artery rings ex vivo (Fig. 3A). Linopirdine was infused directly into the coronary perfusion line to give specific coronary plasma concentrations between 1 and 100 μM to determine whether inhibiting KV7 channels could influence baseline coronary vascular resistance. Linopirdine had no effect on coronary blood flow at the resting heart rate (Fig. 7B). There was no discernable effect of linopirdine in vivo when evaluated by 1) RM-ANOVA on absolute or delta flow values, 2) linear regression (slope of 0.014 ± 0.006; not different from zero), or 3) nonlinear regression (unable to fit with a dose-response curve).

To address whether the apparent lack of responses to KV7 channel modulators on baseline coronary vascular resistance were due to the choice of pharmacological agents, a subset of animals was subjected to similar intracoronary concentration-response experiments with additional, structurally unrelated KV7 channel drugs. Two more KV7 channel activators, L364-373 (0.03–30 μM) and retigabine (1–30 μM), were assessed in an additional two pigs. Neither of these KV7 channel openers increased coronary blood flow. The average change in flow with 0.03, 0.1, 0.3, 1, 3, 10, and 30 μM L364-373 was −5, 3, −3, 4, −6, −1, and 6%, respectively. The average change in flow with 1, 3, 10, and 30 μM retigabine was 1, 0, 0, and 1%, respectively. Chromanol 293B is a KV7 channel blocker, but intracoronary infusion of this drug (0.1–30 μM) had no effect on coronary blood flow at the resting heart rate (data from 1 pig). The change in flow with 0.1, 0.3, 1, 3, 10, and 30 μM chromanol 293B was −1, 0, −1, 1, 2, and −3%, respectively. Thus, regardless of the KV7 channel modulator employed in vivo, there was no appreciable change in coronary blood flow at the resting heart rate.

Additional cardiovascular parameters were recorded during the intracoronary infusion of KV7 channel modulators and are presented in Tables 3 and 4. We did not expect major changes in systemic hemodynamics because the drugs were infused directly into the coronary circulation. Neither flupirtine (Table 3) nor linopirdine (Table 4) significantly changed any parameter we measured. The same is true for L364-373, retigabine, and chromanol 293B (data not shown). Heart rate and mean arterial pressure remained stable.

Table 3.

Cardiac and hemodynamic parameters with intracoronary flupirtine infusion

Flupirtine, μM
Baseline 1 3 10 30
Systolic pressure, mmHg 111 ± 6 103 ± 5 103 ± 9 108 ± 6 106 ± 9
Diastolic pressure, mmHg 76 ± 4 71 ± 4 70 ± 6 73 ± 5 71 ± 6
Mean pressure, mmHg 92 ± 5 86 ± 4 86 ± 7 89 ± 5 88 ± 7
Heart rate, beats/min 67 ± 8 72 ± 8 79 ± 12 71 ± 7 79 ± 12
Table 4.

Cardiac and hemodynamic parameters with intracoronary infusion of linopirdine

Linopirdine, μM
Baseline 1 3 10 30 100
Systolic pressure, mmHg 104 ± 5 105 ± 5 103 ± 5 103 ± 5 103 ± 5 94 ± 8
Diastolic pressure, mmHg 72 ± 4 72 ± 4 71 ± 4 71 ± 4 71 ± 4 65 ± 6
Mean pressure, mmHg 88 ± 4 88 ± 4 86 ± 4 86 ± 4 86 ± 4 79 ± 7
Heart rate, beats/min 74 ± 7 73 ± 8 76 ± 9 76 ± 9 75 ± 8 84 ± 11

Linopirdine and coronary reactive hyperemia.

Our second in vivo experiment was designed to determine whether KV7 channels play a role in coronary reactive hyperemia (i.e., vasodilation in response to an ischemic stimulus). If KV7 channels are responsive to vasodilators produced by the ischemic myocardium, then linopirdine should reduce the peak hyperemic response and/or the repayment of flow debt. This would be similar to what we have shown previously for the K+ channel blocker 4-aminopyridine (12). To elicit coronary reactive hyperemia, the arterial perfusion cannula was occluded for 15 s and then released. Blood flow responses were measured under control conditions and during infusion of linopirdine to a plasma concentration of 30 μM (Fig. 8; n = 6 pigs). Data presented in Table 5 quantify the effects of linopirdine on reactive hyperemia. There were no changes in baseline flow, peak hyperemic flow (which reflects the minimum vascular resistance obtained), debt area, repayment area, or flow measured 30 s after the release of occlusion.

Fig. 8.

Fig. 8.

Linopirdine and ischemic vasodilation (reactive hyperemia). A plot of coronary blood flow vs. time is shown for a reactive hyperemia protocol. A clamp on the coronary perfusion line was used to reduce blood flow to zero for 15 s and then released. Coronary blood flow quickly increased and then returned the baseline level over the next minute. The protocol was repeated in the same pig during infusion of linopirdine to reach a coronary plasma concentration of 30 μM. Linopirdine had no significant effect on ischemic vasodilation (see also Table 5).

Table 5.

Quantification of coronary reactive hyperemia

Control Linopirdine (30 μM)
Baseline flow, ml·min−1·g−1 0.66 ± 0.07 0.80 ± 0.11
Flow debt, ml/g 0.17 ± 0.02 0.20 ± 0.03
Peak flow, ml·min−1·g−1 4.40 ± 0.56 4.57 ± 0.54
Repayment volume, ml/g 1.32 ± 0.31 1.09 ± 0.36
Flow 30 s after reperfusion, ml·min−1·g−1 1.19 ± 0.16 1.16 ± 0.33

Linopirdine and H2O2-induced coronary vasodilation.

Our third in vivo experiment was designed to determine whether KV7 channels mediate the coronary blood flow increase elicited by H2O2. We reasoned that if KV7 channels were the redox-sensitive targets of H2O2, linopirdine should attenuate H2O2-induced coronary vasodilation. This would be similar to what we have shown previously for another K+ channel blocker, 4-aminopyridine (12). Pigs (n = 5) were instrumented for measuring coronary blood flow in the pressure-clamped LCx artery. Coronary vasodilation induced by H2O2 can be seen in Fig. 9. H2O2 was infused to reach plasma concentrations of 0.3, 1, 3, and 10 μM, and this increased coronary blood flow 9 ± 6, 38 ± 15, 71 ± 22, and 126 ± 48%, respectively. After coronary blood flow returned to the control level, an intracoronary infusion of linopirdine was commenced to reach a plasma concentration of 10 μM and the H2O2 infusion protocol was repeated. Linopirdine did not inhibit H2O2-induced coronary vasodilation, because the same four concentrations of H2O2 increased coronary blood flow 12 ± 4, 47 ± 11, 94 ± 21, and 190 ± 40%, respectively (Fig. 9).

Fig. 9.

Fig. 9.

Linopirdine and the vasodilation in response to exogenous H2O2. The graph shows group data (n = 5) for coronary blood flow vs. intracoronary concentration of exogenous H2O2. H2O2-induced coronary vasodilation was quantified twice in each pig: before (control) and during simultaneous administration of a KV7 channel antagonist (10 μM linopirdine). H2O2 significantly reduced coronary vascular resistance during both challenges (i.e., coronary pressure was held constant at 100 mmHg and flow increased). There was, however, no effect of linopirdine on the response, because the KV7 channel blocker did not attenuate H2O2-induced coronary vasodilation.

To further test the role of KV7 channels in coronary vasodilation, we designed an in vivo experiment to determine whether KV7 channels play a role in the increase of coronary blood flow that accompanies an escalating rate of myocardial metabolism. Heart rate is a major determinant of myocardial oxygen consumption; therefore, accelerating the heart rate by electrical pacing is a way to increase myocardial metabolic demands and increase coronary blood flow. Our reasoning was that if KV7 channels were involved in coronary metabolic vasodilation, then linopirdine should diminish pacing-induced coronary vasodilation. This would be similar to what we have shown previously for 4-aminopyridine, an unrelated K+ channel blocker (40). To elicit coronary metabolic vasodilation (Fig. 10), the heart was paced +25, +50, and +75 beats/min above the intrinsic rate. This was done before (control) and during intracoronary infusion of linopirdine to reach a concentration of 10 μM in the coronary plasma in two pigs. Under control conditions, pacing increased coronary blood flow an average of 6, 26, and 48% at +25, +50, and +75 beats/min, respectively. Linopirdine had no effect on coronary metabolic vasodilation, as coronary blood flow in the presence of this drug increased an average of 3, 28, and 51% at +25, +50, and +75 beats/min, respectively. Table 6 contains relevant arterial and coronary venous blood gas data obtained during these experiments; linopirdine treatment did not reduce coronary venous Po2 or oxygen content.

Fig. 10.

Fig. 10.

Linopirdine and coronary metabolic vasodilation. Coronary blood flow is plotted against the rate of myocardial oxygen consumption. Data are from 2 pigs. Measurements were made at resting heart rate and when heart rate was paced +25, +50, and +75 beats/min. This was done before (control; open symbols and dashed line for linear regression) and during intracoronary infusion of a KV7 channel antagonist (10 μM linopirdine; filled symbol and solid line for linear regression). Tachycardia significantly increased coronary blood flow during both pacing protocols. There was, however, no effect of linopirdine on the pacing-induced coronary blood flow response. In other words, linopirdine did not attenuate coronary metabolic vasodilation.

Table 6.

Blood gas parameters during cardiac pacing before and during linopirdine infusion

Pacing, beats/min
Baseline +25 +50 +75
Arterial
pH, mmHg
    Control 7.44 7.44 7.44 7.43
    Linopirdine 7.45 7.45 7.47 7.42
Pco2, mmHg
    Control 38 42 42 43
    Linopirdine 43 41 38 38
Po2, mmHg
    Control 93 93 91 87
    Linopirdine 91 92 96 95
O2 content, ml/dl
    Control 17.7 17.4 17.3 17.9
    Linopirdine 17.9 17.9 17.4 17.4
Venous
pH, mmHg
    Control 7.41 7.40 7.39 7.39
    Linopirdine 7.40 7.41 7.41 7.40
Pco2, mmHg
    Control 55 57 58 57
    Linopirdine 57 55 56 55
Po2, mmHg
    Control 18 18 18 19
    Linopirdine
O2 content, ml/dl 18 18 17 22
    Control 4.1 3.8 4.2 4.3
    Linopirdine 3.5 3.4 3.5 4.5

Note that the venous analysis was performed on blood drawn from a coronary vein. Data are represented as the average from 2 pigs.

Linopirdine and bradykinin-induced coronary vasodilation.

Our final in vivo experiment examined the effect of linopirdine on bradykinin-induced (endothelium dependent) coronary vasodilation. The rationale for this experiment was based on 1) our demonstrated role for the endothelium in flupirtine-induced relaxation of coronary artery rings (Fig. 3) and 2) the inhibition by linopirdine of bradykinin-induced relaxation in coronary artery rings (Fig. 4). For this experiment, coronary blood flow was measured across a range of intracoronary bradykinin infusion rates (0.03–0.3 μg/min) before and during intracoronary infusion of linopirdine to a plasma concentration of 30 μM (n = 4). Under control conditions, bradykinin infusion significantly increased coronary blood flow at all doses (Fig. 11). Simultaneous infusion of linopirdine significantly attenuated bradykinin-induced coronary vasodilation (Fig. 11). Neither the infusion of bradykinin nor linopirdine affected heart rate or systolic, diastolic, and mean blood pressures (Table 7).

Fig. 11.

Fig. 11.

Linopirdine inhibits bradykinin-induced coronary vasodilation in vivo. The plot shows group data (n = 4) for Δcoronary blood flow vs. intracoronary plasma concentration of bradykinin. Coronary blood flow responses were measured twice in each pig: the first set of bradykinin responses was elicited under control conditions, whereas the second set of bradykinin responses was measured during simultaneous infusion of linopirdine to reach 30 μM in the coronary plasma. *P < 0.05 for Δcoronary blood flow values between groups.

Table 7.

Cardiac and hemodynamic parameters during in vivo bradykinin experiments

Bradykinin, μg/min
Baseline 0.03 0.1 0.3
Systolic pressure, mmHg
    Control 109 ± 12 105 ± 10 103 ± 10 105 ± 10
    Linopirdine 100 ± 9 106 ± 7 108 ± 6 107 ± 6
Diastolic pressure, mmHg
    Control 76 ± 9 72 ± 7 70 ± 6 71 ± 7
    Linopirdine 72 ± 5 74 ± 4 73 ± 4 71 ± 4
Mean pressure, mmHg
    Control 91 ± 10 87 ± 8 85 ± 7 86 ± 8
    Linopirdine 84 ± 6 88 ± 5 88 ± 4 87 ± 4
Heart rate, beats/min
    Control 85 ± 15 88 ± 17 91 ± 18 91 ± 18
    Linopirdine 96 ± 10 95 ± 15 90 ± 17 88 ± 18

DISCUSSION

By measuring coronary blood flow in anesthetized, open-chest swine, we tested the hypothesis that KV7 channels are present in cells of the coronary vascular wall and regulate vasodilation in vivo. We also used qPCR, Western blot, isometric tension recording, patch-clamp electrophysiology, and IHC to study KV7 channels (and their genes) in the porcine coronary artery. Our data indicate that KCNQ genes and KV7 channel protein are expressed in the vascular wall of coronary arteries. These KV7 channels are unlikely to be regulators of baseline coronary vascular resistance or redox-sensitive targets of H2O2. KV7 channels do not appear responsive to vasodilators produced by the ischemic myocardium or normal working myocardium (i.e., metabolic vasodilators). However, despite the apparent absence of an influence on some major physiological aspects of coronary vascular regulation, KV7 channels may play an important role in paracrine-mediated endothelium-dependent responses, because linopirdine significantly diminished coronary vasodilator responses to bradykinin ex vivo and in vivo.

KCNQ genes and KV7.4 protein are expressed in the coronary arteries of swine (Figs. 1 and 2). Functional KV7 channels are expressed in some cell type(s) of the vascular wall, because flupirtine relaxes coronary arteries in a linopirdine-sensitive manner ex vivo (Fig. 3). It is not clear what cell type(s) of the coronary vascular wall express KV7 channels, because they might be in the smooth muscle (Fig. 5) and/or the other cell types such as the endothelium (Figs. 2, 4, and 11). We did not observe effects of KV7 channel modulators by themselves (i.e., no flupirtine-induced vasodilation or any linopirdine-induced vasoconstriction; Fig. 7). Thus KV7 channels apparently do not determine the basal level of coronary vascular resistance [although they are seemingly expressed in coronary resistance vessels <200 μm in diameter (11); Fig. 2]. Similarly, there was no linopirdine-sensitivity in the responses to some of the most physiologically relevant stimuli (tachycardia or ischemia; Figs. 8 and 10).

In isolated coronary rings, we observed flupirtine-induced and linopirdine-sensitive vascular relaxation (Fig. 3) that might be attributed to KV7 channels, particularly KV7 channels of the endothelium (Fig. 2). KV7 channel modulators could theoretically influence vascular tone in at least two ways. The first way would be a direct effect whereby KV7 channel agonists and antagonists change the membrane potential of vascular smooth muscle by binding to KV7 channels in the sarcolemma. This direct action has been demonstrated using current-clamp techniques on single vascular smooth muscle cells from the mouse portal vein, where KV7 channel inhibition depolarized the membrane potential (49). Our data do not strongly support this idea of a direct smooth muscle action of KV7 modulators, at least with regard to the coronary circulation of swine, because linopirdine did not have inhibitory effects on the steady-state current in smooth muscle cells where one would expect to see KV7 channels function (Fig. 6). The second mode of action would be an indirect effect in which KV7 channel agonists and antagonists do not act on the vascular smooth muscle cell itself, but rather on neighboring cell types (e.g., neurons, endothelium, or adipocytes) to influence the production and/or release of vasoactive factors (e.g., norepinephrine, nitric oxide, or hydrogen sulfide, etc.). This type of indirect action has been demonstrated for sympathetic nerves innervating rat mesenteric arteries, where KV7 channel inhibition enhances excitatory purinergic neurotransmission (19). Our data do support an indirect action of KV7 channel modulators and indicate 1) a role for the endothelium in flupirtine-induced relaxation of coronary artery rings (Fig. 3), 2) the function of linopirdine-sensitive KV7 channels in bradykinin-induced coronary relaxation ex vivo (Fig. 4) and vasodilation in vivo (Fig. 11), and 3) endothelial expression of KV7.4 immunoreactivity (Fig. 2). The direct and indirect mechanisms of KV7 channel modulators are likely not exclusive, because they could interact to regulate vascular tone. For example, KV7 channel inhibition contracts murine arteries and also augments contractions to the adrenergic agonist phenylephrine (50).

Members of the KV7 channel family are encoded by five known genes (KCNQ1–KCNQ5). Expression of these genes produces subunits that make up delayed rectifier (noninactivating) K+ channels such as the classic M-current, named for its suppression by muscarinic agonists (6). KV7 channels are widely recognized to regulate the excitability of cardiac myocytes and neurons. Moreover, defects in these genes (at least KCNQ1 through KCNQ4) cause channel dysfunction and underlie a variety of pathologies such as long QT syndrome, epilepsy, and deafness. The first description of KV7 channels in vascular smooth muscle was made over a decade ago, when KCNQ1 and a novel splice variant, KCNQ1b, were observed in the mouse portal vein (29, 35). Since that seminal observation, it has been found that KCNQ isoforms are also expressed in gastrointestinal, myometrium, airway, and bladder smooth muscle (1, 7, 17, 29). KV7 channels can be homo- or heterotetramers; however, data regarding which subunits can form heteromers in vascular tissues is recent (10), and we do not yet know the exact subunit composition of KV7 channels in swine coronary vascular smooth muscle. Subunit composition is likely to influence the responses to physiological regulators (8), including responses to endothelium-derived relaxing factors (16), paracrine molecules (10), and transmembrane signaling machinery (43).

We found mRNA encoding KV7 channels to be present in the coronary artery, but we do not definitively know what cell type(s) is(are) expressing the genes. Specifically, our qPCR and Western blot results (Fig. 1) do not necessarily indicate that KV7 channels are expressed in the vascular smooth muscle, and our IHC data (Fig. 2) suggest that the mRNA signal may possibly arise from cells in the adventitia or intima. The presence of KV7 channels in various cells of the vascular wall could potentially explain the flupirtine-induced and linopirdine-sensitive relaxation of LCx artery rings (Fig. 3). That is, the KV7 drugs may be acting on cells that release factors responsible for the vascular relaxation (endothelium- and/or adipocyte-derived relaxing factors). The presence of KV7 channels in cells of the intimal layer could potentially explain the endothelial dependence of flupirtine-induced relaxation (Fig. 3) and the linopirdine-sensitivity of bradykinin-induced vascular relaxation ex vivo (Fig. 4) and bradykinin-induced coronary vasodilation in vivo (Fig. 11). Mechanisms might conceivably include KV7 channel contributions to endothelial membrane potential, Ca2+ influx, and the production of relaxing factors.

It was recently reported that KV7 channels are expressed in porcine coronary arteries and involved in hypoxic vasodilation (16). Similar to our experiments, Hedegaard et al. (16) used whole artery samples and detected KCNQ1–KCNQ5 transcripts by RT-PCR as well as KV7.4 (and KV7.5) protein by Western blot analysis. Our IHC data extend their work and demonstrate a nonuniform distribution of KV7.4 immunoreactivity across the cell types of the vascular wall (Fig. 2). Our patch-clamp work differs from theirs in that we used different KV7 channel blockers (linopirdine vs. XE991), but we both demonstrate some moderate inhibition of K+ current in coronary vascular smooth muscle at more depolarized test potentials, but no apparent membrane potential change (i.e., the voltage at which the whole cell current reverses does not visibly depolarize with application of a KV7 channel antagonist).

The findings of the present study agree with the recent findings of Lee et al. (23), who demonstrated marked heterogeneity in KV7 channel function in cerebral and coronary smooth muscle of mice. These investigators studied the expression and function of KV7 channels in the cerebral (circle of Willis, basilar artery) and coronary (LAD artery) circulations. KCNQ4 was the predominant transcript observed, and although KV7.4 protein was detected in the LAD artery, its expression was greatly reduced compared with that in the cerebral vessels. There was no significant K+ current in murine LAD artery myocytes that was sensitive to KV7 channel modulators, unlike myocytes from the circle of Willis or basilar artery. The absence of major KV7 channel function in coronary smooth muscle certainly contrasts with numerous studies in a wide variety of vascular beds (cf. most references in Table 2), but it should be recognized that KCNQ knockout mice have no known coronary phenotypic differences, and moreover, no vascular (or other smooth muscle) abnormalities have been reported for mice lacking KCNQ genes. These knockout animals do, however, demonstrate profound deficits in other body systems, including cardiac long QT syndrome, inner ear problems, deafness, intestinal epithelium dysfunction, pancreatic disorders, epilepsy, etc.

A caveat for our in vivo studies is the use of pharmacological agents and whether the coronary plasma concentrations of KV7 activators and inhibitors might possibly be insufficient. Existing literature seems to validate the doses (intracoronary plasma concentrations) we used. For example, intravenous linopirdine at 0.10 mg/kg increases mean arterial pressure in Sprague-Dawley rats (26), and values for rat blood volume (22) and hematocrit (37) allow one to translate that dose to initial plasma concentrations between 6.5 and 9.8 μM. Linopirdine blocks all five KV7 subtypes with IC50 values between 5 and 16 μM (15). We used 10–30 μM linopirdine in most experiments (e.g., Figs. 8–11) and up to 100 μM in the experiment shown in Fig. 7, which should be an effective range. Furthermore, we infused linopirdine directly into the coronary circulation, alleviating any concerns about hepatic metabolism. A plasma concentration of 10 μM should be sufficient, because doubling the dose to 20 μM linopirdine has no further effect on the constriction of isolated rat isolated mesenteric arteries (26). Moreover, we assessed a number of KV7 channel modulators in vivo in search of coronary vascular effects. For example, we tried three different KV7 agonists (flupirtine, L364-373, and retigabine), none of which were able to increase coronary blood flow. Flupirtine should be an ideal KV7 modulator for our in vivo studies, because it has been in therapeutic use for over 30 years, has excellent bioavailability, and shows high selectivity for KV7 channel activation [with reports of significant vasodilation at concentrations ≥100 nM (32)]. However, we obtained no evidence suggesting that flupirtine (or any other KV7 channel modulator) altered coronary vascular tone. Another caveat concerns the patch-clamp measurements we made at room temperature (Figs. 5 and 6) and their comparison to results of ex vivo and in vivo experiments at physiological temperatures (Figs. 3, 4, and 8–11). KV7 channels are temperature sensitive, but not in a manner that we would expect to change our conclusion. This is because increasing temperature accelerates activation and inactivation kinetics and increases the maximal conductance, but the voltage dependence of activation and pharmacology are little affected (30). Thus we would predict that experiments at more physiological temperatures would increase the size of any KV7 currents and change their shape (i.e., kinetics); however, elevated temperature would be unlikely to change the effects of KV7 channel modulators.

The data lead us to conclude that KCNQ genes (and KV7.4 protein) are expressed in some cells of the coronary vascular wall and that KV7 channels play a role in endothelium-dependent vasodilation. The mechanism(s) by which KV7 channels modulate endothelial responses have not been identified. Additionally, it may be important to further study the distribution of KV7.5 in the coronary vascular wall, because KCNQ5 expression was also high. The search for specific K+ channels that regulate baseline coronary vascular resistance and function as end effectors in metabolic and ischemic coronary vasodilation would likely benefit from focus on other KV channel families, such as KV1 (12, 34).

GRANTS

This study was supported by National Heart, Lung, and Blood Institute Grants U01HL118738 (to D. Beard and G. Kassab) and R01HL11760 (to J. Tune and K. Mather). A. G. Goodwill was supported by American Heart Association Award 13POST1681001813. J. N. Noblet and D. Sassoon were supported by National Center for Advancing Translational Sciences, Clinical and Translational Sciences Award TL1 TR000162 (to A. Shekhar).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

A.G.G., L.F., J.N.N., E.D.C., D.J.S., Z.B., G.S.K., J.D.T., and G.M.D. conception and design of research; A.G.G., L.F., J.N.N., E.D.C., D.J.S., Z.B., G.S.K., J.D.T., and G.M.D. performed experiments; A.G.G., L.F., J.N.N., E.D.C., D.J.S., Z.B., G.S.K., J.D.T., and G.M.D. analyzed data; A.G.G., L.F., J.N.N., E.D.C., D.J.S., Z.B., G.S.K., J.D.T., and G.M.D. interpreted results of experiments; A.G.G., L.F., J.N.N., E.D.C., D.J.S., Z.B., G.S.K., J.D.T., and G.M.D. prepared figures; A.G.G., L.F., J.N.N., E.D.C., D.J.S., Z.B., G.S.K., J.D.T., and G.M.D. edited and revised manuscript; A.G.G., L.F., J.N.N., E.D.C., D.J.S., Z.B., G.S.K., J.D.T., and G.M.D. approved final version of manuscript; G.M.D. drafted manuscript.

REFERENCES

  • 1.Anderson UA, Carson C, Johnston L, Joshi S, Gurney AM, McCloskey KD. Functional expression of KCNQ (Kv7) channels in guinea pig bladder smooth muscle and their contribution to spontaneous activity. Br J Pharmacol 169: 1290–1304, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Beard DA, Schenkman KA, Feigl EO. Myocardial oxygenation in isolated hearts predicted by an anatomically realistic microvascular transport model. Am J Physiol Heart Circ Physiol 285: H1826–H1836, 2003. [DOI] [PubMed] [Google Scholar]
  • 3.Berne RM. Cardiac nucleotides in hypoxia: possible role in regulation of coronary blood flow. Am J Physiol 204: 317–322, 1963. [DOI] [PubMed] [Google Scholar]
  • 4.Berwick ZC, Dick GM, Moberly SP, Kohr MC, Sturek M, Tune JD. Contribution of voltage-dependent K channels to metabolic control of coronary blood flow. J Mol Cell Cardiol 52: 912–919, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Berwick ZC, Dick GM, O'Leary HA, Bender SB, Goodwill AG, Moberly SP, Owen MK, Miller SJ, Obukhov AG, Tune JD. Contribution of electromechanical coupling between Kv and Ca v1.2 channels to coronary dysfunction in obesity. Basic Res Cardiol 108: 370, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Brown DA, Adams PR. Muscarinic suppression of a novel voltage-sensitive K+ current in a vertebrate neurone. Nature 283: 673–676, 1980. [DOI] [PubMed] [Google Scholar]
  • 7.Brueggemann LI, Kakad PP, Love RB, Solway J, Dowell ML, Cribbs LL, Byron KL. Kv7 potassium channels in airway smooth muscle cells: signal transduction intermediates and pharmacological targets for bronchodilator therapy. Am J Physiol Lung Cell Mol Physiol 302: L120–L132, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Brueggemann LI, Mackie AR, Cribbs LL, Freda J, Tripathi A, Majetschak M, Byron KL. Differential protein kinase C-dependent modulation of Kv7.4 and Kv75 subunits of vascular Kv7 channels. J Biol Chem 289: 2099–2111, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Burgoyne JR, Oka S, Ale-Agha N, Eaton P. Hydrogen peroxide sensing and signaling by protein kinases in the cardiovascular system. Antioxid Redox Signal 18: 1042–1052, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chadha PS, Jepps TA, Carr G, Stott JB, Zhu HL, Cole WC, Greenwood IA. Contribution of kv7.4/kv7.5 heteromers to intrinsic and calcitonin gene-related peptide-induced cerebral reactivity. Arterioscler Thromb Vasc Biol 34: 887–893, 2014. [DOI] [PubMed] [Google Scholar]
  • 11.Chilian WM, Eastham CL, Marcus ML. Microvascular distribution of coronary vascular resistance in beating left ventricle. Am J Physiol Heart Circ Physiol 251: H779–H788, 1986. [DOI] [PubMed] [Google Scholar]
  • 12.Dick GM, Bratz IN, Borbouse L, Payne GA, Dincer UD, Knudson JD, Rogers PA, Tune JD. Voltage-dependent K+ channels regulate the duration of reactive hyperemia in the canine coronary circulation. Am J Physiol Heart Circ Physiol 294: H2371–H2381, 2008. [DOI] [PubMed] [Google Scholar]
  • 13.Gamper N, Zaika O, Li Y, Martin P, Hernandez CC, Perez MR, Wang AY, Jaffe DB, Shapiro MS. Oxidative modification of M-type K+ channels as a mechanism of cytoprotective neuronal silencing. EMBO J 25: 4996–5004, 2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gorman MW, Tune JD, Richmond KN, Feigl EO. Feedforward sympathetic coronary vasodilation in exercising dogs. J Appl Physiol 89: 1892–1902, 2000. [DOI] [PubMed] [Google Scholar]
  • 15.Gutman GA, Chandy KG, Grissmer S, Lazdunski M, McKinnon D, Pardo LA, Robertson GA, Rudy B, Sanguinetti MC, Stuhmer W, Wang X. International Union of Pharmacology. LIII. Nomenclature and molecular relationships of voltage-gated potassium channels. Pharmacol Rev 57: 473–508, 2005. [DOI] [PubMed] [Google Scholar]
  • 16.Hedegaard ER, Nielsen BD, Kun A, Hughes AD, Kroigaard C, Mogensen S, Matchkov VV, Frobert O, Simonsen U. KV 7 channels are involved in hypoxia-induced vasodilatation of porcine coronary arteries. Br J Pharmacol 171: 69–82, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jepps TA, Greenwood IA, Moffatt JD, Sanders KM, Ohya S. Molecular and functional characterization of Kv7 K+ channel in murine gastrointestinal smooth muscles. Am J Physiol Gastrointest Liver Physiol 297: G107–G115, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Joshi S, Sedivy V, Hodyc D, Herget J, Gurney AM. KCNQ modulators reveal a key role for KCNQ potassium channels in regulating the tone of rat pulmonary artery smooth muscle. J Pharmacol Exp Ther 329: 368–376, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kansui Y, Goto K, Ohtsubo T, Murakami N, Ichishima K, Matsumura K, Kitazono T. Facilitation of sympathetic neurotransmission by phosphatidylinositol-4,5-bisphosphate-dependent regulation of KCNQ channels in rat mesenteric arteries. Hypertens Res 35: 909–916, 2012. [DOI] [PubMed] [Google Scholar]
  • 20.Khanamiri S, Soltysinska E, Jepps TA, Bentzen BH, Chadha PS, Schmitt N, Greenwood IA, Olesen SP. Contribution of Kv7 channels to basal coronary flow and active response to ischemia. Hypertension 62: 1090–1097, 2013. [DOI] [PubMed] [Google Scholar]
  • 21.Kokusho Y, Komaru T, Takeda S, Takahashi K, Koshida R, Shirato K, Shimokawa H. Hydrogen peroxide derived from beating heart mediates coronary microvascular dilation during tachycardia. Arterioscler Thromb Vasc Biol 27: 1057–1063, 2007. [DOI] [PubMed] [Google Scholar]
  • 22.Lee HB, Blaufox MD. Blood volume in the rat. J Nucl Med 26: 72–76, 1985. [PubMed] [Google Scholar]
  • 23.Lee S, Yang Y, Tanner MA, Li M, Hill MA. Heterogeneity in Kv7 channel function in the cerebral and coronary circulation. Microcirculation 22: 109–121, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li SS, Ran YJ, Zhang DD, Li SZ, Zhu D. MicroRNA-190 regulates hypoxic pulmonary vasoconstriction by targeting a voltage-gated K+ channel in arterial smooth muscle cells. J Cell Biochem 115: 1196–1205, 2014. [DOI] [PubMed] [Google Scholar]
  • 25.Linley JE, Pettinger L, Huang D, Gamper N. M channel enhancers and physiological M channel block. J Physiol 590: 793–807, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Mackie AR, Brueggemann LI, Henderson KK, Shiels AJ, Cribbs LL, Scrogin KE, Byron KL. Vascular KCNQ potassium channels as novel targets for the control of mesenteric artery constriction by vasopressin, based on studies in single cells, pressurized arteries, and in vivo measurements of mesenteric vascular resistance. J Pharmacol Exp Ther 325: 475–483, 2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mackie AR, Byron KL. Cardiovascular KCNQ (Kv7) potassium channels: physiological regulators and new targets for therapeutic intervention. Mol Pharmacol 74: 1171–1179, 2008. [DOI] [PubMed] [Google Scholar]
  • 28.Mani BK, Brueggemann LI, Cribbs LL, Byron KL. Activation of vascular KCNQ (Kv7) potassium channels reverses spasmogen-induced constrictor responses in rat basilar artery. Br J Pharmacol 164: 237–249, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.McCallum LA, Pierce SL, England SK, Greenwood IA, Tribe RM. The contribution of Kv7 channels to pregnant mouse and human myometrial contractility. J Cell Mol Med 15: 577–586, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Miceli F, Cilio MR, Taglialatela M, Bezanilla F. Gating currents from neuronal KV7.4 channels: general features and correlation with the ionic conductance. Channels 3: 274–283, 2009. [PubMed] [Google Scholar]
  • 31.Miura H, Bosnjak JJ, Ning G, Saito T, Miura M, Gutterman DD. Role for hydrogen peroxide in flow-induced dilation of human coronary arterioles. Circ Res 92: e31–e40, 2003. [DOI] [PubMed] [Google Scholar]
  • 32.Morecroft I, Murray A, Nilsen M, Gurney AM, MacLean MR. Treatment with the Kv7 potassium channel activator flupirtine is beneficial in two independent mouse models of pulmonary hypertension. Br J Pharmacol 157: 1241–1249, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ng FL, Davis AJ, Jepps TA, Harhun MI, Yeung SY, Wan A, Reddy M, Melville D, Nardi A, Khong TK, Greenwood IA. Expression and function of the K+ channel KCNQ genes in human arteries. Br J Pharmacol 162: 42–53, 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ohanyan V, Yin L, Bardakjian R, Kolz C, Enrick M, Hakobyan T, Kmetz JG, Bratz I, Luli J, Nagane M, Khan N, Hou H, Kuppusamy P, Graham J, Fu FS, Janota D, Oyewumi MO, Logan SJ, Lindner JR, Chilian WM. Requisite role of Kv1.5 channels in coronary metabolic dilation. Circ Res 117: 612–621, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ohya S, Sergeant GP, Greenwood IA, Horowitz B. Molecular variants of KCNQ channels expressed in murine portal vein myocytes: a role in delayed rectifier current. Circ Res 92: 1016–1023, 2003. [DOI] [PubMed] [Google Scholar]
  • 36.Oliveras A, Roura-Ferrer M, Sole L, de la Cruz A, Prieto A, Etxebarria A, Manils J, Morales-Cano D, Condom E, Soler C, Cogolludo A, Valenzuela C, Villarroel A, Comes N, Felipe A. Functional assembly of Kv7.1/Kv75 channels with emerging properties on vascular muscle physiology. Arterioscler Thromb Vasc Biol 34: 1522–1530, 2014. [DOI] [PubMed] [Google Scholar]
  • 37.Probst RJ, Lim JM, Bird DN, Pole GL, Sato AK, Claybaugh JR. Gender differences in the blood volume of conscious Sprague-Dawley rats. J Am Assoc Lab Anim Sci 45: 49–52, 2006. [PMC free article] [PubMed] [Google Scholar]
  • 38.Rogers PA, Chilian WM, Bratz IN, Bryan RM Jr, Dick GM. H2O2 activates redox- and 4-aminopyridine-sensitive KV channels in coronary vascular smooth muscle. Am J Physiol Heart Circ Physiol 292: H1404–H1411, 2007. [DOI] [PubMed] [Google Scholar]
  • 39.Rogers PA, Dick GM, Knudson JD, Focardi M, Bratz IN, Swafford AN Jr, Saitoh S, Tune JD, Chilian WM. H2O2-induced redox-sensitive coronary vasodilation is mediated by 4-aminopyridine-sensitive K+ channels. Am J Physiol Heart Circ Physiol 291: H2473–H2482, 2006. [DOI] [PubMed] [Google Scholar]
  • 40.Saitoh S, Zhang C, Tune JD, Potter B, Kiyooka T, Rogers PA, Knudson JD, Dick GM, Swafford A, Chilian WM. Hydrogen peroxide: a feed-forward dilator that couples myocardial metabolism to coronary blood flow. Arterioscler Thromb Vasc Biol 26: 2614–2621, 2006. [DOI] [PubMed] [Google Scholar]
  • 41.Schenkman KA, Beard DA, Ciesielski WA, Feigl EO. Comparison of buffer and red blood cell perfusion of guinea pig heart oxygenation. Am J Physiol Heart Circ Physiol 285: H1819–H1825, 2003. [DOI] [PubMed] [Google Scholar]
  • 42.Schleifenbaum J, Kassmann M, Szijarto IA, Hercule HC, Tano JY, Weinert S, Heidenreich M, Pathan AR, Anistan YM, Alenina N, Rusch NJ, Bader M, Jentsch TJ, Gollasch M. Stretch-activation of angiotensin II type 1a receptors contributes to the myogenic response of mouse mesenteric and renal arteries. Circ Res 115: 263–272, 2014. [DOI] [PubMed] [Google Scholar]
  • 43.Stott JB, Povstyan OV, Carr G, Barrese V, Greenwood IA. G-protein betagamma subunits are positive regulators of Kv7.4 and native vascular Kv7 channel activity. Proc Natl Acad Sci USA 112: 6497–6502, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Svalø J, Bille M, Parameswaran Theepakaran N, Sheykhzade M, Nordling J, Bouchelouche P. Bladder contractility is modulated by Kv7 channels in pig detrusor. Eur J Pharmacol 715: 312–320, 2013. [DOI] [PubMed] [Google Scholar]
  • 45.Winterbourn CC. The biological chemistry of hydrogen peroxide. Methods Enzymol 528: 3–25, 2013. [DOI] [PubMed] [Google Scholar]
  • 46.Yada T, Shimokawa H, Hiramatsu O, Kajita T, Shigeto F, Goto M, Ogasawara Y, Kajiya F. Hydrogen peroxide, an endogenous endothelium-derived hyperpolarizing factor, plays an important role in coronary autoregulation in vivo. Circulation 107: 1040–1045, 2003. [DOI] [PubMed] [Google Scholar]
  • 47.Yada T, Shimokawa H, Hiramatsu O, Shinozaki Y, Mori H, Goto M, Ogasawara Y, Kajiya F. Important role of endogenous hydrogen peroxide in pacing-induced metabolic coronary vasodilation in dogs in vivo. J Am Coll Cardiol 50: 1272–1278, 2007. [DOI] [PubMed] [Google Scholar]
  • 48.Yeung S, Schwake M, Pucovsky V, Greenwood I. Bimodal effects of the Kv7 channel activator retigabine on vascular K+ currents. Br J Pharmacol 155: 62–72, 2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Yeung SY, Greenwood IA. Electrophysiological and functional effects of the KCNQ channel blocker XE991 on murine portal vein smooth muscle cells. Br J Pharmacol 146: 585–595, 2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Yeung SY, Pucovsky V, Moffatt JD, Saldanha L, Schwake M, Ohya S, Greenwood IA. Molecular expression and pharmacological identification of a role for Kv7 channels in murine vascular reactivity. Br J Pharmacol 151: 758–770, 2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Zavaritskaya O, Zhuravleva N, Schleifenbaum J, Gloe T, Devermann L, Kluge R, Mladenov M, Frey M, Gagov H, Fesus G, Gollasch M, Schubert R. Role of KCNQ channels in skeletal muscle arteries and periadventitial vascular dysfunction. Hypertension 61: 151–159, 2013. [DOI] [PubMed] [Google Scholar]
  • 52.Zhong XZ, Harhun MI, Olesen SP, Ohya S, Moffatt JD, Cole WC, Greenwood IA. Participation of KCNQ (Kv7) potassium channels in myogenic control of cerebral arterial diameter. J Physiol 588: 3277–3293, 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Heart and Circulatory Physiology are provided here courtesy of American Physiological Society

RESOURCES