Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 May 14.
Published in final edited form as: Methods Mol Biol. 2016;1419:131–144. doi: 10.1007/978-1-4939-3581-9_11

Detection of Cell Death in Drosophila Tissues

Deepika Vasudevan 1, Hyung Don Ryoo 1,*
PMCID: PMC4867113  NIHMSID: NIHMS785423  PMID: 27108437

Abstract

Drosophila has served as a particularly attractive model to study cell death due to the vast array of tools for genetic manipulation under defined spatial and temporal conditions in vivo as well as in cultured cells. These genetic methods have been well supplemented by enzymatic assays and a panel of antibodies recognizing cell death markers. This chapter discusses reporters, mutants and assays used by various laboratories to study cell death in the context of development and in response to external insults.

Keywords: Drosophila cell death reporters, TUNEL, Acridine orange, Immunostaining, DEVD cleavage assay

1. Introduction

Drosophila is a highly popular experimental model for studying various aspects of biological problems as they can be easily genetically manipulated and have relatively short lifecycles. The Drosophila community over the last hundred years has built a formidable library of mutants, transgenes, transgenic reporter lines and genetic techniques that allow study of many processes and pathways. This includes programmed cell death (PCD), which makes possible the metamorphosis from larvae to adult flies, and also plays many other important roles in development.

Similar to other organisms, cell death pathways in Drosophila can be activated in response to DNA damage and excess stress imposed in various subcellular compartments by extrinsic factors. While the apoptotic cascade in Drosophila culminates in the activation of initiator and effector caspases, the upstream components vary from canonical apoptotic genes in mammals. There are seven known caspases: Dredd[1], Dronc[2], and Strica[3] are initiator caspases; Drice[4], DCP-1[5], DECAY[6] and DAMM[7] are effector caspases. These caspases are synthesized as inactive zymogens, but gain activity after proteolytic processing. In Drosophila, a family of proteins called Inhibitors of apoptosis proteins (IAPs) play particularly prominent roles in regulating caspase activity [8]. There are three known IAPs – DIAP1 [8], DIAP2 [9, 10] and BRUCE[11–13]. There is certain degree of tissue-specificity and mutual redundancy between the caspases and IAPs and this is extensively reviewed elsewhere [14–16]. When death-inducing signals are received by cells, IAPs are inactivated by the IAP-antagonists: hid[17], reaper[18], grim[19] and sickle[20–22] (Figure 1). Inhibition of IAPs trigger apoptosis in most somatic cells of Drosophila, as caspases are constantly undergoing proteolytic activation in living cells, only to be inhibited by IAPs. Specifically, the Drosophila initiator caspase Dronc constitutively forms a complex with the adaptor protein Dark, even without cytochrome c released from the mitochondria [23]. In living cells, the small amount of activated caspases engage in negative feedback, with the help of IAPs. In cells doomed to die, inhibition of IAPs by IAP-antagonists leads to the stable activation Dronc and Dark[24]. This leads to the activation of effector caspases such as Drice, which subsequently orchestrate apoptosis by cleaving various nuclear and cytoplasmic proteins.

Figure 1.

Figure 1

Open in a new tab

A schematic showing various manipulatable elements of the cell death pathway in Drosophila: See text.

A dramatic case of programmed cell death (PCD) associated with normal development occurs during metamorphosis. In this case, cell death is largely under the control of ecdysone, a steroid hormone. Spikes in ecdysone levels are seen at the interface of the major development stages -embryo hatching, larval molting, pupariation and pupation[25, 26]. The most morphological change and correspondingly the largest ecdysone spike occurs during pupation when entire larval organs, such as the gut and salivary gland, are eliminated by PCD to give way to adult tissues. It is thus not surprising that ectopic misexpression of ecdysone and other apoptotic pathway proteins has dire developmental consequences[27, 28].

This overview of cell death in Drosophila, while simplistic, provides the basis for methods detailed in this chapter. Section 2 of this chapter discusses genetic and genotoxic methods of inducing or blocking cell death. Section 3 discusses cell biological and biochemical assays to visualize and quantify cell death. Both sections discuss methods that can be used in larvae, adults and in cultured cells. Overall, this chapter attempts to illuminate what makes Drosophila a comprehensive model for studying cell death: the ability to finely regulate expression of genes with spatial and temporal control, and the variety of physiological contexts that can be simulated.

2. Materials

  • 2.1

    Fly stocks: Commonly used fly stocks and suggested sources are described in Table 1.

  • 2.2

    S2/S2R+/SL2 cell culture media: Schneider's Insect Cell Medium (Life Technologies), 10% Fetal Bovine Serum (Life Technologies), 1% Penicillin/Streptomycin (Life Technologies).

  • 2.3

    PBS (Phosphate Buffer Saline): 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4. 10x stock can be made and stored at room temperature.

  • 2.4

    Ringer's solution: 116 mM NaCl, 1.2 mM KCl, 1 mM CaCl2, pH 7.4.

  • 2.5

    Fixative for tissue staining: 4% paraformaldehyde, 1x PBS, made fresh.

  • 2.6

    PBT (Phosphate Buffer Tween): 0.1% Tween-20, PBS.

  • 2.7

    Blocking buffer for immunostaining: 10% donkey serum or 3% BSA, PBT.

  • 2.8

    AO stain (Acridine Orange stain): 1.25 μg/ml AO, 50% heptane.

  • 2.9

    Lysis buffer for larval tissue: 50 mM Tris, 1 mM EDTA, 10 mM EGTA, 10 μM digitonin.

  • 2.10

    2x reaction buffer for DEVD assay: 50 mM HEPES pH 7.4, 20 mM MgCl2, 200 mM NaCl, 0.1% NP40.

  • 2.11

    Fixative for cells: 10% formaldehyde, PBS.

Table 1.

Commonly used fly lines for modulating and observing cell death

Fly Lines Available sources
hid, reaper, grim deletion - Df(3L)H99 BDSC, Kyoto DGGR
droncRNAi VDRC, TRiP
driceRNAi
dcp-1RNAi
dreddRNAi
diap1RNAi TRiP
Gain of function
uas-hid BDSC
uas-reaper BDSC, Kyoto DGGR
gmr-hid
heat shock-hid
Reporters
rpr-lacZ Laboratories of Hermann Steller, Andreas Bergmann and John Abrams
hid-lacZ
Open in a new tab

3. Methods

3.1. Tools for manipulating cell death

This section aims to give an overview of methodologies used to either block or induce cell death. Genetic methods are useful when precise control is needed over tissue and cell type while genotoxic methods can be used to induce organism wide cell death. Chemical methods are mostly used in cell culture studies, often to corroborate results seen in vivo.

3.1.1. Genetic tools for blocking or inducing cell death in Drosophila

The four pro-apoptotic genes, hid, reaper, grim and sickle are clustered together in a genetic locus on the 3L chromosome [14, 29]. Various deletions of of this locus have been employed to block cell death but the most commonly used strain is a 3rd chromosome deficiency, Df(3L)H99, which deletes hid, reaper and grim. Mild phenotypes have been observed when only one copy of the H99 locus remains[30–34] but homozygotic mutants abolish virtually all apoptosis [17–19, 35]. Conversely, induction of IAP-antagonists in response to DNA damage or stress (proteotoxicity, viral infection, etc) is mediated by p53, overexpression of which can be used to induce cell death[36, 37].

Cell death can also be inhibited by deletion or RNAi knockdown of caspases such as Dronc, Drice, DCP-1 and Dredd [9], etc. On the other hand, cell death can be induced by deleting or RNAi-mediated knockdown of anti-apoptotic genes such as DIAP1 [9] using the GAL4-UAS system[38]. In this system, a promoter typically drives the expression of a transcription factor, GAL4, which in turn induces the expression of any gene downstream of a UAS element. This two-component system allows for tissue-specific control of transgene expression. A further level of temporal control can be added using a number of genetic tools. For example, one strategy employs the GAL80 transcription factor, which inhibits GAL4 activity. GAL80 temperature sensitive (GAL80TS) mutants are widely used to grow animals at GAL80-permissive temperatures to the desired developmental stage before upshifting to a non-permissive temperature where GAL80 activity is inhibited and hence GAL4 activity is restored [39]. Another popular system for temporal control of gene expression is the Geneswitch system, where GAL4 is fused to a mifepristone-responsive promoter [40]. Thus GAL4 will be active only in the presence of mifepristone, which can be regulated via diet. Often GAL4-driven expression of a transgene in the entire tissue results in various side effects, for which experimental controls are difficult to design. To circumvent this issue, transgene expression can be induced in small sections of the tissue using clonal analysis. Mosaic analysis with a repressible cell marker (MARCM) utilizes site-specific recombinases under the control of inducible promoters in combination with the GAL4-GAL80 system to generate subpopulations of cells that express a given transgene [41]. Surrounding tissue that did not undergo recombination serves as a great internal control for the experiment.

In addition to the methods described above, there are several other genetic tricks that provide various degrees of control over GAL4 expression and these are discussed in detail elsewhere [42].

Transgenic lines that fuse pro-apoptotic genes such as reaper or hid directly to tissue specific promoters have also been used widely to induce apoptosis [17] and this has been the basis of many screens to identify new modulators of cell death. For example, overexpression of hid in the Drosophila eye using the GMR-promoter results in ablation of the eye (Figure 2). This phenotype is readily visible and hence convenient to score for. Our laboratory and others have utilized this system to identify many different components of the cell death machinery[9]. Table 1 lists transgenic fly lines which can be been to induce or block cell death.

Figure 2.

Figure 2

Open in a new tab

High resolution image of Drosophila eye: Overexpression of the pro-apoptotic gene, hid, using the eye-specific promoter gmr results in eye ablation (right) when compared to wild type eyes (left).

In cultured S2, SL2 and S2R+ cells (Life Technologies, see 2.2), hid, reaper or apaf overexpression can induce apoptosis[43–45]. Overexpression constructs are typically under the control of an inducible promoter and are transiently transfected into cells using a lipid-based transfection reagent such as Effectene (Qiagen).

3.1.2. Genotoxic methods to induce cell death

The most common method of inducing DNA damage in flies is by ionizing irradiation. In adults, 40 Gy of gamma-ray radiation is an efficient way to induce massive apoptosis and for larvae, a lower dose (20 Gy) maybe sufficient. The animals are allowed to recover for 2–3 hours prior to dissecting out desired tissues to observe for markers of apoptosis. UV irradiation at 254nm and 40 mJ/cm2 can also be used to induce apoptosis in embryos, adult and larval tissues [46]. Recovery time before dissection may vary from 4–10 hours.

In cultured cells cells, apoptosis can be induced by any of the following methods: 1 μM staurosporine or 10 μM ecdysone for 24 hours, 200nM Actinomycin D for 3–8 hours, UV-irradiation at 200 mJ/cm2 followed by 4–12 hour recovery[43, 45, 47]. When using irradiation, cells should be cultured in UV-transparent plates to allow for exposure.

3.2. Detecting cell death

Reflecting their roles as initiators of apoptosis in Drosophila, the expression pattern of reaper, grim and sickle coincides with that of apoptosis [19–21, 35]. Based on these observations, reporters have been made that can be used to monitor cell death in your favourite tissue. The first described reaper-lacZ reporter was generated by placing an 11-kb radiation reaper upstream element driving lacZ expression[48]. Subsequently other groups have whittled down this region to generate more fine-tuned reporters that respond to specific types of injury and stress [36, 49]. Section 3.1 describes how to examine lacZ expression using antibody staining. A similar reporter for hid has also been employed to monitor cell death in tissues[50]. Apoptotic pathways can be cell-type or tissue-type specific [51], so it maybe worth trying multiple methodologies when experimenting with a less explored tissue.

An important control to consider when designing experiments is to ensure that all animals being compared in the study, embryo, larvae or adult, are of similar age and thus at similar developmental stages. Age is especially relevant when studying apoptosis in the developing embryo. Eggs are collected in large cages on grape juice or apple juice plates smeared with yeast paste to encourage laying. Plates can be switched out in timed intervals so as to control the age of the embryo. For accurate staging, the first plate must be discarded since flies can carry embryos in their oviducts for 30 minutes before laying them. Eggs have a protective proteinaceous covering called the chorion. Embryos must be dechorionated to allow for penetration of both staining agents and for effective lysis.

  • Add 66% bleach to the apple juice plates and incubate for 3 minutes.

  • Collect embryos in a mesh basket and thoroughly rinse with tap water for at least 3 minutes before transferring to a microfuge tube containing PBS (2.3).

Dissect larvae and adults in PBS (2.3) or Ringer's solution (2.4). When dissecting several samples, store tissues in a dissection dish or microfuge tube containing PBS (2.3). For staining experiments, leave the carcass of the organism attached until just before mounting. This allows samples to sink to the bottom of tubes making washes and solution changes easier. For imaging apoptosis in S2 cells, it is best to culture them in poly-lysine coated multi-chamber slide (Nunc). The chamber allows for the entire staining process to be done on the slide and can be removed prior to mounting.

3.2.1. Cell biological assays

Apoptotic cells can be visualized using the TUNEL labeling or by staining for specific apoptotic marker. For either type of assay, the samples are prepared as follows.

  • Incubate sample in fixative (2.5) for 20 minutes. Please note that the strength of the PFA and the duration of fixing may vary by tissue type.

  • Wash fixed samples in PBT (2.6) for 5 minute thrice. This step permeabilizes samples using the detergent, Tween-20, to allow for reagent penetration.

TUNEL assay

TUNEL is abbreviated for Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) and is based on the detection of fragmented DNA ends, which are characteristic of apoptotic cells. A deoxynucleotidyl transferase (TdT) is used to add modified nucleotides to double- and single-stranded DNA breaks. The modified nucleotides, such as digoxigenin-dUTP, can then be detected using specific antibodies. Several commercial kits provide complete panels of reagents with different dUTP. This protocol describes staining of tissues or cells prepared as described in the previous section using Apoptag (Millipore).

  • Equilibriate samples in the buffer provided at room temperature.

  • Incubate in appropriate volume (till tissue is submerged) of the TdT reaction mixture (2:1 mixture of reaction buffer and TdT enzyme) for 1 hour at 37°C.

  • Stop the reaction by the adding the stop buffer (diluted 34:1 with distilled water). Agitate for 15 second and incubate at room temperature for 10 minutes.

  • Wash 3 times with PBT, 5 minutes each.

  • Incubated with a fluor-conjugated anti-digoxigenin antibody according to manufacturer's instructions for 2 hours at room temperature.

  • If desired, counterstain with DAPI (300 nM final concentration) for 5 minutes at room temperature toward the end of the previous incubation.

  • Wash 3 times with PBT, 10 minutes each.

  • Mount samples on glass slide in a suitable medium such as Vectashield (Life Technologies) or 50% glycerol (sterile) and visualize using a fluorescent or confocal microscope (Figure 3).

Figure 3.

Figure 3

Open in a new tab

TUNEL staining of 3rd instar larval eye imaginal discs: Discs expressing mutant Rh-1G69D that imposes stress in the endoplasmic reticulum show increased TUNEL staining (right) in comparison to the wild type control (left).

Other markers of apoptotic cells

While TUNEL assays for a specific aspect of apoptosis i.e. DNA damage, there are other markers of apoptosis that can be stained for. Table 2 lists a subset of antibodies that are commercially available or generated by various laboratories to detect pro-apoptotic proteins. The choice of apoptotic marker is dictated by how apoptosis was induced and in which cell type. Staining for apoptotic markers can also be performed in combination with TUNEL. Fixed samples or samples incubated with TdT (but before anti-digoxigenin staining) are prepared as follows.

  • Incubate in blocking buffer (2.7) for an hour at room temperature. Remove blocking buffer and rinse with PBT 3 times. Remove as much PBT as possible before proceeding to next step.

  • Add primary antibody solution (see Table 2) diluted appropriately in PBT and incubate either for 2 hours at room temperature or overnight at 4°C.

  • Wash samples 3 times with PBT, 5 minutes each.

  • Incubate with fluor-conjugated secondary antibody (Alexafluor, Life Technolgies) diluted 1:1000 in PBT for 1 hour at room temperature. If combining with TUNEL staining, include anti-digoxigenin antibody in the secondary antibody solution.

  • Counterstain and mount as described in TUNEL staining.

Table 2.

Antibodies for cell death markers

Antibody Source
cleaved-dcp-1 Cell Signaling Technology
cleaved caspase 3 Cell Signaling Technology
hid Santa Cruz, Hermann Steller, Hyung Don Ryoo
DIAP1 AbCam, Bruce Hay, Hyung Don Ryoo
Dronc Sharad Kumar
Drice Sharad Kumar
ATP5a (mitochondrial marker) AbCam
Cytochrome C Zymed
anti-βgal Sigma
Open in a new tab

The primary antibody incubation step has scope for optimization in antibody dilution ratios, incubation times and temperatures. Typically, primary antibody solutions can be reused by storing at 4°C in 0.01% sodium azide for up to a month.

Samples can be counterstained with a cytoskeletal marker such as fluor-conjugated Phalloidin (Life Technologies) to observe cellular and nuclear morphology. Early apoptotic nuclei have a condensed appearance. Mitochondrial markers show shattered-glass-like patterns in apoptotic cells. Staining for pro-apoptotic proteins such as hid show their localization to the mitochondria and appear as a punctate pattern. Unlike mammalian cells, cytochrome c release is not necessary for apoptosis in Drosophila so anti-cytochrome c antibodies are generally not used [52]. Several groups have generated antibodies against pro-apoptotic factors some of which are listed in Table 2. If using a lacZ reporter line, then an anti-βgal antibody can be used to visualize rpr or hid transcriptional activity.

Acridine Orange staining

Acridine Orange (AO) is a cell-permeable organic compound that is retained selectively by dying cells because of their internal pH imbalance[53]. Since AO is used primarily in live tissues, options for counterstaining samples with other markers are limited. AO staining is popularly used for screening large numbers of embryos[35] but can also be used in other tissues such as imaginal discs [54]. While the staining protocol for AO is brief, so is the time available to observe the tissue after staining.

  • For embryos: Add sufficient amount of AO stain (2.8) to dechorionated embryos and shake vigorously. Incubate for 5 minutes at room temperature. Mount the embryos from the interphase on to a glass slide and visualize in the green or red channel within fifteen minutes.

  • For tissues: Incubate freshly dissected tissues (not fixed) in 0.5–10 μg/ ml AO for 5 minutes at room temperature. The concentration of AO varies depending on tissue type and can be optimized. Mount tissues on glass slide and visualize as above.

3.2.2. Biochemical assays

A direct approach for quantifying cell death activity is by measuring hid and reaper levels by either western blotting (Table 2) or RT-PCR (Table 3). A broader method is measuring caspase activity. One method to assess caspase activity is by western blotting for cleaved caspase (anti-Dronc, -Drice) using antibodies described in Table 2. A more precise assessment of cell death can be obtained by measuring caspase activity using synthetic substrates. Several synthetic substrates have been developed and their catalysis can be measured colorimetrically or by fluorescence. DEVD-pNA is a peptide caspase substrate whose sequence is similar to the caspase cleavage site in PARP. Cells or tissues prepared as described in section 3.1 can be used in the assay as follows.

  • Add appropriate amount of lysis buffer (2.9) to samples and vortex intermittently for 10 minutes to enable complete lysis. Larger tissues or whole organisms can be homogenized in the lysis buffer using a pestle.

  • Clear lysate by centrifuging at 10, 0000 g for 10 minutes at 4°C. Lysates can be stored in −70°C for several weeks with minimal loss in caspase activity.

  • Mix lysate with equal volume of 2x reaction buffer (2.10). Add 10 μM (final) Z-DEVD-pNA or Ac-DEVD-pNA (SCBT) and incubate for 37°C for 1 hour.

  • Measure absorbance at 400 nM (or other wavelength depending on substrate). Samples maybe diluted to obtain readings in a linear range if necessary.

Table 3.

Primers for amplification of pro-apoptotic genes [56]

Gene Primer sequence
reaper AGTCACAGTGGAGATTCCTGG
TGCGATATTTGCCGGACTTTC
hid ACGGCCATCCGAATCCGAAC
TGCTGCTGCCGGAAGAAGAAGTT
Open in a new tab
Viability assays in S2 cells

An alternative to staining for cell death in cultured cells is to assess viability by using an exclusion dye such as trypan blue or an inclusion dye such as crystal violet. It is important to start with equal number of cells per sample so as to be able to compare values directly. Crystal violet staining is more suitable for high throughput experiments since it can be read using a plate reader. Crystal violet stains all cells adherent to the plate so it relies on the assumption that apoptotic cells will be washed away. Cells cultured in 6-well dishes and transfected or treated with appropriate apoptotic inducers are assayed as follows.

  • Aspirate culture media, add 250 μl fixative (2.11) and incubate for 15 minutes at room temperature.

  • Rinse 3 times with distilled water.

  • Incubate with 250 μl 0.5% crystal violet solution (Sigma Aldrich) for 30 minutes at room temperature on a shaker.

  • Rinsing with tap water 10 times to remove excess dye. Leave plates inverted on a paper towel to drain water completely.

  • Elute with 500 μl of 10% acetic acid for 10 minutes at room temperature on a shaker.

  • Diluted eluate in water 100-fold before measuring absorbance at 595 nm.

Trypan blue staining is more suitable for kinetic monitoring of samples. It is based on membrane impermeability of the blue dye thus negatively marking live cells. A suspension of S2 cells in PBS is mixed with trypan blue (Sigma) solution such that the final concentration of trypan blue is 0.04%. After incubating for 5 minutes at room temperature, the number of alive versus dead cells can be counted using a hemocytometer or a cell counter (Biorad). Other cell viability assays are reviewed in [55].

4. Notes

It is important to remember that acridine orange or trypan blue labeling should not be performed with fixed tissues. These assays work only when tissues contain live cells. By contrast, TUNEL or antibody labeling assays require prior fixation of tissues. The precise condition for antibody labeling may vary from tissues to tissues. For example, larval imaginal disc epithelium is an accessible tissue, and the PBT solution contains typically 0.2% of Triton X-100. However, embryos and adult eyes, brains are less permeable to antibodies, and require a higher concentration of Triton X-100 (we suggest 0.3%). If the quality of the antibody labeling is unsatisfactory, one might want to vary the concentration of Triton X-100 in PBS. Also amenable to trouble shooting is the concentration of formaldehyde in the fixative. Although 4% formaldehyde (or para-formaldehyde) is standard, there are antibody or TUNEL labeling protocols that use as low as 1% of formaldehyde fixative.

5. References

  • 1.Chen P, Rodriguez A, Erskine R, et al. Dredd, a novel effector of the apoptosis activators reaper, grim, and hid in Drosophila. Dev Biol. 1998;201:202–216. doi: 10.1006/dbio.1998.9000. doi: 10.1006/dbio.1998.9000. [DOI] [PubMed] [Google Scholar]
  • 2.Dorstyn L, Colussi PA, Quinn LM, et al. DRONC, an ecdysone-inducible Drosophila caspase. Proc Natl Acad Sci U S A. 1999;96:4307–4312. doi: 10.1073/pnas.96.8.4307. doi: 10.1073/pnas.96.8.4307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Doumanis J, Quinn L, Richardson H, Kumar S. STRICA, a novel Drosophila melanogaster caspase with an unusual serine/threonine-rich prodomain, interacts with DIAP1 and DIAP2. Cell Death Differ. 2001;8:387–394. doi: 10.1038/sj.cdd.4400864. doi: 10.1038/sj.cdd.4400864. [DOI] [PubMed] [Google Scholar]
  • 4.Fraser AG, Evan GI. Identification of a Drosophila melanogaster ICE/CED-3-related protease, drICE. EMBO J. 1997;16:2805–2813. doi: 10.1093/emboj/16.10.2805. doi: 10.1093/emboj/16.10.2805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Song Z, McCall K, Steller H. DCP-1, a Drosophila cell death protease essential for development. Science. 1997;275:536–540. doi: 10.1126/science.275.5299.536. doi: 10.1126/science.275.5299.536. [DOI] [PubMed] [Google Scholar]
  • 6.Dorstyn L, Read SH, Quinn LM, et al. DECAY, a novel Drosophila caspase related to mammalian caspase-3 and caspase-7. J Biol Chem. 1999;274:30778–30783. doi: 10.1074/jbc.274.43.30778. doi: 10.1074/jbc.274.43.30778. [DOI] [PubMed] [Google Scholar]
  • 7.Harvey NL, Daish T, Mills K, et al. Characterization of the Drosophila caspase, DAMM. J Biol Chem. 2001;276:25342–25350. doi: 10.1074/jbc.M009444200. doi: 10.1074/jbc.M009444200. [DOI] [PubMed] [Google Scholar]
  • 8.Hay BA, Wassarman DA, Rubin GM. Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death. Cell. 1995;83:1253–1262. doi: 10.1016/0092-8674(95)90150-7. doi: 10.1016/0092-8674(95)90150-7. [DOI] [PubMed] [Google Scholar]
  • 9.Leulier F, Ribeiro PS, Palmer E, et al. Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery. Cell Death Differ. 2006;13:1663–1674. doi: 10.1038/sj.cdd.4401868. doi: 10.1038/sj.cdd.4401868. [DOI] [PubMed] [Google Scholar]
  • 10.Vucic D, Kaiser WJ, Harvey AJ, Miller LK. Inhibition of reaper-induced apoptosis by interaction with inhibitor of apoptosis proteins (IAPs) Proc Natl Acad Sci U S A. 1997;94:10183–10188. doi: 10.1073/pnas.94.19.10183. doi: 10.1073/pnas.94.19.10183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Vernooy SY, Copeland J, Ghaboosi N, et al. Cell death regulation in Drosophila: conservation of mechanism and unique insights. J Cell Biol. 2000;150:F69–F76. doi: 10.1083/jcb.150.2.f69. doi: 10.1083/jcb.150.2.F69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Domingues C, Ryoo HD. Drosophila BRUCE inhibits apoptosis through non-lysine ubiquitination of the IAP-antagonist REAPER. Cell Death Differ. 2012;19:470–477. doi: 10.1038/cdd.2011.116. doi: 10.1038/cdd.2011.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Arama E, Agapite J, Steller H. Caspase activity and a specific cytochrome C are required for sperm differentiation in Drosophila. Dev Cell. 2003;4:687–697. doi: 10.1016/s1534-5807(03)00120-5. [DOI] [PubMed] [Google Scholar]
  • 14.Orme M, Meier P. Inhibitor of apoptosis proteins in Drosophila: gatekeepers of death. Apoptosis. 2009;14:950–960. doi: 10.1007/s10495-009-0358-2. doi: 10.1007/s10495-009-0358-2. [DOI] [PubMed] [Google Scholar]
  • 15.Kumar S. Caspase function in programmed cell death. Cell Death Differ. 2007;14:32–43. doi: 10.1038/sj.cdd.4402060. doi: 10.1038/sj.cdd.4402060. [DOI] [PubMed] [Google Scholar]
  • 16.Ryoo HD, Baehrecke EH. Distinct death mechanisms in Drosophila development. Curr Opin Cell Biol. 2010;22:889–895. doi: 10.1016/j.ceb.2010.08.022. doi: 10.1016/j.ceb.2010.08.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Grether ME, Abrams JM, Agapite J, et al. The head involution defective gene of Drosophila melanogaster functions in programmed cell death. Genes Dev. 1995;9:1694–1708. doi: 10.1101/gad.9.14.1694. [DOI] [PubMed] [Google Scholar]
  • 18.White K, Tahaoglu E, Steller H. Cell killing by the Drosophila gene reaper. Science. 1996;271:805–807. doi: 10.1126/science.271.5250.805. [DOI] [PubMed] [Google Scholar]
  • 19.Chen P, Nordstrom W, Gish B, Abrams JM. grim, a novel cell death gene in Drosophila. Genes Dev. 1996;10:1773–1782. doi: 10.1101/gad.10.14.1773. doi: 10.1101/gad.10.14.1773. [DOI] [PubMed] [Google Scholar]
  • 20.Christich A, Kauppila S, Chen P, et al. The damage-responsive Drosophila gene sickle encodes a novel IAP binding protein similar to but distinct from reaper, grim, and hid. Curr Biol. 2002;12:137–140. doi: 10.1016/s0960-9822(01)00658-3. doi: 10.1016/S0960-9822(01)00658-3. [DOI] [PubMed] [Google Scholar]
  • 21.Srinivasula SM, Datta P, Kobayashi M, et al. sickle, a novel Drosophila death gene in the reaper/hid/grim region, encodes an IAP-inhibitory protein. Curr Biol. 2002;12:125–130. doi: 10.1016/s0960-9822(01)00657-1. doi: 10.1016/S0960-9822(01)00657-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wing JP, Karres JS, Ogdahl JL, et al. Drosophila sickle is a novel grim-reaper cell death activator. Curr Biol. 2002;12:131–135. doi: 10.1016/s0960-9822(01)00664-9. [DOI] [PubMed] [Google Scholar]
  • 23.Yu X, Wang L, Acehan D, et al. Three-dimensional structure of a double apoptosome formed by the Drosophila Apaf-1 related killer. J Mol Biol. 2006;355:577–589. doi: 10.1016/j.jmb.2005.10.040. doi: 10.1016/j.jmb.2005.10.040. [DOI] [PubMed] [Google Scholar]
  • 24.Shapiro PJ, Hsu HH, Jung H, et al. Regulation of the Drosophila apoptosome through feedback inhibition. Nat Cell Biol. 2008;10:1440–1446. doi: 10.1038/ncb1803. doi: 10.1038/ncb1803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Handler A. Ecdysteroid titers during pupal and adult development in Drosophila melanogaster. Dev Biol. 1982;93:73–82. doi: 10.1016/0012-1606(82)90240-8. doi: 10.1016/0012-1606(82)90240-8. [DOI] [PubMed] [Google Scholar]
  • 26.Warren JT, Yerushalmi Y, Shimell MJ, et al. Discrete pulses of molting hormone, 20-hydroxyecdysone, during late larval development of Drosophila melanogaster: correlations with changes in gene activity. Dev Dyn. 2006;235:315–326. doi: 10.1002/dvdy.20626. doi: 10.1002/dvdy.20626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Baehrecke EH. Steroid regulation of programmed cell death during Drosophila development. Cell Death Differ. 2000;7:1057–1062. doi: 10.1038/sj.cdd.4400753. doi: 10.1038/sj.cdd.4400753. [DOI] [PubMed] [Google Scholar]
  • 28.Denton D, Aung-Htut MT, Kumar S. Developmentally Programmed Cell Death in Drosophila. Biochim Biophys Acta. 2013 doi: 10.1016/j.bbamcr.2013.06.014. doi: 10.1016/j.bbamcr.2013.06.014. [DOI] [PubMed] [Google Scholar]
  • 29.Abbott MK, Lengyel JA. Embryonic head involution and rotation of male terminalia require the Drosophila locus head involution defective. Genetics. 1991;129:783–789. doi: 10.1093/genetics/129.3.783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Miguel-Aliaga I, Thor S. Segment-specific prevention of pioneer neuron apoptosis by cell-autonomous, postmitotic Hox gene activity. Development. 2004;131:6093–6105. doi: 10.1242/dev.01521. doi: 10.1242/dev.01521. [DOI] [PubMed] [Google Scholar]
  • 31.Fichelson P, Gho M. The glial cell undergoes apoptosis in the microchaete lineage of Drosophila. Development. 2003;130:123–133. doi: 10.1242/dev.00198. [DOI] [PubMed] [Google Scholar]
  • 32.Macías A, Romero NM, Martín F, et al. PVF1/PVR signaling and apoptosis promotes the rotation and dorsal closure of the Drosophila male terminalia. Int J Dev Biol. 2004;48:1087–1094. doi: 10.1387/ijdb.041859am. doi: 10.1387/ijdb.041859am. [DOI] [PubMed] [Google Scholar]
  • 33.Wichmann A, Jaklevic B, Su TT. Ionizing radiation induces caspase-dependent but Chk2- and p53-independent cell death in Drosophila melanogaster. Proc Natl Acad Sci U S A. 2006;103:9952–9957. doi: 10.1073/pnas.0510528103. doi: 10.1073/pnas.0510528103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Choi YJ, Lee G, Park JH. Programmed cell death mechanisms of identifiable peptidergic neurons in Drosophila melanogaster. Development. 2006;133:2223–2232. doi: 10.1242/dev.02376. doi: 10.1242/dev.02376. [DOI] [PubMed] [Google Scholar]
  • 35.White K, Grether ME, Abrams JM, et al. Genetic control of programmed cell death in Drosophila. Science. 1994;264:677–683. doi: 10.1126/science.8171319. [DOI] [PubMed] [Google Scholar]
  • 36.Brodsky MH, Nordstrom W, Tsang G, et al. Drosophila p53 binds a damage response element at the reaper locus. Cell. 2000;101:103–113. doi: 10.1016/S0092-8674(00)80627-3. doi: 10.1016/S0092-8674(00)80627-3. [DOI] [PubMed] [Google Scholar]
  • 37.Thomas SE, Malzer E, Ordóñez A, et al. p53 and Translation Attenuation Regulate Distinct Cell Cycle Checkpoints during Endoplasmic Reticulum (ER) Stress. J Biol Chem. 2013;288:7606–7617. doi: 10.1074/jbc.M112.424655. doi: 10.1074/jbc.M112.424655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Brand AH, Perrimon N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993;118:401–415. doi: 10.1242/dev.118.2.401. [DOI] [PubMed] [Google Scholar]
  • 39.McGuire SE, Le PT, Osborn AJ, et al. Spatiotemporal rescue of memory dysfunction in Drosophila. Science. 2003;302:1765–1768. doi: 10.1126/science.1089035. doi: 10.1126/science.1089035. [DOI] [PubMed] [Google Scholar]
  • 40.Osterwalder T, Yoon KS, White BH, Keshishian H. A conditional tissue-specific transgene expression system using inducible GAL4. Proc Natl Acad Sci U S A. 2001;98:12596–12601. doi: 10.1073/pnas.221303298. doi: 10.1073/pnas.221303298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Lee T, Luo L. Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron. 1999;22:451–461. doi: 10.1016/s0896-6273(00)80701-1. [DOI] [PubMed] [Google Scholar]
  • 42.Del Valle Rodríguez A, Didiano D, Desplan C. Power tools for gene expression and clonal analysis in Drosophila. Nat Methods. 2012;9:47–55. doi: 10.1038/nmeth.1800. doi: 10.1038/nmeth.1800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Kanuka H, Hisahara S, Sawamoto K, et al. Proapoptotic activity of Caenorhabditis elegans CED-4 protein in Drosophila: implicated mechanisms for caspase activation. Proc Natl Acad Sci U S A. 1999;96:145–150. doi: 10.1073/pnas.96.1.145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Juhász G, Sass M. Hid can induce, but is not required for autophagy in polyploid larval Drosophila tissues. Eur J Cell Biol. 2005;84:491–502. doi: 10.1016/j.ejcb.2004.11.010. doi: 10.1016/j.ejcb.2004.11.010. [DOI] [PubMed] [Google Scholar]
  • 45.Abdelwahid E, Yokokura T, Krieser RJ, et al. Mitochondrial disruption in Drosophila apoptosis. Dev Cell. 2007;12:793–806. doi: 10.1016/j.devcel.2007.04.004. doi: 10.1016/j.devcel.2007.04.004. [DOI] [PubMed] [Google Scholar]
  • 46.Zhou L, Steller H. Distinct pathways mediate UV-induced apoptosis in Drosophila embryos. Dev Cell. 2003;4:599–605. doi: 10.1016/s1534-5807(03)00085-6. [DOI] [PubMed] [Google Scholar]
  • 47.Means JC, Muro I, Clem RJ. Lack of involvement of mitochondrial factors in caspase activation in a Drosophila cell-free system. Cell Death Differ. 2006;13:1222–1234. doi: 10.1038/sj.cdd.4401821. doi: 10.1038/sj.cdd.4401821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Nordstrom W, Chen P, Steller H, Abrams JM. Activation of the reaper gene during ectopic cell killing in Drosophila. Dev Biol. 1996;180:213–226. doi: 10.1006/dbio.1996.0296. doi: 10.1006/dbio.1996.0296. [DOI] [PubMed] [Google Scholar]
  • 49.Jiang C, Lamblin AF, Steller H, Thummel CS. A steroid-triggered transcriptional hierarchy controls salivary gland cell death during Drosophila metamorphosis. Mol Cell. 2000;5:445–455. doi: 10.1016/s1097-2765(00)80439-6. [DOI] [PubMed] [Google Scholar]
  • 50.Fan Y, Lee TV, Xu D, et al. Dual roles of Drosophila p53 in cell death and cell differentiation. Cell Death Differ. 2010;17:912–921. doi: 10.1038/cdd.2009.182. doi: 10.1038/cdd.2009.182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Steller H. Regulation of apoptosis in Drosophila. Cell Death Differ. 2008;15:1132–1138. doi: 10.1038/cdd.2008.50. doi: 10.1038/cdd.2008.50. [DOI] [PubMed] [Google Scholar]
  • 52.Dorstyn L, Read S, Cakouros D, et al. The role of cytochrome c in caspase activation in Drosophila melanogaster cells. J Cell Biol. 2002;156:1089–1098. doi: 10.1083/jcb.200111107. doi: 10.1083/jcb.200111107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.ROBBINS E, MARCUS PI. DYNAMICS OF ACRIDINE ORANGE-CELL INTERACTION. I. INTERRELATIONSHIPS OF ACRIDINE ORANGE PARTICLES AND CYTOPLASMIC REDDENING. J Cell Biol. 1963;18:237–250. doi: 10.1083/jcb.18.2.237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Bonini NM, Leiserson WM, Benzer S. The eyes absent gene: genetic control of cell survival and differentiation in the developing Drosophila eye. Cell. 1993;72:379–395. doi: 10.1016/0092-8674(93)90115-7. [DOI] [PubMed] [Google Scholar]
  • 55.Riss TL, Moravec RA, Niles AL, et al. Assay Guidance Manual. 2004. Cell Viability Assays. [Google Scholar]
  • 56.Morishita J, Kang MJ, Fidelin K, Ryoo HD. CDK7 Regulates the Mitochondrial Localization of a Tail-Anchored Proapoptotic Protein, Hid. Cell Rep. 2013;5:1481–1488. doi: 10.1016/j.celrep.2013.11.030. doi: 10.1016/j.celrep.2013.11.030. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES