Abstract
Introduction:
Staphylococcus aureus is a pathogen that causes food poisoning as well as hospital and community acquired infections.
Objective:
Establish the profile of superantigen genes among hospital isolates in relation to clinical specimen type, susceptibility to antibiotics and hospital or community acquisition.
Methods:
Eighty one isolates obtained from patients at Colombian hospital, were classified by antimicrobial susceptibility, specimen type and hospital or community acquired . The PCR uniplex and multiplex was used for detection of 22 superantigen genes (18 enterotoxins, tsst-1 and three exfoliative toxins).
Results:
Ninety five point one percent of isolates harbored one or more of the genes with an average of 5.6 genes. Prevalence of individual genes was variable and the most prevalent was seg (51.9%). Thirty nine genotypes were obtained, and the genotype gimnou (complete egc cluster) was the most prevalent alone (16.0%) and in association with other genes (13.6%). The correlation between presence of superantigens and clinical specimen or antimicrobial susceptibility showed no significant difference. But there was significant difference between presence of superantigens and the origin of the isolates, hospital or community acquired (p= 0.049).
Conclusions:
The results show the variability of the superantigen genes profile in hospital isolates and shows no conclusive relationship with the clinical sample type and antimicrobial susceptibility, but there was correlation with community and hospital isolates. The analysis of the interplay between virulence, epidemic and antibiotic resistance of bacterial populations is needed to predict the future of infectious diseases.
Keywords: Staphylococcus aureus, hospital infection, toxin, antibiotic resistance, microbial sensivity, genotype, genetic variation
Abstract
Introducción:
Staphylococcus aureus, es un patógeno que causa intoxicación alimentaria e infecciones hospitalarias y comunitarias.
Objetivo:
Establecer el perfil de genes de superantígenos en aislamientos hospitalarios correlacionándolos con el tipo de muestra clínica, susceptibilidad antimicrobiana y origen hospitalario o comunitario.
Métodos:
Se analizaron 81 aislamientos de S. aureus de pacientes de un hospital colombiano. Fueron clasificadas por susceptibilidad antimicrobiana, tipo de muestra clínica y origen hospitalario o comunitario. Se detectó por PCR individual y múltiple 22 genes de superantígenos (18 enterotoxinas, una toxina del choque tóxico-1 y tres toxinas exfoliativas).
Resultados:
El 95.1% albergaban uno o más genes de superantígenos con un promedio de 5.6 genes. La prevalencia individual fue variable y el gen con mayor prevalencia fue seg (51.9%). Se obtuvieron 39 genotipos, y el genotipo gimnou (cluster egc completo) fue el de mayor frecuencia (16.0%) y asociado con otros genes (13.6%). La correlación de superantígenos frente a tipo de muestra clínica y susceptibilidad antimicrobiana no mostró diferencia estadística significativa, pero hubo diferencia significativa con el tipo de aislamiento hospitalario o comunitario (p= 0.049).
Conclusiones:
Los resultados muestran la diversidad genética en los aislados hospitalarios respecto a la presencia de superantígenos y no muestra una relación concluyente con el tipo de muestra clínica y susceptibilidad antimicrobiana pero sí con origen de los aislamientos comunitarios y hospitalarios. Un análisis de la interrelación entre la virulencia, epidemicidad y resistencia antimicrobiana de las poblaciones bacterianas es necesario para predecir el futuro de las enfermedades infecciosas.
Introduction
Staphylococcus aureus is a major human pathogen capable of causing a wide range of infections, including skin and soft tissue infections, Healthcare-associated infections (nosocomial infections), food poisoning and life-threatening infections such as toxic shock syndrome, endocarditis, osteomyelitis, meningitis and pneumonia 1,2.
The pathogenicity of S. aureus is very complex, involving numerous bacterial products and sophisticated regulatory pathways 3. Many virulence factors have been described, such as antibiotic resistance, production of exotoxins and enzymes that contribute to its ability to colonize and cause disease 1,4.
Some strains produce one or more exoproteins, including staphylococcal enterotoxins (SE), toxic shock syndrome toxin (TSST-1), exfoliative toxins (ET) and leukocidins 4.
Superantigenicity is one of the most studied properties of this exoproteins, which refers to its ability to activate 20 to 30% of T lymphocytes with a massive production of pro-inflammatory cytokines and chemokines that can cause fever, hypotension and other disorders including potentially lethal shock 1,5,6.
There are five known types of classical enterotoxins (SEA to SEE), many new types of enterotoxins have been described, called nonclassical enterotoxins (SEG to SEU) 1,4,7-10 and more recently described, superantigen SElX (selx gene), that contributes to the lethality of a strain CA-MRSA in necrotizing pneumonia (community acquired-Methicillin Resistant S. aureus) 11.
Most types of enterotoxins are encoded in mobile genetic elements located on pathogenicity islands, transposons, plasmids, phages or highly variable genetic regions (vSaβ) 6,11. There is an enterotoxin gene cluster (egc) that groups the genes seg-sei-sem-seo-sen and sometimes seu, which has been linked to increased virulence of S. aureus strains and is the most commonly detected. It is located in the pathogenicity island vSA 9,12,13. Other genes of enterotoxins are detected in the methicillin resistance chromosomal cassette (SCCmec) 14.
Exfoliative toxins produced by S. aureus are responsible for the scalded skin syndrome (SSS), which causes the most sever bullous skin manifestations. It primarily affects infants and young children 15,16. ETs are classified as ETA, ETB, and ETD, ETA and ETB. ETB being the most frequent 17,18 and ETD the less frequent 19.
Recent studies show the prevalence of superantigen genes in S. aureus isolates from different sources and geographical regions. Some clinical studies have attempted to correlate the results of detection of superantigen genes in patients with S. aureus infections, but their relationship has not been elucidated 5,20,21.
The objective of the study was to establish the relationship between the profile of superantigen genes (SEs, ETs and TSST-1) to antiobiotic resistance, to clinical specimen type (blood, secretions, others specimens), and to hospital (HA: Hospital-Acquired) or community (CA: Community-Acquired) in isolates of S. aureus in order to try to establish the potential virulence of hospital isolates.
Materials and Methods
A prospective study was carried out with 81 isolates obtained between February 2009 and March 2011. Only S. aureus isolates from patients with diagnosis of Healthcare-associated infections of both sex and adult were included and excluded patients with polymicrobial infections and children. We analyzed only the first isolation cultured by the clinical laboratory. The study was approved and supervised by the Bioethics Committee of the Faculty of Health Sciences - Technological University of Pereira.
The identification of clinical isolates and antibiotic susceptibility were performed by Automated Systems for Susceptibility Testing (WalkAway/Microscan®, Dade Behring) at clinical laboratory of the Hospital Universitario San Jorge (Pereira-Colombia), this hospital is an institution providing health services II, III and IV levels of care, with 402 hospital beds and an average monthly hospital admissions and discharge of 2,100 and 1,700 patients, respectively. The levels of care correspond to the therapies and services provided.
The isolates were confirmed as S. aureus by PCR using primers: Sa442-1 5'-AAT CTT TGT CGG TAC ACG ATA TTC TTC ACG -3' and Sa442-2 5'-CGT AAT GAG ATT TCA GTA GAT AAT ACA ACA -3', to amplify a portion of the species-specific gene Sa442 of S. aureus 22.
Classification of S. aureus isolates
The isolates were classified according to the type of clinical specimen (blood, secretions, and others). Secretions which come from ears, eyes, muscle, burns, scalp, joint regions, osteosynthesis material, abscesses and wounds. Samples of devices such as catheters and tracheobronchial aspirates, pleural, peritoneal and cerebrospinal fluid and urine were classified as others. The isolates were also classified as resistance to one or more antibiotics and finally isolates were classified by the Hospital Universitario San Jorge as home hospital (HA) or community (CA).
DNA extraction
The CTAB (cetyltrimethylammonium bromide) genomic DNA extraction method was modified to use lysostaphin and the methodology described by Johnson et al 23. The extracted DNA was stored at -20° C in aliquots of 20 ng/μL for subsequent analysis by PCR
Identification of superantigen genes
All isolates were examined for 22 genes (sea to see, tsst-1, seg to ser, seu, eta, etb and etd) by PCR. Five reference strains were used as positive controls, containing one or more superantigens genes: ATCC 700699, ATCC BAA-1707, ATCC 13565, ATCC 13566 and ATCC 19095 (FRI137).
The nucleotide sequences for all the primers used in this study and their respective amplification products are described for other authors 10,18,24 ( Table 1).
Table 1. Primers, nucleotide sequence and the size of PCR amplification products.
| Gene | Primer sequence (5´- 3´) | Size (bp) | Reference |
|---|---|---|---|
| sea | GGT TAT CAA TGT GCG GGT GG | 102 | 24 |
| CGG CAC TTT TTT CTC TTC GG | |||
| seb | GTA TGG TGG TGT AAC TGA GC | 164 | 24 |
| CCA AAT AGT GAC GAG TTA GG | |||
| sec | AGA TGA AGT AGT TGA TGT GTA TGG | 451 | 24 |
| CAC ACT TTT AGA ATC AAC CG | |||
| sed | CCA ATA ATA GGA GAA AAT AAA AG | 278 | 24 |
| ATT GGT ATT TTT TTT CGT TC | |||
| see | AGG TTT TTT CAC AGG TCA TCC | 209 | 24 |
| CTT TTT TTT CTT CGG TCA ATC | |||
| tst | ACC CCT GTT CCC TTA TCA TC | 326 | 24 |
| TTT TCA GTA TTT GTA ACG CC | |||
| eta | GCA GGT GTT GAT TTA GCA TT | 93 | 24 |
| AGA TGT CCC TAT TTT TGC TG | |||
| etb | ACA AGC AAA AGA ATA CAG CG | 226 | 24 |
| GTT TTT GGC TGC TTC TCT TG | |||
| etd | AAC TAT CAT GTA TCA AGG | 376 | 18 |
| CAG AAT TTC CCG ACT CAG | |||
| seg | AAGTAGACATTTTTGGCGTTCC | 287 | 25 |
| AGAACCATCAAACTCGTATAGC | |||
| seh | GTCTATATGGAGGTACAACACT | 213 | 25 |
| GACCTTTACTTATTTCGCTGTC | |||
| sei | GGTGATATTGGTGTAGGTAAC | 454 | 25 |
| ATCCATATTCTTTGCCTTTACCAG | |||
| sej | ATAGCATCAGAACTGTTGTTCCG | 152 | 25 |
| CTTTCTGAATTTTACCACCAAAGG | |||
| sek | TAGGTGTCTCTAATAATGCCA | 293 | 25 |
| TAGATATTCGTTAGTAGCTG | |||
| sel | TAACGGCGATGTAGGTCCAGG | 383 | 25 |
| CATCTATTTCTTGTGCGGTAAC | |||
| sem | GGATAATTCGACAGTAACAG | 379 | 25 |
| TCCTGCATTAAATCCAGAAC | |||
| sen | TATGTTAATGCTGAAGTAGAC | 282 | 25 |
| ATTTCCAAAATACAGTCCATA | |||
| seo | TGTGTAAGAAGTCAAGTGTAG | 214 | 25 |
| TCTTTAGAAATCGCTGATGA | |||
| sep | TGATTTATTAGTAGACCTTGG | 396 | 25 |
| ATAACCAACCGAATCACCAG | |||
| seq | AATCTCTGGGTCAATGGTAAGC | 122 | 25 |
| TTGTATTCGTTTTGTAGGTATTTTCG | |||
| ser | GGATAAAGCGGTAATAGCAG | 166 | 25 |
| GTATTCCAAACACATCTAAC | |||
| seu | ATTTGCTTTTATCTTCAT | 167 | 10 |
| GGACTTTAATGTTTGTTTCTGAT | |||
| fem A | AAAAAAGCACATAACAAGCG | 132 | 24 |
| GATAAAGAAGAAACCAGCAG | |||
| fem B | TTACAGAGTTAACTGTTACC | 651 | 25 |
| ATACAAATCCAGCACGCTCT |
Multiplex PCR
Two sets of multiplex PCR were used to detect classical enterotoxins genes (sea to see), toxic shock syndrome toxin (tsst-1) and exfoliative toxins (eta y etb). The internal control of the reactions was a couple of primers femA, that amplified a 132 bp fragment of the femA gene (structural component of peptidoglycan, associated to methicillin resistance) 10,18,24. Reference ATCC strains were used as positive controls and sterile distilled water as negative control.
Multiplex PCR series A included primers for genes sea, seb, sec, sed, see and femA. The amplification reaction was performed in a final volume of 25 µL, containing 1X buffer (50 mM KCl, 10 mM Tris-HCl, pH 9.0), 3 mM MgCl2, 200 µM dNTPs, 20 pmol each of the primers sea, seb, sec and see, 40 pmoles of primer sed, 1 U of Taq polymerase (Invitrogen) and 1 µL of DNA at a concentration of 20 ng/µL. Amplification was performed in a thermocycler (Perkin Elmer GeneAmp 9700), under the following conditions: denaturation at 94º C for 1 min, annealing at 61º C for 30 s and extension at 74º C for 1 min, for 35 cycles 24.
Multiplex PCR series B included the primers for exfoliative toxins A and B genes and the toxic shock syndrome toxin (TSST-1). The amplification reaction had the same constituents and concentrations of the amplification reaction for the series A, except for the primer eta that must be 50 pmoles, as stated in Mehrotra et al 24. For tst-1 and etb is 20 pmoles. Amplification temperatures and cycles are as described for the set A.
Individual PCR (Uniplex)
Was used to detect nonclassical enterotoxin genes: seg to ser, seu, and exfoliative toxin etd. Gene FemB primers were used as an internal control of the reactions, which is also an essential factor for the expression of methicillin resistance 25. Reference ATCC strains were used as positive control and sterile distilled water negative control.
The reaction mixture (25 µL) consisted of 20 pmol of each primer, 2.5 mM MgCl2, 200 µM of each oligonucleotide, 1 U of Taq DNA polymerase and 1X buffer. Thermocycler conditions were: denaturation at 94º C for 30 s, annealing at 55º C for 30 s, and extension at 72º C for 60 s for 30 cycles 25.
Detection and analysis of all the amplified products was performed by 2% agarose gel electrophoresis stained with ethidium bromide.
Statistical analysis
Contingency tables were prepared and different correlations were analyzed between the presence or absence of superantigens genes against antimicrobial resistance, clinical specimen type, source of isolation of S. aureus, hospital or community acquired. Fisher's exact test was applied and p ≤0.05 with a confidence interval of 95%, were considered statistically significant.
Results
Eighty one isolates of S. aureus identified by Automated Systems for Susceptibility Testing and were confirmed by Sa442 gene amplification (100%). The distributions of isolates between genders were 48.1% (39/81) for male with an average of 6.2 genes detected and 51.9% (42/81) for female with an average of 4.9 genes. No statistically significant difference (p= 0.37).
Classification of S. aureus isolates according to the type clinical specimen
Clinical isolates of S. aureus were classified according to the type of clinical sample: 23 blood isolates (28.4%), 39 from secretions (48.1%) and 19 clinical specimens were classified as others (23.5%).
Antimicrobial susceptibility in S. aureus isolates
Antimicrobial susceptibility indicated that 6 isolates (7.4%) were susceptible to all 12 antimicrobial group´s (26 antimicrobials) tested and 75 (92.6%) were resistant to one or more antibiotics. The resistance range varied from 92.6% (75/81) for Beta- Lactam to 1.2% (1/81) to rifamycin. Additionally, 31 isolates was resistant for oxacillin (38.7%) phenotypically classified as MRSA isolates (Table 2).
Table 2. Antimicrobial group's susceptibility in S. aureus isolates. N= 81.
| Antimicrobial group | S | % | R | % |
|---|---|---|---|---|
| Beta-Lactam | 6 | 7.4 | 75.0 | 92.6 |
| Chloranphenicol | 81 | 100 | 0 | 0.0 |
| Quinolones | 54 | 66.7 | 277 | 33.3 |
| Clindamycin | 54 | 66.7 | 277 | 33.3 |
| Macrolide | 43 | 53.1 | 381 | 46.9 |
| Fusidic acid | 81 | 100 | 0 | 0.0 |
| Aminoglycoside | 56 | 69.1 | 251 | 30.9 |
| Nitrofurantoin | 81 | 100 | 0 | 0.0 |
| Rifamycin | 80 | 98.8 | 1 | 1.2 |
| Tetracycline | 59 | 72.8 | 228 | 27.2 |
| Trimethoprim/Sulfonamide | 81 | 100 | 0 | 0.0 |
| Glycopeptide | 81 | 100 | 0 | 0.0 |
S= sensivity
R= resistance
Prevalence and distribution of the genes encoding superantigens
The prevalence of the 22 genes detected by PCR in the 81 isolates of S. aureus was 95.1% (77/81) and in 4.9% (4/81) no genes were detected. The range of genes detected was at least 2 genes in 11 isolates (13.6%) and up to 13 genes in 6 isolates (7.5%), for an average of 5.9 genes.
The distribution of genes showed 39 genotypes and the genotype gimnou (complete egc cluster) was the most prevalent (16.0%) and associated with other genes (13.6%) followed by sek-seq with 18.4% and 42.0% of the genotypes had different combinations of genes.
The prevalence of individual genes was variable and seg was the most prevalent gene (51.9%), followed by seq (45.7%) and the lowest prevalence was eta (2.5%). No sep, ser or etb genes were detected. The difference was marked between classical enterotoxins with a gene average of 0.44 and with 4.0 for nonclassical genes (Table 3).
Table 3. Profile of superantigen genes distributed as classical, nonclassical, toxic shock syndrome toxin and exfoliative toxins in clinical isolates of S. aureus.
| Variables | Gene | NP | % |
|---|---|---|---|
| Classical superantigens | sea | 9 | 11.1 |
| seb | 8 | 9.9 | |
| sec | 13 | 16.0 | |
| sed | 3 | 3.7 | |
| see | 3 | 3.7 | |
| Toxic shock syndrome toxin | tsst-1 | 5 | 6.2 |
| Nonclassical superantigens | seg | 42 | 51.9 |
| seh | 29 | 35.8 | |
| sei | 36 | 44.4 | |
| sej | 3 | 3.7 | |
| sek | 25 | 30.9 | |
| sel | 18 | 22.2 | |
| sem | 27 | 33.3 | |
| sen | 36 | 44.4 | |
| seo | 30 | 37.0 | |
| seq | 37 | 45.7 | |
| seu | 41 | 50.6 | |
| Exfoliative toxin | eta | 2 | 2.5 |
| etd | 34 | 42.0 |
NP= number positive
Correlation between the presence of superantigen genes and antimicrobial susceptibility
In 6 antimicrobial susceptible isolates 6.2% (5/81) superantigen genes were detected and 1.2% had none. In resistant, 92.6% had them, in the latter case there were no resistant isolates without superantigens. No significant difference (p= 0.074) (Table 4).
Table 4. Relationship between superantigens genes with antimicrobial susceptibility, hospital or community origin and type of clinical sample.
| Superantigens | Antimicrobial susceptibility | Acquired place | Type clinical specimen | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| S | % | R | % | HA | % | CA | % | Blood | % | Secretion | % | Other | % | |
| SAg+ | 5 | 6.2 | 75 | 92.6 | 35 | 43.2 | 42 | 51.9 | 21 | 25.9 | 37 | 45.7 | 19 | 23.5 |
| SAg- | 1 | 1.2 | 0 | 0.0 | 4 | 4.9 | 0 | 0.0 | 2 | 2.5 | 2 | 2.5 | 0 | 0.0 |
| Total | 6 | 7.4 | 75 | 92.6 | 39 | 48.1 | 42 | 51.9 | 23 | 28.4 | 39 | 48.1 | 19 | 23.5 |
| p | 0.074 | 0.049 | 0.566 | |||||||||||
SAg: superantigen. S: susceptible; R: resistantance. HA: Hospital-Acquired; CA: Community-Acquired. p: Fisher's exact test.
Beta-Lactam were the only group that showed statistically significant difference (p <0.05) in the correlation between the superantigens genes and antimicrobial group's susceptibility in S. aureus isolates.
Correlation between the presence of superantigen genes and type of hospital and community isolate
Table 4 shows the detection of superantigen genes according to the origin HA or CA, where 43.2% (35/81) isolates for HA had one or more SAg genes and 59.9% (42/81) of CA isolates had one or more superantigens genes of with statistically significant difference (p= 0.049).
Correlation between the presence of superantigen genes and the type of clinical sample
Of the 23 isolates from blood specimens, 21 (25.9%) had one or more genes with an average of 5.2 superantigen genes. For secretion, of the 39 isolates, 37 (45.7%) genes were detected with an average of 5.8 genes, and for the 19 isolates classified as other specimens, all genes were detected (23.5%) with an average of 6.9 genes. Statistical analysis by Fisher's exact test showed no significant difference (p= 0.566) (Table 4).
Discussion
Staphylococcus aureus is the second most isolated pathogen from infections at the Hospital Universitario San Jorge de Pereira as well as in all the hospitals around Colombia 26. 95.1% of all isolates contained at least one superantigen gene. High prevalence has also been reported by Varshney et al., 99% 5, Chiang et al., 91.8% 10, Xie et al., 90.7% 27 and Omoe et al., 77.4% 25.
The prevalence of individual genes varied as reported by other researchers 5,6,10. The most common single gene in the study was seg (51.9%) which also has been reported by other studies 6,10, 25. In Colombia, Portillo et al. 28, found the seg gene at 94% in isolated MRSA.
For other genes, in contrast to Portillo, we detected tsst, sea, seb, sec, seh and sel but not sep, ser and etb genes, this indicates heterogeneity genetic of S. aureus intro the same country. This indicates that the presence of individual genes or associations between them is very diverse in all isolates of S. aureus regardless of origin.
The number of genotypes detected was 39, similar to that reported by Omoe et al. 25, and greater than that reported by Kuroda et al. 9, which allows us to infer that the number of genotypes is variable and dependent to the type of strain and the geographic area from which the isolate proceeded.
The presence of the full egc cluster or in coexistence with other SAgs in this study is consistent with other reports of its prevalence 5,6,12,29 and lower than that reported by Portillo et al. 28, An interesting fact was the detection of the gene couple sek-seq (18.5%) associated with phage φ-3 followed in frequency the egc cluster; the couple sed-sej encoded on plasmid pIB485 reported by Varshney et al., was not found 5.
In this study no significant differences were established between the presence of superantigens and type of clinical specimen (blood, secretions, and others) and the same happened when compared with antimicrobial susceptibility. The only relationship that showed a significant difference was the comparison between the presence of superantigens against hospital (HA) or community (CA) origin.
Conclusions
The high detection and the variety of arrangements of superantigen genes in hospital isolates of S. aureus demonstrate their virulence, and their presence allows differentiation between CA and HA isolates.
No correlation was established between superantigens and carry genes for antibiotic resistance or type of clinical specimen. In future studies it will be necessary to establish the importance of the egc cluster as a possible marker for virulence in S. aureus isolates.
It is important to note that one limitation of the study was unable to establish superantigen gene expression in vitro. The detection de superantigens proteins will be made in future research to determine the true virulence in hospital isolates of S. aureus.
Today, the analysis of the interplay between virulence, epidemic and antibiotic resistance of bacterial populations is needed to predict the future of infectious diseases.
Acknowledgements:
The research team expresses sincere gratitude to the Universidad Tecnológica de Pereira, for their generous funding (project code 05-09-8) and support for the development of research. We express also our gratitude to the group of bacteriologists and directives of the Hospital San Jorge, ESE Pereira for donating the S. aureus isolates
Footnotes
Funding: The project was funded entirely by the Vicerrectoría de Investigaciones, Innovación y Extensión of the Universidad Tecnológica de Pereira
References
- 1.Larkin EA, Carman RJ, Krakauer T, Stiles BG. Staphylococcus aureus: The toxic presence of a pathogen extraordinaire. Current Medicinal Chemistry. 2009;16:4003–4019. doi: 10.2174/092986709789352321. [DOI] [PubMed] [Google Scholar]
- 2.Bronner S, Monteil H, Prévost G. Regulation of virulence determinants in Staphylococcus aureus: complexity and applications. FEMS Microbiology Reviews. 2004;28:183–200. doi: 10.1016/j.femsre.2003.09.003. [DOI] [PubMed] [Google Scholar]
- 3.François P, Scherl A, Hochstrasser D, Schrenzel J. Proteomic approaches to study Staphylococcus aureus pathogenesis. J Proteomics. 2010;73:701–708. doi: 10.1016/j.jprot.2009.10.007. [DOI] [PubMed] [Google Scholar]
- 4.Dinges MM, Orwin PM, Schlievert PM. Exotoxins of Staphylococcus aureus. Clin Microbiol Rev. 2000;13:16–34. doi: 10.1128/cmr.13.1.16-34.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Varshney AK, Mediavilla JR, Robiou N, Guh A, Wang X, Gialanella P, et al. Diverse enterotoxin gene profiles among clonal complexes of Staphylococcus aureus isolates from the Bronx, New York. Appl Environ Microbiol. 2009;75(21):6839–6849. doi: 10.1128/AEM.00272-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Holtfreter S, Grumann D, Schmudde M, Nguyen H, Eichler P, Strommenger B, et al. Clonal distribution of superantigen genes in clinical Staphylococcus aureus isolates. J Clin Microbiol. 2007;45:2669–2680. doi: 10.1128/JCM.00204-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.McCormick JK, Yarwood JM, Schlievert PM. Toxic shock syndrome and bacterial superantigens: an update. Ann Rev Microbiol. 2001;55:77–104. doi: 10.1146/annurev.micro.55.1.77. [DOI] [PubMed] [Google Scholar]
- 8.Jarraud S, Peyrat MA, Lim A, Tristan A, Bes M, Mougel C, et al. egc, a highly prevalent operon of enterotoxin gene.forms a putative nursery of superantigens in Staphylococcus aureus. J Immunol. 2001;166:669–677. doi: 10.4049/jimmunol.166.1.669. [DOI] [PubMed] [Google Scholar]
- 9.Kuroda M, Ohta T, Uchiyama I, Baba T, Yuzawa H, Kobayashi I, et al. Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet. 2001;357:1225–1239. doi: 10.1016/s0140-6736(00)04403-2. [DOI] [PubMed] [Google Scholar]
- 10.Chiang YC, Liao WW, Fan CM, Pai WY, Chiou CS, Tsen HY. PCR detection of Staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SE types in Staphylococcus aureus isolates from food-poisoning cases in Taiwán. Int J Food Microbiol. 2008;121(1):66–73. doi: 10.1016/j.ijfoodmicro.2007.10.005. [DOI] [PubMed] [Google Scholar]
- 11.Wilson G, Seo KS, Cartwright RA, Connelley T, Chuang-Smith ON, Merriman J, et al. A novel core genome-encoded superantigen contributes to lethality of community-associated MRSA necrotizing pneumonia. PLoS Pathog. 2011;7(10):e1002271–e1002271. doi: 10.1371/journal.ppat.1002271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Blaiotta G, Fusco V, von Eiff C, Villani F, Becker K . Biotyping of enterotoxigenic Staphylococcus aureus by enterotoxin gene cluster (egc) polymorphism and spa typing analyses. Appl Environ Microbiol. 2006;72(9):6117–6123. doi: 10.1128/AEM.00773-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Lindsay JA, Holden MT. Understanding the rise of the superbug: investigation of the evolution and genomic variation of Staphylococcus aureus. Funct Integr Genomics. 2006;6(3):186–201. doi: 10.1007/s10142-005-0019-7. [DOI] [PubMed] [Google Scholar]
- 14.Baba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki K, Oguchi A, et al Genome and virulence determinants of high virulence community-acquired MRSA. Lancet. 2002;359:1819–1827. doi: 10.1016/s0140-6736(02)08713-5. [DOI] [PubMed] [Google Scholar]
- 15.Ladhani S, Joannou CL, Lochrie DP, Evans RW, Poston SM. Clinical, microbial, and biochemical aspects of the exfoliative toxins causing staphylococcal scalded-skin syndrome. Clin Microbiol Rev. 1999;12:224–242. doi: 10.1128/cmr.12.2.224. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Plano LR. Staphylococcus aureus exfoliative toxins: how they cause disease. J Invest Dermatol. 2004;122:1070–1077. doi: 10.1111/j.1523-1747.2004.22144.x. [DOI] [PubMed] [Google Scholar]
- 17.Kondo I, Sakurai S, Sarai Y, Futaki S. Two serotypes of exfoliation and their distribution in staphylococcal strains isolated from patients with scalded-skin syndrome. J Clin Microbiol. 1975;1:397–400. doi: 10.1128/jcm.1.5.397-400.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ruzicková V, Voller J, Pantucek R, Petrás P, Doskar J. Multiplex PCR for detection of three exfoliative toxin serotype genes in Staphylococcus aureus. Folia Microbiol. 2005;50:499–502. doi: 10.1007/BF02931437. [DOI] [PubMed] [Google Scholar]
- 19.Yamaguchi T, Hayashi T, Takami H, Ohnishi M. Murata T, Nakayama K. et al. Complete nucleotide sequence of Staphylococcus aureus exfoliative toxin B plasmid and identification of a novel ADP-ribosyltransferase, EDIN-C. Infect Immun. 2001;69:7760–7771. doi: 10.1128/IAI.69.12.7760-7771.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Ferry T, Thomas D, Perpoint T, Lina G, Monneret G, Mohammedi I, et al. Analysis of superantigenic toxin Vbeta T-cell signatures produced during cases of staphylococcal toxic shock syndrome and septic shock. Clin Microbiol Infect. 2008;14:546–554. doi: 10.1111/j.1469-0691.2008.01975.x. [DOI] [PubMed] [Google Scholar]
- 21.Fleischer B, Schrezenmeier H. T cell stimulation by staphylococcal enterotoxins. Clonally variable response and requirement for major histocompatibility complex class II molecules on accessory or target cells. J Exp Med. 1988;167:1697–1707. doi: 10.1084/jem.167.5.1697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Martineau F, Picard JR, Roy PR, Ouellette M, Bergeron MG. Species-specific and ubiquitous-DNA-based assays for rapid identification of Staphylococcus aureus. J Clin Microbiol. 1998;36:618–623. doi: 10.1128/jcm.36.3.618-623.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Johnson WM, Tyler SD, Ewan EP, Pollard DR, Rozee KR. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J Clin Microbiol. 1991;29(3):426–430. doi: 10.1128/jcm.29.3.426-430.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Mehrotra M, Wang G, Johnson WM. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol. 2000;38:1032–1035. doi: 10.1128/jcm.38.3.1032-1035.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Omoe K, Hu DL, Takahashi-Omoe H, Nakane A, Shinagawa K. Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiol Lett. 2005;246:191–198. doi: 10.1016/j.femsle.2005.04.007. [DOI] [PubMed] [Google Scholar]
- 26.Briceño DF, Correa A, Torres JA, Pacheco R, Grupo de Resistencia Bacteriana Nosocomial de Colombia Actualización de la resistencia a antimicrobianos de bacilos Gram negativos aislados en hospitales de nivel III de Colombia: años 2006, 2007 y 2008. Biomédica. 2010;30:371–381. [PubMed] [Google Scholar]
- 27.Xie Y, He Y, Gehring A, Hu Y, Li Q, Tu S, Shi X. Genotypes and toxin gene profiles of Staphylococcus aureus clinical isolates from China. PLos One. 2011;6(12): doi: 10.1371/journal.pone.0028276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Portillo B, Moreno J, Yomayusa N, Alvarez C, Castro B, Escobar J, et al. Molecular epidemiology and characterization of virulence genes of community- acquired and hospital-acquired methicillin-resistan Staphylococcus aureus isolates in Colombia. Int J Inf Dis. 2013;17:e744–e749. doi: 10.1016/j.ijid.2013.02.029. [DOI] [PubMed] [Google Scholar]
- 29.van Belkum A, Melles DC, Snijders SV, van Leeuwen WB, Wertheim HF, Nouwen JL, et al. Clonal distribution and differential occurrence of the enterotoxin gene cluster, egc, in carriage- versus bacteremia-associated isolates of Staphylococcus aureus. J Clin Microbiol. 2006;44:1555–1557. doi: 10.1128/JCM.44.4.1555-1557.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]